HBVdb

Dataset for nucleotide sequence S of genotype D

[Download (right click)] [Alignment] [Repertoires]

5020 sequence(s)

>gnl|hbvcds|AB048701_S_P-D Feature FT:CDS AB048701_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtgttggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttac
cgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB078031_S_P-D Feature FT:CDS AB078031_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FH1-YS). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB078032_S_P-D Feature FT:CDS AB078032_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AH1-SY). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB078033_S_P-D Feature FT:CDS AB078033_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IS1-OY). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB090268_S_P-D Feature FT:CDS AB090268_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggacccccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB090269_S_P-D Feature FT:CDS AB090269_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatctccaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB090270_S_P-D Feature FT:CDS AB090270_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB104709_S_P-D Feature FT:CDS AB104709_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG64). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB104710_S_P-D Feature FT:CDS AB104710_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG105). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB104711_S_P-D Feature FT:CDS AB104711_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG104). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcaaacctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtcttgggggccaagtctgtgcagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB104712_S_P-D Feature FT:CDS AB104712_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG75). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109475_S_P-D Feature FT:CDS AB109475_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109476_S_P-D Feature FT:CDS AB109476_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109477_S_P-D Feature FT:CDS AB109477_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109478_S_P-D Feature FT:CDS AB109478_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109479_S_P-D Feature FT:CDS AB109479_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttccaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109480_S_P-D Feature FT:CDS AB109480_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109481_S_P-D Feature FT:CDS AB109481_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaattctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109482_S_P-D Feature FT:CDS AB109482_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatctgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagactgtgcagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109483_S_P-D Feature FT:CDS AB109483_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgcagctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggcaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109484_S_P-D Feature FT:CDS AB109484_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109485_S_P-D Feature FT:CDS AB109485_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109486_S_P-D Feature FT:CDS AB109486_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109487_S_P-D Feature FT:CDS AB109487_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatctgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AB109488_S_P-D Feature FT:CDS AB109488_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB110075_S_P-D Feature FT:CDS AB110075_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116266_S_P-D Feature FT:CDS AB116266_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB119251_S_P-D Feature FT:CDS AB119251_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB119252_S_P-D Feature FT:CDS AB119252_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB119253_S_P-D Feature FT:CDS AB119253_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB119254_S_P-D Feature FT:CDS AB119254_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB119255_S_P-D Feature FT:CDS AB119255_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatctgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagactgtgcagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB119256_S_P-D Feature FT:CDS AB119256_S_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB120308_S_P-D Feature FT:CDS AB120308_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggacccccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB126581_S_P-D Feature FT:CDS AB126581_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU301). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctggacgactcctggtcaaggaacctctatgt
atccctcctggtgctggaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB188241_S_P-D Feature FT:CDS AB188241_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KAMCHATKA25). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtcta
tcctctaattccaggatcgtcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB188242_S_P-D Feature FT:CDS AB188242_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KAMCHATKA38). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcgaccaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB188244_S_P-D Feature FT:CDS AB188244_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZ24). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ggccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcktggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB205126_S_P-D Feature FT:CDS AB205126_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-IF714-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205127_S_P-D Feature FT:CDS AB205127_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU313-2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttctcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205128_S_P-D Feature FT:CDS AB205128_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU316-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcttcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaagtaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttccccttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ctccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB210820_S_P-D Feature FT:CDS AB210820_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgcacaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB210821_S_P-D Feature FT:CDS AB210821_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB210822_S_P-D Feature FT:CDS AB210822_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222709_S_P-D Feature FT:CDS AB222709_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV34). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccgggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222710_S_P-D Feature FT:CDS AB222710_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNVC6M). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctgctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222711_S_P-D Feature FT:CDS AB222711_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNV24). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222712_S_P-D Feature FT:CDS AB222712_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV61). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatctkgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB222713_S_P-D Feature FT:CDS AB222713_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNVC6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222782_S_P-D Feature FT:CDS AB222782_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CN608). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcanggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggcaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB246347_S_P-D Feature FT:CDS AB246347_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcgaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB246348_S_P-D Feature FT:CDS AB246348_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaagttcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatat
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB267090_S_P-D Feature FT:CDS AB267090_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ehime 22-HS). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270537_S_P-D Feature FT:CDS AB270537_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL22F). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270539_S_P-D Feature FT:CDS AB270539_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL200F). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270540_S_P-D Feature FT:CDS AB270540_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL241F). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagaatgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270541_S_P-D Feature FT:CDS AB270541_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL47F). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagaatgwrcagcatcttgagtccctttttac
cgctgtkaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270542_S_P-D Feature FT:CDS AB270542_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL12F). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270543_S_P-D Feature FT:CDS AB270543_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL209F). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270546_S_P-D Feature FT:CDS AB270546_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL88F). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatga
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270547_S_P-D Feature FT:CDS AB270547_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL295F). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaacatgcagaacctgcacgacccctgctcgcggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB270548_S_P-D Feature FT:CDS AB270548_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL207F). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctcgactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270549_S_P-D Feature FT:CDS AB270549_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL79F). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctatcctccaacttgacctggttatcgctggatgtgtcggcagcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatat
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270550_S_P-D Feature FT:CDS AB270550_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL247F). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB330367_S_P-D Feature FT:CDS AB330367_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ14HBV). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctaac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgcttgatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttg
ccctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB330369_S_P-D Feature FT:CDS AB330369_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ5HBV). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB330370_S_P-D Feature FT:CDS AB330370_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ6HBV). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|AB471856_S_P-D Feature FT:CDS AB471856_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3O-C1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB471857_S_P-D Feature FT:CDS AB471857_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3O-C2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB493846_S_P-D Feature FT:CDS AB493846_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17UC). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB555496_S_P-D Feature FT:CDS AB555496_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA31). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggggccctgctaatgatacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AB555497_S_P-D Feature FT:CDS AB555497_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA37). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcctggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AB555500_S_P-D Feature FT:CDS AB555500_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA64). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctgctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgctcaacaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AB555501_S_P-D Feature FT:CDS AB555501_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA65). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttatgtctttgggtattcatataa
>gnl|hbvcds|AB561825_S_P-D Feature FT:CDS AB561825_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggactttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561826_S_P-D Feature FT:CDS AB561826_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F11). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtgcccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561827_S_P-D Feature FT:CDS AB561827_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ED84_PRES2+S). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561828_S_P-D Feature FT:CDS AB561828_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ED271). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561829_S_P-D Feature FT:CDS AB561829_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F34-son-c). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaytgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttmc
cgctgttaccaattttcttttgtcttagggtatacattt
>gnl|hbvcds|AB561830_S_P-D Feature FT:CDS AB561830_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ED226_PRES2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcaatttactagcgccatttgttcagtggttcgtcgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561831_S_P-D Feature FT:CDS AB561831_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ED275_PRES2+S). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtwtg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561832_S_P-D Feature FT:CDS AB561832_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F4-daughter). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcatgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacattt
>gnl|hbvcds|AB561833_S_P-D Feature FT:CDS AB561833_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F4-grand-duaghter). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcatgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacattt
>gnl|hbvcds|AB561834_S_P-D Feature FT:CDS AB561834_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F4-grandmother). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcnaggtatgttgcccgyttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaayctctatgt
atccctcctgwtgctgtaccaarccttcggacggaaaytgcacctgtattmccatsmyatcgtcatgsgctttcgcaaaa
ttgctatgggagtgggcctcagcmcgtttctcctggctcagwttactagtgccattygttcagtggttcgyagggctctc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagmctgtacagcatcttgagtccctttttrc
cgctgttaccaattatcttttgtctctgggtatacattt
>gnl|hbvcds|AB561835_S_P-D Feature FT:CDS AB561835_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F4 daughter). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccmgcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561836_S_P-D Feature FT:CDS AB561836_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ED169). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaagactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttactaactttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561837_S_P-D Feature FT:CDS AB561837_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F37-Wife). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttwcaggcggggtttttcttgttgacaagaatcctcaa
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgctcagtggttcgtagagctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561838_S_P-D Feature FT:CDS AB561838_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F37-Husband). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaa
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgctcagtggttcgtagagctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttctgtctttgggtatacattt
>gnl|hbvcds|AB561839_S_P-D Feature FT:CDS AB561839_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3-Daughter). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561840_S_P-D Feature FT:CDS AB561840_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3-Mother). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcyaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561842_S_P-D Feature FT:CDS AB561842_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ED86). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaccatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561843_S_P-D Feature FT:CDS AB561843_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F34-son-D). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561844_S_P-D Feature FT:CDS AB561844_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F35-Father). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtttccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561845_S_P-D Feature FT:CDS AB561845_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F35-Daughter). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtttccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561846_S_P-D Feature FT:CDS AB561846_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F43-Daughter). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtcccaaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactgctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561847_S_P-D Feature FT:CDS AB561847_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F43-Father). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtcccaaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactgctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561848_S_P-D Feature FT:CDS AB561848_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F55). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctatacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561849_S_P-D Feature FT:CDS AB561849_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F19-Husband). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561850_S_P-D Feature FT:CDS AB561850_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F4-grand-daughter). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcatgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacattt
>gnl|hbvcds|AB561851_S_P-D Feature FT:CDS AB561851_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ED124). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccgggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcaccttgagtccctatttac
cgctgttactaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561852_S_P-D Feature FT:CDS AB561852_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ED161). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacattacatcaggattcctagcacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcgtcaaacaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctcagt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgtcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|AB561853_S_P-D Feature FT:CDS AB561853_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F36-Brother). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtctcctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtatcaaaccttcggacggaaattgcacatgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatat
>gnl|hbvcds|AB561854_S_P-D Feature FT:CDS AB561854_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F45). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttctcgttggttctcctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactmctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatat
>gnl|hbvcds|AB561855_S_P-D Feature FT:CDS AB561855_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ED81). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatgccgcagagtctagactcgtggtggacttctctcarttttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtccctttttac
cgctgttaccaattttcttatgtctttgggtatacattt
>gnl|hbvcds|AB561856_S_P-D Feature FT:CDS AB561856_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F36-Mother). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtatttcttgktgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccatttg
tcctctgattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacrtgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggmtcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtgcaccatcttgagtccctatatac
cgctgttaccaaktttcttttgtctttgggtatacattt
>gnl|hbvcds|AB583680_S_P-D Feature FT:CDS AB583680_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pkst7912). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674403_S_P-D Feature FT:CDS AB674403_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD87). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
cctcactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtccctttttac
cgctgtwaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674404_S_P-D Feature FT:CDS AB674404_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE39). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggamcatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674405_S_P-D Feature FT:CDS AB674405_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraHCCA12). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB674406_S_P-D Feature FT:CDS AB674406_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB23). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggagccaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcttcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcrtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674407_S_P-D Feature FT:CDS AB674407_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD35). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB674408_S_P-D Feature FT:CDS AB674408_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD83). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674409_S_P-D Feature FT:CDS AB674409_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD40). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB674410_S_P-D Feature FT:CDS AB674410_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD27). Partial genome (Contains: HBc, HBx). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggacyaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgccgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatg
tcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactcctgctcaaggaacctctatga
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatagatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674411_S_P-D Feature FT:CDS AB674411_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD84). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaacgaccagtacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggttttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AB674413_S_P-D Feature FT:CDS AB674413_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB27). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaggtctgtacaacatcttgagtcccttttttc
cgctgttaccacctttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674414_S_P-D Feature FT:CDS AB674414_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE33). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB674415_S_P-D Feature FT:CDS AB674415_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC24). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgctgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcmtgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AB674416_S_P-D Feature FT:CDS AB674416_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE19). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgttcagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674417_S_P-D Feature FT:CDS AB674417_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraLCE1). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674418_S_P-D Feature FT:CDS AB674418_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC7). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674419_S_P-D Feature FT:CDS AB674419_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatgccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtgttgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtttccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674420_S_P-D Feature FT:CDS AB674420_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunLCD2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AB674422_S_P-D Feature FT:CDS AB674422_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE15). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674423_S_P-D Feature FT:CDS AB674423_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD18). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatataa
>gnl|hbvcds|AB674424_S_P-D Feature FT:CDS AB674424_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE24). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tccactaattccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgagtcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB674425_S_P-D Feature FT:CDS AB674425_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE44). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674426_S_P-D Feature FT:CDS AB674426_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD50). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674427_S_P-D Feature FT:CDS AB674427_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD54). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcttcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674428_S_P-D Feature FT:CDS AB674428_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB26). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgagtcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgtcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674429_S_P-D Feature FT:CDS AB674429_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD89). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctcgaattccaggaacttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatga
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674431_S_P-D Feature FT:CDS AB674431_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC27). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagattcctaggacccctgctcgggttactggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtgttgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674435_S_P-D Feature FT:CDS AB674435_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB24). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
accatcttcctcttcatcctgctgccatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
acctctaattccaggatcttcaactaccagcacgggaccatgcagaatctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggcccagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786644_S_P-D Feature FT:CDS AB786644_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KE20402). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB786650_S_P-D Feature FT:CDS AB786650_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KE20408). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786653_S_P-D Feature FT:CDS AB786653_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KE20411). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcagatggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcggttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF041251_S_P-D Feature FT:CDS AF041251_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacttcctgtcttccaacttgtcctggttatcgctggatgtttctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|AF043593_S_P-D Feature FT:CDS AF043593_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 6/89). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgaccactgttcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF043594_S_P-D Feature FT:CDS AF043594_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1/91). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF061523_S_P-D Feature FT:CDS AF061523_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ms8388). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaagaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF061524_S_P-D Feature FT:CDS AF061524_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate mb602). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctagcaccccttctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggcaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF061528_S_P-D Feature FT:CDS AF061528_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate od2278). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaatctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF065110_S_P-D Feature FT:CDS AF065110_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate hb1213). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcgaccaccagcgcgggaccatgcagaacctgcacgacaactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF065112_S_P-D Feature FT:CDS AF065112_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate sn1065). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgcgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttctggttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgttgtcccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtggggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF065117_S_P-D Feature FT:CDS AF065117_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate sn7099). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgctcgtctg
tcctctaatttcaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggccttagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF065118_S_P-D Feature FT:CDS AF065118_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate z12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctatggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcccttttttc
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF065119_S_P-D Feature FT:CDS AF065119_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate zms520). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF083640_S_P-D Feature FT:CDS AF083640_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate patient 4-1991). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggaacttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggaaggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF083641_S_P-D Feature FT:CDS AF083641_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate patient 4-1992). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggaacttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggaaggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF121239_S_P-D Feature FT:CDS AF121239_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1303). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF121240_S_C-D Feature FT:CDS AF121240_S_C-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/11066). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF121241_S_P-D Feature FT:CDS AF121241_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1758). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF121242_S_P-D Feature FT:CDS AF121242_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1218). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaa
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF134135_S_P-D Feature FT:CDS AF134135_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgtcacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtctcggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccgggatcctcaaccaccagcacgggatcatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF134136_S_P-D Feature FT:CDS AF134136_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatca
atccctcctgttgctgtaccaaaagtttggacaaaaattgcacttgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgctatttgttcagtggttcgtagatcgttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF134140_S_P-D Feature FT:CDS AF134140_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcagacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaaaccgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF134141_S_P-D Feature FT:CDS AF134141_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcagacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaacatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF134142_S_P-D Feature FT:CDS AF134142_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgc
agtccctaacctccaatcactcaccaacctcctgtcctcaaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaaactgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttgctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF151735_S_P-D Feature FT:CDS AF151735_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggaaggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF208870_S_P-D Feature FT:CDS AF208870_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate js2617). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcagacttcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcacttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF208872_S_P-D Feature FT:CDS AF208872_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate pal3649). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccagctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgctgagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgttttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgagtcgtcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatcttacccgtttg
tcctctaattccaggatcttcaacaaccagcacgggaccatgcagaacgtgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgcacccaaccttcggacggaaattggacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgggatttgttcagtggtacgtagggctttc
ccccactgtgtgggttctaggtatatggatgatctggtattgggggcacagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF208874_S_P-D Feature FT:CDS AF208874_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate pal3671). Partial genome (Contains: LHBs, MHBs, SHBs). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcagacttcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgccgcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcctcaaccacgagcgcgggaccatgcagaacctgcacgactactgctctaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcgcatcatcctgggctttcggtaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcacttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF208877_S_P-D Feature FT:CDS AF208877_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate wr2209). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF209391_S_P-D Feature FT:CDS AF209391_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ak009). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaacatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF209394_S_P-D Feature FT:CDS AF209394_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dr10039). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF209396_S_P-D Feature FT:CDS AF209396_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate gs). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatratgyggtattgggggccaagtctgtacagcatcttgagcccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AF209398_S_P-D Feature FT:CDS AF209398_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ls384). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF209401_S_P-D Feature FT:CDS AF209401_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate rb011). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF214659_S_P-D Feature FT:CDS AF214659_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaactcgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttctac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF214660_S_P-D Feature FT:CDS AF214660_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttctac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF214661_S_P-D Feature FT:CDS AF214661_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF229158_S_P-D Feature FT:CDS AF229158_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcattcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgcttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttttctctgggtatacatttaa
>gnl|hbvcds|AF229159_S_P-D Feature FT:CDS AF229159_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgcttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF280817_S_P-D Feature FT:CDS AF280817_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-D1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF369534_S_P-D Feature FT:CDS AF369534_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MEX364). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcactagtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgccgaacctgcatgactactgctcaaggaaactctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF372622_S_P-D Feature FT:CDS AF372622_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF372623_S_P-D Feature FT:CDS AF372623_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ131956_S_P-D Feature FT:CDS AJ131956_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ344116_S_P-D Feature FT:CDS AJ344116_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBsAg negative patient GX27). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtccagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ517792_S_P-D Feature FT:CDS AJ517792_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate X6S3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=672 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttccagggggaaataccgtgtgtcttggacaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggta
>gnl|hbvcds|AJ627215_S_P-D Feature FT:CDS AJ627215_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 06115). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtgtg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtcgctttttac
cgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|AJ627216_S_P-D Feature FT:CDS AJ627216_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17707). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtgtg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtcgctttttac
cgctgttaccaattttcttwtgtctctgggtatacatttaa
>gnl|hbvcds|AJ627218_S_P-D Feature FT:CDS AJ627218_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 21116). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtgtg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcgctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ627219_S_P-D Feature FT:CDS AJ627219_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 24039). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttyagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ627220_S_P-D Feature FT:CDS AJ627220_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 29234). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaaactctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ627222_S_P-D Feature FT:CDS AJ627222_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 31228). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcarggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttacaaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ627223_S_P-D Feature FT:CDS AJ627223_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 33720). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ627224_S_P-D Feature FT:CDS AJ627224_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 33852). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM422939_S_P-D Feature FT:CDS AM422939_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate X28). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494742_S_P-D Feature FT:CDS AM494742_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CAR202). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcttgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494749_S_P-D Feature FT:CDS AM494749_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CAR175). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgccacatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcaggggaccatgcagaacctgcacgactcctgctcaaggaacctctatgc
atccctcttgttgctattcaaaactttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaac
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM494750_S_P-D Feature FT:CDS AM494750_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CAR175). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcaggggaccatgcagaacctgcacgactcctgctcaaggaacctctatgc
atccctcttgttgctgtacaaaactttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaac
ttcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM991999_S_P-D Feature FT:CDS AM991999_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaatctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY090452_S_P-D Feature FT:CDS AY090452_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctgattccaggatcctcaaccaccagcacgggaccatgcaaaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY090453_S_P-D Feature FT:CDS AY090453_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcatttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcaagacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttcttctggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122551_S_P-D Feature FT:CDS AY122551_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F148). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122552_S_P-D Feature FT:CDS AY122552_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F193). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaccatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122553_S_P-D Feature FT:CDS AY122553_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F201). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacatgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122554_S_P-D Feature FT:CDS AY122554_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F203). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgcttgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122555_S_P-D Feature FT:CDS AY122555_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F216). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtgctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122556_S_P-D Feature FT:CDS AY122556_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F306). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagcctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122557_S_P-D Feature FT:CDS AY122557_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K130). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122558_S_P-D Feature FT:CDS AY122558_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K198). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122559_S_P-D Feature FT:CDS AY122559_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K200). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122560_S_P-D Feature FT:CDS AY122560_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K202). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcagaacatgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122561_S_P-D Feature FT:CDS AY122561_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K205). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122562_S_P-D Feature FT:CDS AY122562_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K218). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122563_S_P-D Feature FT:CDS AY122563_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K219). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaacctttggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122564_S_P-D Feature FT:CDS AY122564_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K232). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122565_S_P-D Feature FT:CDS AY122565_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K239). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122566_S_P-D Feature FT:CDS AY122566_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K260). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122567_S_P-D Feature FT:CDS AY122567_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K276). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122568_S_P-D Feature FT:CDS AY122568_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K279). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122569_S_P-D Feature FT:CDS AY122569_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K282). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122570_S_P-D Feature FT:CDS AY122570_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K295). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122571_S_P-D Feature FT:CDS AY122571_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K300). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122572_S_P-D Feature FT:CDS AY122572_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate K307). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaaactctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122573_S_P-D Feature FT:CDS AY122573_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T244). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122574_S_P-D Feature FT:CDS AY122574_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T251). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgaccactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttac
tgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122575_S_P-D Feature FT:CDS AY122575_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T269). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccatcttgagaccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122576_S_P-D Feature FT:CDS AY122576_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T286). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacagggggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagccccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122587_S_P-D Feature FT:CDS AY122587_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IN0008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactggttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttggctttgggtatacctttaa
>gnl|hbvcds|AY122588_S_P-D Feature FT:CDS AY122588_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IN0015). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgactttgggtatacatttaa
>gnl|hbvcds|AY122589_S_P-D Feature FT:CDS AY122589_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IN0017). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122590_S_P-D Feature FT:CDS AY122590_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IN0051). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaaccttctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122591_S_P-D Feature FT:CDS AY122591_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IN0062). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122592_S_P-D Feature FT:CDS AY122592_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IN0083). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122593_S_P-D Feature FT:CDS AY122593_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IN0091). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122594_S_P-D Feature FT:CDS AY122594_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IN0134). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161150_S_P-D Feature FT:CDS AY161150_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactctattc
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161151_S_P-D Feature FT:CDS AY161151_S_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactctattc
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161152_S_P-D Feature FT:CDS AY161152_S_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacataaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactctattc
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161153_S_P-D Feature FT:CDS AY161153_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactctattc
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161154_S_P-D Feature FT:CDS AY161154_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacgggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactctattc
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161155_S_P-D Feature FT:CDS AY161155_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactctattc
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161156_S_P-D Feature FT:CDS AY161156_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacgggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactctattc
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161157_S_P-D Feature FT:CDS AY161157_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccagcctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagaatgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161158_S_P-D Feature FT:CDS AY161158_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
aatccccagcctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagaatgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161159_S_P-D Feature FT:CDS AY161159_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaa
ttcctatggaagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161160_S_P-D Feature FT:CDS AY161160_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaa
ttcctatggaagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY221115_S_P-D Feature FT:CDS AY221115_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P1008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY230116_S_P-D Feature FT:CDS AY230116_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcgattttctagggggaactactgtatgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233291_S_P-D Feature FT:CDS AY233291_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 179). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctggcctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233292_S_P-D Feature FT:CDS AY233292_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 184). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggttgacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtgtg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233294_S_P-D Feature FT:CDS AY233294_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 305). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggttgacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtgtg
tcctctaattccaggatcctcaaccaccagcacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtaccatttgttcagtggttcgtaaggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233296_S_P-D Feature FT:CDS AY233296_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 185). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcccttttcac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY236160_S_P-D Feature FT:CDS AY236160_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1A). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgttcctcctggctcagtttactagtgccatttgttcaggggttcggagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttctttggtctttgggtatacatttaa
>gnl|hbvcds|AY236162_S_P-D Feature FT:CDS AY236162_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 23A). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatga
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY236164_S_P-D Feature FT:CDS AY236164_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 30). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccgcagagtctagactcgtggaggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaatctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttctttggtctttgggtatacatttaa
>gnl|hbvcds|AY373431_S_P-D Feature FT:CDS AY373431_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aaaaccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653804_S_P-D Feature FT:CDS AY653804_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 288-00). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagcacctgcacgactactgctcaaggaacctctacgt
ttccctcctgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653805_S_P-D Feature FT:CDS AY653805_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4404-97). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgcccgtgttacaggcggggttttcctggttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagtacctccacgactgctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653806_S_P-D Feature FT:CDS AY653806_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4500-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattcctggatcctcaaccatcagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttagacgcaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653807_S_P-D Feature FT:CDS AY653807_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 290-00). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactattgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653808_S_P-D Feature FT:CDS AY653808_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4441-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653809_S_P-D Feature FT:CDS AY653809_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4430-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
accatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctttatga
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653810_S_P-D Feature FT:CDS AY653810_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4543-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtatctgcggcgttct
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653811_S_P-D Feature FT:CDS AY653811_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4494-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccatcagcacgggaccatgcagaacctgcacaactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653812_S_P-D Feature FT:CDS AY653812_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 3812-91). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttttatagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653814_S_P-D Feature FT:CDS AY653814_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4388-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653815_S_P-D Feature FT:CDS AY653815_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 5946-89). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653816_S_P-D Feature FT:CDS AY653816_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 6087-89). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653817_S_P-D Feature FT:CDS AY653817_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 5552-89). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653818_S_P-D Feature FT:CDS AY653818_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 686-01). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653819_S_P-D Feature FT:CDS AY653819_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 5542-89). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgaagccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653821_S_P-D Feature FT:CDS AY653821_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4380-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactattgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY653822_S_P-D Feature FT:CDS AY653822_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4639-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgaccattgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY653823_S_P-D Feature FT:CDS AY653823_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4561-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcag
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653824_S_P-D Feature FT:CDS AY653824_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4556-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653825_S_P-D Feature FT:CDS AY653825_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4475-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacctgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653826_S_P-D Feature FT:CDS AY653826_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4402-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgcacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653827_S_P-D Feature FT:CDS AY653827_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 6059-89). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653828_S_P-D Feature FT:CDS AY653828_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4603-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653829_S_P-D Feature FT:CDS AY653829_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 3781-91). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653830_S_P-D Feature FT:CDS AY653830_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4471-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacctccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653831_S_P-D Feature FT:CDS AY653831_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4534-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653832_S_P-D Feature FT:CDS AY653832_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 6058-89). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653833_S_P-D Feature FT:CDS AY653833_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4649-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653834_S_P-D Feature FT:CDS AY653834_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4492-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653838_S_P-D Feature FT:CDS AY653838_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 5373-89). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653839_S_P-D Feature FT:CDS AY653839_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4470-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653840_S_P-D Feature FT:CDS AY653840_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 3789-91). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaactttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653841_S_P-D Feature FT:CDS AY653841_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1993-02). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653842_S_P-D Feature FT:CDS AY653842_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 283-01). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653843_S_P-D Feature FT:CDS AY653843_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4407-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcatttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaacaaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653845_S_P-D Feature FT:CDS AY653845_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 3790-91). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagaatctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttct
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653847_S_P-D Feature FT:CDS AY653847_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 3806-91). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653849_S_P-D Feature FT:CDS AY653849_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4483-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653850_S_P-D Feature FT:CDS AY653850_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4644-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaaactctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653855_S_P-D Feature FT:CDS AY653855_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4643-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653856_S_P-D Feature FT:CDS AY653856_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4482-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653858_S_P-D Feature FT:CDS AY653858_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 3786-91). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653859_S_P-D Feature FT:CDS AY653859_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4382-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctacttccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggaaggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653862_S_P-D Feature FT:CDS AY653862_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4370-97). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtytg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggtaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653866_S_P-D Feature FT:CDS AY653866_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4369-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653867_S_P-D Feature FT:CDS AY653867_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 879-96). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653868_S_P-D Feature FT:CDS AY653868_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 646-00). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653870_S_P-D Feature FT:CDS AY653870_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4645-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcgtatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653871_S_P-D Feature FT:CDS AY653871_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4531-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggacgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653872_S_P-D Feature FT:CDS AY653872_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4386-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactgctgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653873_S_P-D Feature FT:CDS AY653873_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4381-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcatgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653874_S_P-D Feature FT:CDS AY653874_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 886-96). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactattgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653876_S_P-D Feature FT:CDS AY653876_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4637-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttagtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653878_S_P-D Feature FT:CDS AY653878_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4632-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653879_S_P-D Feature FT:CDS AY653879_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 300-01). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653880_S_P-D Feature FT:CDS AY653880_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 882-96). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagagctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653881_S_P-D Feature FT:CDS AY653881_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 297-01). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttgggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653882_S_P-D Feature FT:CDS AY653882_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2012-01). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653884_S_P-D Feature FT:CDS AY653884_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 292-01). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653885_S_P-D Feature FT:CDS AY653885_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 3785-91). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653886_S_P-D Feature FT:CDS AY653886_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 3783-91). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653887_S_P-D Feature FT:CDS AY653887_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1880-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcaattatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653889_S_P-D Feature FT:CDS AY653889_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1889-98). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtccagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653892_S_P-D Feature FT:CDS AY653892_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4544-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653894_S_P-D Feature FT:CDS AY653894_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4523-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653895_S_P-D Feature FT:CDS AY653895_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 881-96). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaacmaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY661792_S_P-D Feature FT:CDS AY661792_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ayw). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY661793_S_P-D Feature FT:CDS AY661793_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY721605_S_P-D Feature FT:CDS AY721605_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AK1.1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY721606_S_P-D Feature FT:CDS AY721606_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AT1.2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AY721607_S_P-D Feature FT:CDS AY721607_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HIY1.3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacaactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY721608_S_P-D Feature FT:CDS AY721608_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IB1.4). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgccgaacatgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AY721609_S_P-D Feature FT:CDS AY721609_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AA1.5). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY721610_S_P-D Feature FT:CDS AY721610_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FK1.6). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY721611_S_P-D Feature FT:CDS AY721611_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SK1.7). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY721612_S_P-D Feature FT:CDS AY721612_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BL1.8). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738848_S_P-D Feature FT:CDS AY738848_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatattgcccgtttg
tcctctacttccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgc
atccctcctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatcatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738849_S_P-D Feature FT:CDS AY738849_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738850_S_P-D Feature FT:CDS AY738850_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtcccaaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctactggactatcagggtatgttgcccgtgtg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgaggccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738851_S_P-D Feature FT:CDS AY738851_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatacctcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
ggtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtttctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttga
>gnl|hbvcds|AY738852_S_P-D Feature FT:CDS AY738852_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgagaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcctgtccttcaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtactgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738853_S_P-D Feature FT:CDS AY738853_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagttgttcgtagggctttc
ccccactgtatggctttcagctatatggattatgtggtattgggggccaagtatgtacagcatcttgagtccctttattc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738854_S_P-D Feature FT:CDS AY738854_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatctaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagttgttcgtagggctttc
ccccactgtttggctttcagctatatggattatgtggtattgggggccaagtctgtacagcatcttgagtccctttattc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738855_S_P-D Feature FT:CDS AY738855_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagacacgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738856_S_P-D Feature FT:CDS AY738856_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacatccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738857_S_P-D Feature FT:CDS AY738857_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgacgcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738858_S_P-D Feature FT:CDS AY738858_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738859_S_P-D Feature FT:CDS AY738859_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738860_S_P-D Feature FT:CDS AY738860_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctaac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738861_S_P-D Feature FT:CDS AY738861_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738862_S_P-D Feature FT:CDS AY738862_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738863_S_P-D Feature FT:CDS AY738863_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatctcacactcctgggctttcggaaaa
tccctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738864_S_P-D Feature FT:CDS AY738864_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatcatgtggtattgggggccaagtctgtacagcatcttgagcccctttttac
cgctgttaccaattttcttttgtctttgggtatccatttaa
>gnl|hbvcds|AY738865_S_P-D Feature FT:CDS AY738865_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738866_S_P-D Feature FT:CDS AY738866_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtcgttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AY738867_S_P-D Feature FT:CDS AY738867_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactactgctcaaggaacctctatgt
atccctactgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738868_S_P-D Feature FT:CDS AY738868_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggaacctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738869_S_P-D Feature FT:CDS AY738869_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738870_S_P-D Feature FT:CDS AY738870_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacttgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738871_S_P-D Feature FT:CDS AY738871_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttrttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738872_S_P-D Feature FT:CDS AY738872_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggaacctcaaccaccagcacgggaccatgccgaacctgcatgaccactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738873_S_P-D Feature FT:CDS AY738873_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgaccactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatcatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacctttaa
>gnl|hbvcds|AY738874_S_P-D Feature FT:CDS AY738874_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatcatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacctttaa
>gnl|hbvcds|AY738875_S_P-D Feature FT:CDS AY738875_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttagacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738876_S_P-D Feature FT:CDS AY738876_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738877_S_P-D Feature FT:CDS AY738877_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738878_S_P-D Feature FT:CDS AY738878_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738879_S_P-D Feature FT:CDS AY738879_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatcatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738880_S_P-D Feature FT:CDS AY738880_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738881_S_P-D Feature FT:CDS AY738881_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738882_S_P-D Feature FT:CDS AY738882_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738883_S_P-D Feature FT:CDS AY738883_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcacgattcctagaacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggtgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaacatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AY738884_S_P-D Feature FT:CDS AY738884_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgaccattgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgtttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AY738885_S_P-D Feature FT:CDS AY738885_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgaccattgcgcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AY738886_S_P-D Feature FT:CDS AY738886_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgaccattgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AY738887_S_P-D Feature FT:CDS AY738887_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggtgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctactggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738888_S_P-D Feature FT:CDS AY738888_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtytg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738889_S_P-D Feature FT:CDS AY738889_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738890_S_P-D Feature FT:CDS AY738890_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738891_S_P-D Feature FT:CDS AY738891_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggtgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738892_S_P-D Feature FT:CDS AY738892_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggggtttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738893_S_P-D Feature FT:CDS AY738893_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AY738894_S_P-D Feature FT:CDS AY738894_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738895_S_P-D Feature FT:CDS AY738895_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacttctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738896_S_P-D Feature FT:CDS AY738896_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatccatttaa
>gnl|hbvcds|AY738897_S_P-D Feature FT:CDS AY738897_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacaactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738898_S_P-D Feature FT:CDS AY738898_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacaactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738899_S_P-D Feature FT:CDS AY738899_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacaactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgtttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738900_S_P-D Feature FT:CDS AY738900_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacaactcctgctcaaggaacctctatgc
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738901_S_P-D Feature FT:CDS AY738901_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacaactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738902_S_P-D Feature FT:CDS AY738902_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcaagagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738903_S_P-D Feature FT:CDS AY738903_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgatggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcccatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738904_S_P-D Feature FT:CDS AY738904_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaggatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cactgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AY738905_S_P-D Feature FT:CDS AY738905_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacagtcagggtttttcttgttaccaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AY738906_S_P-D Feature FT:CDS AY738906_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttaccaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AY738907_S_P-D Feature FT:CDS AY738907_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttcttctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AY738908_S_P-D Feature FT:CDS AY738908_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggatggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ctcctatgggagtgggcctcagcccgtttcttctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AY738909_S_P-D Feature FT:CDS AY738909_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatacagcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AY738910_S_P-D Feature FT:CDS AY738910_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatacagcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AY738911_S_P-D Feature FT:CDS AY738911_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738912_S_P-D Feature FT:CDS AY738912_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatcatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738913_S_P-D Feature FT:CDS AY738913_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738914_S_P-D Feature FT:CDS AY738914_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738915_S_P-D Feature FT:CDS AY738915_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatctaa
>gnl|hbvcds|AY738916_S_P-D Feature FT:CDS AY738916_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738917_S_P-D Feature FT:CDS AY738917_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY741794_S_P-D Feature FT:CDS AY741794_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-50). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY741795_S_P-D Feature FT:CDS AY741795_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-Hi). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY741796_S_P-D Feature FT:CDS AY741796_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-P3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
gcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY741797_S_P-D Feature FT:CDS AY741797_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-21). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtctttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttgccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY741798_S_P-D Feature FT:CDS AY741798_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-P4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggacaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccagtcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctgtaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcagcatcttgaggccctttatac
cgctgttgtcaattttctttggtctttgggtattcatttaa
>gnl|hbvcds|AY796030_S_P-D Feature FT:CDS AY796030_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FC1.9). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY796031_S_P-D Feature FT:CDS AY796031_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RA1.10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaaccaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaagggacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY796032_S_P-D Feature FT:CDS AY796032_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NA1.11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY945307_S_P-D Feature FT:CDS AY945307_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttgggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY999088_S_P-D Feature FT:CDS AY999088_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PKM3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctactggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcaaaaccaacacgactactgctcaaagaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaagttgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttcttctggctcagttcactagtgccatttgttcagtggttcgtagagctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ111986_S_P-D Feature FT:CDS DQ111986_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MBT181). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|DQ131122_S_P-D Feature FT:CDS DQ131122_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M-D). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccctgccgaacctgcacgacaactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ131123_S_P-D Feature FT:CDS DQ131123_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M-Dstop). Partial genome (Contains: SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccctgccgaacctgcacgacaactgctcaaggaacctctatgc
atccctactgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacagcatcttgagtccctttttac
cgctgttaccaatttttttttggctttgggtatacatttaa
>gnl|hbvcds|DQ131126_S_P-D Feature FT:CDS DQ131126_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S-D). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctactatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccgattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ160161_S_P-D Feature FT:CDS DQ160161_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EIBD0485). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aaaaccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggaattgggggccaagtctgtacagcaacttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ236128_S_P-D Feature FT:CDS DQ236128_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MEX B09). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaccagtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatccccaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ299408_S_P-D Feature FT:CDS DQ299408_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HCC_335). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggatcccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcwtgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ299409_S_P-D Feature FT:CDS DQ299409_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HCC_335). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaagcatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ304547_S_P-D Feature FT:CDS DQ304547_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgcgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttagccgtttg
tcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatga
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ304548_S_P-D Feature FT:CDS DQ304548_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaacaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatga
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ304549_S_P-D Feature FT:CDS DQ304549_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaacaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatga
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ304550_S_P-D Feature FT:CDS DQ304550_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaacaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatga
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ304551_S_P-D Feature FT:CDS DQ304551_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatga
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ315776_S_P-D Feature FT:CDS DQ315776_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EI00615). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ315778_S_P-D Feature FT:CDS DQ315778_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EI0388). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ329356_S_P-D Feature FT:CDS DQ329356_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacttgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ329357_S_P-D Feature FT:CDS DQ329357_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacttgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336674_S_P-D Feature FT:CDS DQ336674_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336675_S_P-D Feature FT:CDS DQ336675_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336676_S_P-D Feature FT:CDS DQ336676_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336677_S_P-D Feature FT:CDS DQ336677_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336678_S_P-D Feature FT:CDS DQ336678_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336679_S_P-D Feature FT:CDS DQ336679_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336680_S_P-D Feature FT:CDS DQ336680_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcagacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaatcccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaatctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ336681_S_P-D Feature FT:CDS DQ336681_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaatctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ336682_S_P-D Feature FT:CDS DQ336682_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcagacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaatcccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaatctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ336683_S_P-D Feature FT:CDS DQ336683_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcaaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaatcccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaatctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ336684_S_P-D Feature FT:CDS DQ336684_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcagacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaatcccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaatctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ336685_S_P-D Feature FT:CDS DQ336685_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagcacgggtccttgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336686_S_P-D Feature FT:CDS DQ336686_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaacctctatgt
atccttcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ336687_S_P-D Feature FT:CDS DQ336687_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaacctctatgt
atccttcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ336688_S_P-D Feature FT:CDS DQ336688_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaacctctatgt
atccttcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ336689_S_P-D Feature FT:CDS DQ336689_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgacaaccagcacgggaccatgccggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ336690_S_P-D Feature FT:CDS DQ336690_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgggtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336691_S_P-D Feature FT:CDS DQ336691_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttccctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacttgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtgggattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttctttggcctttgggtatacatttaa
>gnl|hbvcds|DQ336692_S_P-D Feature FT:CDS DQ336692_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaacctctatgt
atccttcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ412277_S_P-D Feature FT:CDS DQ412277_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02001720). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatyacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctkcatcctgctgctatgcctcatcttctygttggttcttmtggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412278_S_P-D Feature FT:CDS DQ412278_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S02001723). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412279_S_P-D Feature FT:CDS DQ412279_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02003094). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttacccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412280_S_P-D Feature FT:CDS DQ412280_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02003096). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatatggtattgggggccaaatctgtacagcaccttgagtcccttttcac
cgctgttactaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|DQ412281_S_P-D Feature FT:CDS DQ412281_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02004197). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412282_S_P-D Feature FT:CDS DQ412282_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02006853). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaccatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaaaactgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412283_S_P-D Feature FT:CDS DQ412283_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02006854). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattctctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412284_S_P-D Feature FT:CDS DQ412284_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02009111). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcatttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412285_S_P-D Feature FT:CDS DQ412285_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02009113). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccytgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggayggaaaytgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|DQ412286_S_P-D Feature FT:CDS DQ412286_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02009114). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaacmaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacascatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|DQ412287_S_P-D Feature FT:CDS DQ412287_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02009115). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ412288_S_P-D Feature FT:CDS DQ412288_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S02009117). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaataccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgyagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacarcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412289_S_P-D Feature FT:CDS DQ412289_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02009121). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggcgccacaactgcacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412290_S_P-D Feature FT:CDS DQ412290_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02011118). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaacaccgtgtgtcttggccaagattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaaatctgtgcaacaccttgagtccctttttac
ggctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412291_S_P-D Feature FT:CDS DQ412291_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S02011121). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattctctagggggaacaatcgcgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatatggtattgggggccaagtctgtacatcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412292_S_P-D Feature FT:CDS DQ412292_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02012958). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccatttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtgttgggggccaagtctgtacagcatcttgagtccctttacac
cgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|DQ412293_S_P-D Feature FT:CDS DQ412293_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02015692). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgyttggcttttagttatatggatgatgtggtattgggcgccaaaactgcacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412294_S_P-D Feature FT:CDS DQ412294_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02016136). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatattgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaacatgcaaaacctgcacgactactgttcaaggaacctctatgt
atcccttctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttactaattttcttttgtctttgggtatacacttaa
>gnl|hbvcds|DQ412295_S_P-D Feature FT:CDS DQ412295_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02016680). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactttcacggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412296_S_P-D Feature FT:CDS DQ412296_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S02016683). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412297_S_P-D Feature FT:CDS DQ412297_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02017231). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggccttagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaaatctgtgcaacaccttgagtccctttttac
cgctgttaccaattttctgttgtctttgggcatacatttaa
>gnl|hbvcds|DQ412298_S_P-D Feature FT:CDS DQ412298_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02019163). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccatgattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactattgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacarcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|DQ412299_S_P-D Feature FT:CDS DQ412299_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02019168). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412300_S_P-D Feature FT:CDS DQ412300_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02023959). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccratttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412301_S_P-D Feature FT:CDS DQ412301_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S02023966). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccgggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412302_S_P-D Feature FT:CDS DQ412302_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02023968). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgacccctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgnacaacatcttgastccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412303_S_P-D Feature FT:CDS DQ412303_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02025808). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttctygttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ412304_S_P-D Feature FT:CDS DQ412304_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S02025810). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412305_S_P-D Feature FT:CDS DQ412305_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02025811). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ412306_S_P-D Feature FT:CDS DQ412306_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02025814). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtttg
tcctctaattccaggatcctcaaccacaagcacgggatcatgccgaacctgcacgactcctgctcaaggaacctctatgy
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412307_S_P-D Feature FT:CDS DQ412307_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02026888). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttyggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggstcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ412308_S_P-D Feature FT:CDS DQ412308_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s02026889). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaggacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgawgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ412309_S_P-D Feature FT:CDS DQ412309_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03001561). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttccacttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatttggtattgggggccaagtctgttcagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412310_S_P-D Feature FT:CDS DQ412310_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03001562). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggstttc
ccccaytgtttggctttyagttatatggacgatgtggtgttgggcaccacatctgcacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatataa
>gnl|hbvcds|DQ412311_S_P-D Feature FT:CDS DQ412311_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S03001563). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgactaccagcacgggaccatgcagaacctgcacgactcctgcacaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412312_S_P-D Feature FT:CDS DQ412312_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S03003109). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggatggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412313_S_P-D Feature FT:CDS DQ412313_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S03003587). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccatcmtgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412314_S_P-D Feature FT:CDS DQ412314_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03005394). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcctcaacgaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggcgttc
ccccactgtttggcttttagctatatggacgatgtggtattgggggccaaatctgtatcgcatcttgagtcccttgttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412315_S_P-D Feature FT:CDS DQ412315_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S03006195). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaagttcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412316_S_P-D Feature FT:CDS DQ412316_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03007590). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcctcaaccaccagcacgggaacatgccgaacatgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412317_S_P-D Feature FT:CDS DQ412317_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03007591). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412318_S_P-D Feature FT:CDS DQ412318_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S03008222). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412319_S_P-D Feature FT:CDS DQ412319_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03008344). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcmggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412320_S_P-D Feature FT:CDS DQ412320_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S03008347). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctactggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412321_S_P-D Feature FT:CDS DQ412321_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03009293). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttctctttgggtatacatttaa
>gnl|hbvcds|DQ412322_S_P-D Feature FT:CDS DQ412322_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03009619). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgacyactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412323_S_P-D Feature FT:CDS DQ412323_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03010173). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaagattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412324_S_P-D Feature FT:CDS DQ412324_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03010175). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactattgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttaggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|DQ412325_S_P-D Feature FT:CDS DQ412325_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03010177). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412326_S_P-D Feature FT:CDS DQ412326_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S03010574). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttaacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412327_S_P-D Feature FT:CDS DQ412327_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S03013242). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcggagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactttcaaggtatgttgcgcgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ412328_S_P-D Feature FT:CDS DQ412328_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03013243). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagaccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|DQ412329_S_P-D Feature FT:CDS DQ412329_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03014651). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagccaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggayggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcagcatcttgaggccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412330_S_P-D Feature FT:CDS DQ412330_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03015608). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctggggatccatttaa
>gnl|hbvcds|DQ412331_S_P-D Feature FT:CDS DQ412331_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03016102). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaacatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggcattc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412332_S_P-D Feature FT:CDS DQ412332_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03016103). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctccygttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412333_S_P-D Feature FT:CDS DQ412333_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03017506). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412334_S_P-D Feature FT:CDS DQ412334_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03020210). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412335_S_P-D Feature FT:CDS DQ412335_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03020211). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcktcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttyagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412336_S_P-D Feature FT:CDS DQ412336_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03020383). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcrctcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412337_S_P-D Feature FT:CDS DQ412337_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S03020384). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcacggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ412338_S_P-D Feature FT:CDS DQ412338_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03021332). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggsaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412339_S_P-D Feature FT:CDS DQ412339_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03021333). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412340_S_P-D Feature FT:CDS DQ412340_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03021867). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412341_S_P-D Feature FT:CDS DQ412341_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03024568). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412342_S_P-D Feature FT:CDS DQ412342_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03024902). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaaccttctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccmtttgttcagtggttcgtagggcwttc
ccccactgtctggctttyagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttgtac
cgctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ412343_S_P-D Feature FT:CDS DQ412343_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s03025320). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412344_S_P-D Feature FT:CDS DQ412344_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04000006). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcctaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatga
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgttcctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacagcatcttgagtccctttttac
cgctgttacaaattttctgttgtctttgggtattcatttaa
>gnl|hbvcds|DQ412345_S_P-D Feature FT:CDS DQ412345_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04000008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctagcaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgtcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412346_S_P-D Feature FT:CDS DQ412346_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S04001916). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccaacacgggaccatgcagaacctgcacgactcctgcacaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412347_S_P-D Feature FT:CDS DQ412347_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04002904). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagtacgggaccatgcagaacctgcacgactattgctcaaggaacctctctgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtcccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|DQ412348_S_P-D Feature FT:CDS DQ412348_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04004396). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaccgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412349_S_P-D Feature FT:CDS DQ412349_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04006023). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggccctaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccgaacctgcatgacwactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttayatggatgatgtggtattgggggccargtctgwacaacatcttgartccctttttac
mgctgttaccaattttctgttgtctttgggtatwcatttaa
>gnl|hbvcds|DQ412350_S_P-D Feature FT:CDS DQ412350_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S04006943). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaytgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtgaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|DQ412351_S_P-D Feature FT:CDS DQ412351_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04007187). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412352_S_P-D Feature FT:CDS DQ412352_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04008404). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattygc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412353_S_P-D Feature FT:CDS DQ412353_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04008720). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412354_S_P-D Feature FT:CDS DQ412354_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04008721). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412355_S_P-D Feature FT:CDS DQ412355_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04009693). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412356_S_P-D Feature FT:CDS DQ412356_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04010318). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaagaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactttcaaggtatgttgcccgtttg
tcccctaattccaggatcttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttacatggatgatgtggttttgggggccaagtctgtacaccatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412357_S_P-D Feature FT:CDS DQ412357_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04011652). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattygc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412358_S_P-D Feature FT:CDS DQ412358_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04012671). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412359_S_P-D Feature FT:CDS DQ412359_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04013163). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttac
tgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ412360_S_P-D Feature FT:CDS DQ412360_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04014604). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctcgaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatatggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412361_S_P-D Feature FT:CDS DQ412361_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S04014605). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatyacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcttgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412362_S_P-D Feature FT:CDS DQ412362_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04014918). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcggagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaatctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412363_S_P-D Feature FT:CDS DQ412363_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04016708). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggaaggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaaggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412364_S_P-D Feature FT:CDS DQ412364_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04017584). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412365_S_P-D Feature FT:CDS DQ412365_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04018170). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412366_S_P-D Feature FT:CDS DQ412366_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04018171). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaagattcgc
agtccccaacctgcagtcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412367_S_P-D Feature FT:CDS DQ412367_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04018172). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcytggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412368_S_P-D Feature FT:CDS DQ412368_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04018771). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412369_S_P-D Feature FT:CDS DQ412369_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04020449). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412370_S_P-D Feature FT:CDS DQ412370_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04020626). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412371_S_P-D Feature FT:CDS DQ412371_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S04020968). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggraccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcaatggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttac
tgctgttaccaattttctkttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412372_S_P-D Feature FT:CDS DQ412372_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04021495). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgwcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgw
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412373_S_P-D Feature FT:CDS DQ412373_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04021496). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412374_S_P-D Feature FT:CDS DQ412374_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04021497). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgacgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412375_S_P-D Feature FT:CDS DQ412375_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04021899). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcarggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgytgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtrtcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412376_S_P-D Feature FT:CDS DQ412376_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04023098). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacmaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412377_S_P-D Feature FT:CDS DQ412377_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04023418). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412378_S_P-D Feature FT:CDS DQ412378_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04024248). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctactggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412379_S_P-D Feature FT:CDS DQ412379_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04024458). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttcttgttgacaagaatcctcaa
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccgaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412380_S_P-D Feature FT:CDS DQ412380_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S04025033). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatacctcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412381_S_P-D Feature FT:CDS DQ412381_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04025340). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcmracttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctrattccaggatcktcaacyaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctktgggtatacatttaa
>gnl|hbvcds|DQ412382_S_P-D Feature FT:CDS DQ412382_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S04026373). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412383_S_P-D Feature FT:CDS DQ412383_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04026374). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggctttcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaycatgcagaacctgcacgactcctgctcaaggaacctctatrt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttyactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtcactttttwc
cgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|DQ412384_S_P-D Feature FT:CDS DQ412384_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04026656). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggaytcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattctctagggggaactcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtsctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412385_S_P-D Feature FT:CDS DQ412385_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04026711). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412386_S_P-D Feature FT:CDS DQ412386_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s04026934). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412387_S_P-D Feature FT:CDS DQ412387_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05001607). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggrytccyaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412388_S_P-D Feature FT:CDS DQ412388_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05003969). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccracttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcttgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412389_S_P-D Feature FT:CDS DQ412389_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05004339). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412390_S_P-D Feature FT:CDS DQ412390_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05004615). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412391_S_P-D Feature FT:CDS DQ412391_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05005494). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaacatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412392_S_P-D Feature FT:CDS DQ412392_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05006103). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgctacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412393_S_P-D Feature FT:CDS DQ412393_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05006872). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaggacatcacatcaggattccttggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaacaaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412394_S_P-D Feature FT:CDS DQ412394_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05007224). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412395_S_P-D Feature FT:CDS DQ412395_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05008022). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacagcatcttgagtccatttttac
cgctgttaccaattttcttttgkctttgggtatacatttaa
>gnl|hbvcds|DQ412396_S_P-D Feature FT:CDS DQ412396_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05008971). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacraaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttmggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412397_S_P-D Feature FT:CDS DQ412397_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05009483). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcatttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtcccttttyac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412398_S_P-D Feature FT:CDS DQ412398_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05010082). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|DQ412399_S_P-D Feature FT:CDS DQ412399_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05010383). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcytgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|DQ412400_S_P-D Feature FT:CDS DQ412400_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05010385). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctkctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|DQ412401_S_P-D Feature FT:CDS DQ412401_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05011420). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgagtgtcttggccaaaattcgc
agtgcccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412402_S_P-D Feature FT:CDS DQ412402_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05011423). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcktcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412403_S_P-D Feature FT:CDS DQ412403_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05011424). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggkgtttttcttgtkgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaacgacaagcacgggaccatgcagaacctgcacgactcctgctcaaggaamctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgsaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcgygagtcactttttac
cgctgttaccaaattccttttgtctttgggtatacagttaa
>gnl|hbvcds|DQ412404_S_P-D Feature FT:CDS DQ412404_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05011855). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaaactgtgcaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412405_S_P-D Feature FT:CDS DQ412405_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05013273). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttactaattttcttttgtctttgggkatacatttaa
>gnl|hbvcds|DQ412406_S_P-D Feature FT:CDS DQ412406_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05013274). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412407_S_P-D Feature FT:CDS DQ412407_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05013553). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaamctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|DQ412408_S_P-D Feature FT:CDS DQ412408_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05013800). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412409_S_P-D Feature FT:CDS DQ412409_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05014131). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412410_S_P-D Feature FT:CDS DQ412410_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05015379). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412411_S_P-D Feature FT:CDS DQ412411_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05016357). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacmaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412412_S_P-D Feature FT:CDS DQ412412_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05016358). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgyttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtttcccatcttgagtcgcttttyac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412413_S_P-D Feature FT:CDS DQ412413_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05016359). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412414_S_P-D Feature FT:CDS DQ412414_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05016898). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaytgtttggctttcagttatatggatgatgtggtrttgggsgccaaatctgaacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412415_S_P-D Feature FT:CDS DQ412415_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05017206). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccracttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgsaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412416_S_P-D Feature FT:CDS DQ412416_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05017207). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtstctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412417_S_P-D Feature FT:CDS DQ412417_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05017208). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412418_S_P-D Feature FT:CDS DQ412418_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05017209). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412419_S_P-D Feature FT:CDS DQ412419_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05017210). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcraggaacctctatgt
atccctcctgttgctgtatcaraccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcaggggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412420_S_P-D Feature FT:CDS DQ412420_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05017429). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtrtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412421_S_P-D Feature FT:CDS DQ412421_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05017884). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctyctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctkcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tccactaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412422_S_P-D Feature FT:CDS DQ412422_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05017886). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaamcaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagactgtgcagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412423_S_P-D Feature FT:CDS DQ412423_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05018054). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
cctcactgcttggcttttagttatatggatgatgtggtattgggggcgaaatctgtgcatcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412424_S_P-D Feature FT:CDS DQ412424_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05018056). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctarggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaactgcacctgtattcccatcccatcatcctrggctttcgtaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcgctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412425_S_P-D Feature FT:CDS DQ412425_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05018157). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaycctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaytgtttggctttcagytatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412426_S_P-D Feature FT:CDS DQ412426_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05018795). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgwcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttsaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412427_S_P-D Feature FT:CDS DQ412427_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05019461). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aatgccgcagagtctagactcgtggtggacttctctcaattttctaggggaaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccgggatcctcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgacatcgtgttgggggccaaatctgtacaacatcgtgaagccctttttgt
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412428_S_P-D Feature FT:CDS DQ412428_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05019462). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412429_S_P-D Feature FT:CDS DQ412429_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05019937). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412430_S_P-D Feature FT:CDS DQ412430_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05020593). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaakcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggawcttcaaccaccagcacgggaccctgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggcsaagtctgtacagcaycttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412431_S_P-D Feature FT:CDS DQ412431_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S05021371). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412432_S_P-D Feature FT:CDS DQ412432_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05021372). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412433_S_P-D Feature FT:CDS DQ412433_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05021373). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgacgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412434_S_P-D Feature FT:CDS DQ412434_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05021812). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412435_S_P-D Feature FT:CDS DQ412435_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05023213). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412436_S_P-D Feature FT:CDS DQ412436_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05024256). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtgcccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacmaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccgtttgttcaatggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412437_S_P-D Feature FT:CDS DQ412437_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05024823). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412438_S_P-D Feature FT:CDS DQ412438_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s05024864). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaycagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412439_S_P-D Feature FT:CDS DQ412439_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s06000631). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggtgtgggcctcagcccatttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412440_S_P-D Feature FT:CDS DQ412440_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s06001114). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacascatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412441_S_P-D Feature FT:CDS DQ412441_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s06001695). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412442_S_P-D Feature FT:CDS DQ412442_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate s06002113). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgagtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccacaagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccrtttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ459085_S_P-D Feature FT:CDS DQ459085_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate patient ID6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaacaaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcgggcgaaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464168_S_P-D Feature FT:CDS DQ464168_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccagcttgtcctggttgtcgctgggtgtgtctgcggcgtttt
gtcagcttcctcttcagcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464169_S_P-D Feature FT:CDS DQ464169_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggaatcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatacggcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcgaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctcgatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464170_S_P-D Feature FT:CDS DQ464170_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaagaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcatggtggacttctctcaattttctagggggaactaccgtgtgtcttggcgaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464172_S_P-D Feature FT:CDS DQ464172_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttctttggtctttgggtatacatttaa
>gnl|hbvcds|DQ464173_S_P-D Feature FT:CDS DQ464173_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttctttggtctttgggtatacatttaa
>gnl|hbvcds|DQ464174_S_P-D Feature FT:CDS DQ464174_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggtccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|DQ464175_S_P-D Feature FT:CDS DQ464175_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgtgtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464176_S_P-D Feature FT:CDS DQ464176_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgtcgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgttgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464177_S_P-D Feature FT:CDS DQ464177_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgttgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464178_S_P-D Feature FT:CDS DQ464178_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgttgg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgtgtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464181_S_P-D Feature FT:CDS DQ464181_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S3). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcgaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgcctggctttcagttacatggatgatgtggtattgggggccaagtctgtacagcatcttgagtctctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464182_S_P-D Feature FT:CDS DQ464182_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaagggatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgacttttgctcaaggaacctctatga
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|DQ486021_S_P-D Feature FT:CDS DQ486021_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT13). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccgcagtgtctagactcgtggaggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttggctttgggtatacatttaa
>gnl|hbvcds|DQ486022_S_P-D Feature FT:CDS DQ486022_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT11). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccgcagagtctagactcgtggaggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaatctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttctttggtctttgggtatacatttaa
>gnl|hbvcds|DQ486023_S_P-D Feature FT:CDS DQ486023_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgcttgcggcgtttt
atcatcttcctcttcatcctggtgctatgcctcatcttcttgttgggtcttctggactaccaaggtatgttgcccgtttg
tcctctaatgccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctggtgctgtaccaaaactttggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcctgttccttctggctcagtttactagtgccatttgtccaggggttcggagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtattcttttaa
>gnl|hbvcds|DQ486025_S_P-D Feature FT:CDS DQ486025_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT12). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggaggacttctctcaattttctagggggaaccaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggatggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtcactttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ871265_S_P-D Feature FT:CDS DQ871265_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate VIY-01-15-2004). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgacyactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ871267_S_P-D Feature FT:CDS DQ871267_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate VIY-06-14-2005). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ871268_S_P-D Feature FT:CDS DQ871268_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate VIY-07-18-2005). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ991752_S_P-D Feature FT:CDS DQ991752_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Irish-2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggggaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgcggtatgttgcccgtttg
tcctctaattacaggatctccaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggaaggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|DQ991754_S_P-D Feature FT:CDS DQ991754_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Irish-4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995809_S_P-D Feature FT:CDS DQ995809_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts1_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcagggttcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaaccaccagcacgggatcatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggattgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaytgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995810_S_P-D Feature FT:CDS DQ995810_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts2_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctkctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggamccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcytgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtytg
tcctctamttccaggatcctcaaccaccagcacgggaccatgccgcacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ995811_S_P-D Feature FT:CDS DQ995811_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts3_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|DQ995812_S_P-D Feature FT:CDS DQ995812_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts4_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995814_S_P-D Feature FT:CDS DQ995814_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts6_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaaraccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcaccaccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcttcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atgcctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
tgctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ995815_S_P-D Feature FT:CDS DQ995815_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts7_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctagcaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcraggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
attcctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtatcrcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|DQ995816_S_P-D Feature FT:CDS DQ995816_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts8_Bas). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atgragaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgtwgacaagaatcctcac
aataccrcaragtctatactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaagcactcaccaacctcytgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgckgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995817_S_P-D Feature FT:CDS DQ995817_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts9_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcatatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctataattccaggatcttcaaacaccagcacgggaccctgcagaacctgcatgactactgctcacagaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttgtctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatattgatgatgtggtattgggggccaagagtgtgcagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995818_S_P-D Feature FT:CDS DQ995818_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts10_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995819_S_P-D Feature FT:CDS DQ995819_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts11_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtgtcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995820_S_P-D Feature FT:CDS DQ995820_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts12_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctg
tcctctgattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagttttctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995821_S_P-D Feature FT:CDS DQ995821_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts13_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcagttttctaggggraactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctyctgtcctccaacttgtcstggdtatcgctggatgtgtctgcggcdtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgctgctgtaccaaaccttcggacggcaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995823_S_P-D Feature FT:CDS DQ995823_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts15_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggyatacatttaa
>gnl|hbvcds|DQ995824_S_P-D Feature FT:CDS DQ995824_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts16_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatatycctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcgggcggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995825_S_P-D Feature FT:CDS DQ995825_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts17_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
rgtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttrctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995826_S_P-D Feature FT:CDS DQ995826_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts18_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995828_S_P-D Feature FT:CDS DQ995828_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts20_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatccctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtgsacttctctcaattttctagggggaactaccgtgtgtcttggccaaaatgcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaactggtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995830_S_P-D Feature FT:CDS DQ995830_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts22_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaactttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggycttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995831_S_P-D Feature FT:CDS DQ995831_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts23_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctgtctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995832_S_P-D Feature FT:CDS DQ995832_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts24_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatycctascacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcwtcatccwgcggctatgcctcatcttcttgttggtwcttctggactatmaaggtatgttgcccgtctg
tcctctgattccaggatcgtcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttwctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttktgtctttgggtgtacatttaa
>gnl|hbvcds|DQ995833_S_P-D Feature FT:CDS DQ995833_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts25_Bas). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccraaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgaatcctgcwcaaggaacctctatgt
atycctcctgttgctgtacctaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995835_S_P-D Feature FT:CDS DQ995835_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts27_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggttttycttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggayttctctcaattttctaggggraactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgwcctggwtatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggatcatgccgaacctgcacgactcctgctcaaggaacctctatga
atccctcctgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttwctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagwctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995836_S_P-D Feature FT:CDS DQ995836_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts28_Bas). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggatcatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995837_S_P-D Feature FT:CDS DQ995837_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts29_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtatttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccgggatcctcaaccaccagcacgggaccatgtcgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcctcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtcccttcatac
cgctgttactaattttctgtgttctttgggcatacatttaa
>gnl|hbvcds|DQ995838_S_P-D Feature FT:CDS DQ995838_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts30_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgtwgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaacatgccgaacctgcacgactcctgctcaaggcacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagctatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995839_S_P-D Feature FT:CDS DQ995839_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts31_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgtwgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccgaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatgtggatgatgtggtattgggggccaaatctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995840_S_P-D Feature FT:CDS DQ995840_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts32_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcatgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccattgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagttcctttttac
cgctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ995841_S_P-D Feature FT:CDS DQ995841_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts33_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggttttycttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaamtaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgcacctgcacgactcctgctcaaggaacctctatga
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttaggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995842_S_P-D Feature FT:CDS DQ995842_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts34_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995844_S_P-D Feature FT:CDS DQ995844_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts4_24mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995845_S_P-D Feature FT:CDS DQ995845_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts9_12mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcatatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggraactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctataattccaggatcttcaaacaccagcacgggaccctgcagaacctgcatgactactgctcacagaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttgtctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatattgatgatgtggtattgggggccaagagtgtgcagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995846_S_P-D Feature FT:CDS DQ995846_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts9_24mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcatatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggraactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctataattccaggatcttcaaacaccagcacgggaccctgcagaacctgcatgactactgctcacagaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttgtctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatattgatgatgtggtattgggggccaagagtgtgcagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995847_S_P-D Feature FT:CDS DQ995847_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts12_PreT). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctg
tcctctgattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagttttctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995848_S_P-D Feature FT:CDS DQ995848_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts12_3mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctg
tcctctgattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagttttctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995849_S_P-D Feature FT:CDS DQ995849_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts12_12mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctg
tcctctgattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagttttctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995850_S_P-D Feature FT:CDS DQ995850_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts12_24mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcarggtatgttgcccgtctg
tcctctgattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagttttctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995851_S_P-D Feature FT:CDS DQ995851_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts17_PreT). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
rgtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttgctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995852_S_P-D Feature FT:CDS DQ995852_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts17_12mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
rgtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgw
rtccctcctgwtgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggaktgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995853_S_P-D Feature FT:CDS DQ995853_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts17_24mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagartctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
ggtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatga
gtccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggaktgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995854_S_P-D Feature FT:CDS DQ995854_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts23_PreT-28mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggraactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgwcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995855_S_P-D Feature FT:CDS DQ995855_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts23_PreT-24mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctgtctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995856_S_P-D Feature FT:CDS DQ995856_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts23_12mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
wtccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctgtctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995857_S_P-D Feature FT:CDS DQ995857_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts23_24mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggraactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccracttgwcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtggcccgtttg
tcctcyaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctgwctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995858_S_P-D Feature FT:CDS DQ995858_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts27_PreT). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacrggcggggtttttcttgttgacaaaaatcctcac
aataccgcaragtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggatcatgccgaacatgcacgactcctgctcaaggaacctctatga
atccctcctgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagwctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995859_S_P-D Feature FT:CDS DQ995859_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts27_12mo). Partial genome (Contains: Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggatttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcatctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggatcatgccgaacctgcacgactcctgctcaaggaacctctatga
atccctcctgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagttttctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995860_S_P-D Feature FT:CDS DQ995860_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts27_24mo). Partial genome (Contains: Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggatttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattcaaggatcctcaaccaccagcacgggatcatgccgaacctgcacgactcctgctcaaggaacctctatga
atccctcctgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagttttctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatagatgatgtggtattgggggccaagwctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995861_S_P-D Feature FT:CDS DQ995861_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts24_3mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatycctascacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcwtcatccwgcggctatgcctcatcttcttgttggtwcttctggactatmaaggtatgttgcccgtctg
tcctctgattccaggatcgtcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttwctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttktgtctttgggtgtacatttaa
>gnl|hbvcds|DQ995862_S_P-D Feature FT:CDS DQ995862_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pts24_6mo). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatycctascacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcwtcatccwgcggctatgcctcatcttcttgttggtwcttctggactatmaaggtatgttgcccgtctg
tcctctgattccaggatcgtcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttwctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttktgtctttgggtgtacatttaa
>gnl|hbvcds|EF103275_S_P-D Feature FT:CDS EF103275_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF103276_S_P-D Feature FT:CDS EF103276_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran22). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaacaattgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctccaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgttgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF103277_S_P-D Feature FT:CDS EF103277_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran33). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtgtgcggcgttta
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF103279_S_P-D Feature FT:CDS EF103279_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran99). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF103280_S_P-D Feature FT:CDS EF103280_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran100). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtggccctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EF103281_S_P-D Feature FT:CDS EF103281_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran102). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtggccctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF398036_S_P-D Feature FT:CDS EF398036_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Japreira 68). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtgggcttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgccctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacccgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547858_S_P-D Feature FT:CDS EF547858_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FD09-0). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcctagggctatc
ccccactgtttggctatcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690471_S_P-D Feature FT:CDS EF690471_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 020-N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690472_S_P-D Feature FT:CDS EF690472_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 328-S). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgaccactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690473_S_P-D Feature FT:CDS EF690473_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 344-S). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccacagtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcaattatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690474_S_P-D Feature FT:CDS EF690474_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 026-N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690475_S_P-D Feature FT:CDS EF690475_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 376-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690476_S_P-D Feature FT:CDS EF690476_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 141-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690477_S_P-D Feature FT:CDS EF690477_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 377-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690478_S_P-D Feature FT:CDS EF690478_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 339-S). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccgggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690479_S_P-D Feature FT:CDS EF690479_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 041-N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacaactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690480_S_P-D Feature FT:CDS EF690480_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 372-S). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690481_S_P-D Feature FT:CDS EF690481_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 208-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgcgtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690482_S_P-D Feature FT:CDS EF690482_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 149-CW). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctagaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690483_S_P-D Feature FT:CDS EF690483_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 189-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggagcccaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU155893_S_P-D Feature FT:CDS EU155893_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggggaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcaaagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaatttcaggatcctcaaccaccagcacgggaccctgccgaccctgcataacaactgctcaagaaacctctatgt
ttgcctcatgttgctgtaccaaacctttggacggaaattacacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggacgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU155895_S_P-D Feature FT:CDS EU155895_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 5b). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcag
aataccgcagagtctagactcgtggtggacttctctcaattttcaagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaaccttcaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttctcgttggctcttctggactatcggggtatgttgcccgtttg
tcctccaatgctagcatcctcaaacaccagcaggggcacatgccgaagctgcatgatacatgctccaggaacctctatgt
ctcccttctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggggtgggcctcagcccgtttctcctggctcagttcactagtgcaatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatatggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaatttccttttatctttgggtatacatttaa
>gnl|hbvcds|EU159677_S_P-D Feature FT:CDS EU159677_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Irish-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatacctcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU346890_S_P-D Feature FT:CDS EU346890_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacatgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaaggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU414105_S_P-D Feature FT:CDS EU414105_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggaytcctaggaccccttctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaytgtttggctttcagytatatggatgatgtggtattgggggcsaagtctgtaymgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414106_S_P-D Feature FT:CDS EU414106_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414107_S_P-D Feature FT:CDS EU414107_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414108_S_P-D Feature FT:CDS EU414108_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctactatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgcacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414109_S_P-D Feature FT:CDS EU414109_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttma
>gnl|hbvcds|EU414110_S_P-D Feature FT:CDS EU414110_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414111_S_P-D Feature FT:CDS EU414111_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacgcaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414112_S_P-D Feature FT:CDS EU414112_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414113_S_P-D Feature FT:CDS EU414113_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414114_S_P-D Feature FT:CDS EU414114_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccrcagagtctagactcgtggtggacttctctcaattttctaggggagaacgccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccarggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggrctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgtcgcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414115_S_P-D Feature FT:CDS EU414115_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcrcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
ygctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414116_S_P-D Feature FT:CDS EU414116_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacaactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414117_S_P-D Feature FT:CDS EU414117_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctgattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414118_S_P-D Feature FT:CDS EU414118_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagaatctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcaggacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414119_S_P-D Feature FT:CDS EU414119_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=674 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtata
>gnl|hbvcds|EU414120_S_P-D Feature FT:CDS EU414120_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatacagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatctcgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414121_S_P-D Feature FT:CDS EU414121_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacatgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414122_S_P-D Feature FT:CDS EU414122_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414123_S_P-D Feature FT:CDS EU414123_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414124_S_P-D Feature FT:CDS EU414124_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414125_S_P-D Feature FT:CDS EU414125_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414126_S_P-D Feature FT:CDS EU414126_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414127_S_P-D Feature FT:CDS EU414127_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=679 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacattt
>gnl|hbvcds|EU414128_S_P-D Feature FT:CDS EU414128_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414129_S_P-D Feature FT:CDS EU414129_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414130_S_P-D Feature FT:CDS EU414130_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatatgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414131_S_P-D Feature FT:CDS EU414131_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactmccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcytgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactmtcaaggtatgttgcccgtytg
tcctctaattccaggatcwtcaaccaccagyrygggaccmtgcmraacctgcacgactmytgytcaaggaacctctatgt
wtccctcmtgttgctgtwcmaaaccttcggacggaaattgcacytgtattcccatcccatcatcmtgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgymgggctttc
ccccactgtytggctttcagttatatggatgatgtggtattgggggccaagtctgtacarcatcttgagtccctttwtac
ckctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414135_S_P-D Feature FT:CDS EU414135_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414136_S_P-D Feature FT:CDS EU414136_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacgcaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414138_S_P-D Feature FT:CDS EU414138_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatatgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414139_S_P-D Feature FT:CDS EU414139_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414140_S_P-D Feature FT:CDS EU414140_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactmccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcytgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactmtcaaggtatgttgcccgtytg
tcctctaattccaggatcwtcaaccaccagyrygggaccmtgcmraacctgcacgactmytgytcaaggaacctctatgt
wtccctcmtgttgctgtwcmaaaccttcggacggaaattgcacytgtattcccatcccatcatcmtgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgymgggctttc
ccccactgtytggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414141_S_P-D Feature FT:CDS EU414141_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414142_S_P-D Feature FT:CDS EU414142_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggaytcctaggaccccttctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaytgtttggctttcagytatatggatgatgtggtattgggggccaagtctgtaycgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414143_S_P-D Feature FT:CDS EU414143_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctactatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgcacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594382_S_P-D Feature FT:CDS EU594382_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594396_S_P-D Feature FT:CDS EU594396_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacytgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594397_S_P-D Feature FT:CDS EU594397_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594398_S_P-D Feature FT:CDS EU594398_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactgctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594399_S_P-D Feature FT:CDS EU594399_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594400_S_P-D Feature FT:CDS EU594400_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594401_S_P-D Feature FT:CDS EU594401_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594402_S_P-D Feature FT:CDS EU594402_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594403_S_P-D Feature FT:CDS EU594403_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594404_S_P-D Feature FT:CDS EU594404_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594405_S_P-D Feature FT:CDS EU594405_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaaccctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594407_S_P-D Feature FT:CDS EU594407_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594408_S_P-D Feature FT:CDS EU594408_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|EU594409_S_P-D Feature FT:CDS EU594409_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594410_S_P-D Feature FT:CDS EU594410_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594411_S_P-D Feature FT:CDS EU594411_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactattgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594412_S_P-D Feature FT:CDS EU594412_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactattgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594413_S_P-D Feature FT:CDS EU594413_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594414_S_P-D Feature FT:CDS EU594414_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594415_S_P-D Feature FT:CDS EU594415_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594416_S_P-D Feature FT:CDS EU594416_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcgaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594417_S_P-D Feature FT:CDS EU594417_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594418_S_P-D Feature FT:CDS EU594418_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594419_S_P-D Feature FT:CDS EU594419_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594420_S_P-D Feature FT:CDS EU594420_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594421_S_P-D Feature FT:CDS EU594421_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594422_S_P-D Feature FT:CDS EU594422_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594423_S_P-D Feature FT:CDS EU594423_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594424_S_P-D Feature FT:CDS EU594424_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594425_S_P-D Feature FT:CDS EU594425_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgkttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtytg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagagctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594426_S_P-D Feature FT:CDS EU594426_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594427_S_P-D Feature FT:CDS EU594427_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594428_S_P-D Feature FT:CDS EU594428_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594429_S_P-D Feature FT:CDS EU594429_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594430_S_P-D Feature FT:CDS EU594430_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594431_S_P-D Feature FT:CDS EU594431_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594432_S_P-D Feature FT:CDS EU594432_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594433_S_P-D Feature FT:CDS EU594433_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaacatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594434_S_P-D Feature FT:CDS EU594434_S_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaccctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|EU686583_S_P-D Feature FT:CDS EU686583_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 72A05). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787436_S_P-D Feature FT:CDS EU787436_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 165). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787437_S_P-D Feature FT:CDS EU787437_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggatcctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787438_S_P-D Feature FT:CDS EU787438_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787439_S_P-D Feature FT:CDS EU787439_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 89). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787440_S_P-D Feature FT:CDS EU787440_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W17). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787441_S_P-D Feature FT:CDS EU787441_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W32). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787442_S_P-D Feature FT:CDS EU787442_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W37). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787443_S_P-D Feature FT:CDS EU787443_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate w40). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU787445_S_P-D Feature FT:CDS EU787445_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W51). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtattggccaaaattagc
agtccccaacctacaatcactcaccagcatcaagtcctccaacttgtcgtggttatcgctggacgtgtatgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttatggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacatgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787446_S_P-D Feature FT:CDS EU787446_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W75). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787447_S_P-D Feature FT:CDS EU787447_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W46). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgagtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU919197_S_P-D Feature FT:CDS EU919197_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XJU). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
accatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctactgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU921418_S_P-D Feature FT:CDS EU921418_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 22.165.07). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgataagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU921419_S_P-D Feature FT:CDS EU921419_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 22.252.07). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgtcgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939680_S_P-D Feature FT:CDS EU939680_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C186). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtgtg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgattcctgctcaaggaacctctatgt
atccctcttgttgctgtaccaaagcttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccatttctccttgctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939681_S_P-D Feature FT:CDS EU939681_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D146). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349205_S_P-D Feature FT:CDS FJ349205_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349206_S_P-D Feature FT:CDS FJ349206_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FJ349208_S_P-D Feature FT:CDS FJ349208_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H25). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349209_S_P-D Feature FT:CDS FJ349209_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349211_S_P-D Feature FT:CDS FJ349211_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H34). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349213_S_P-D Feature FT:CDS FJ349213_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H59). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcgaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349214_S_P-D Feature FT:CDS FJ349214_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H61). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgacaactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349215_S_P-D Feature FT:CDS FJ349215_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H82). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgatacaggcggggtttttcttgttgataagaatcctcac
aataacgcacagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtgttgtccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ349216_S_P-D Feature FT:CDS FJ349216_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H113). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ349217_S_P-D Feature FT:CDS FJ349217_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H129). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggtggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ349218_S_P-D Feature FT:CDS FJ349218_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H135). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggattgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349219_S_P-D Feature FT:CDS FJ349219_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H138). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctagcacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcacggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttga
>gnl|hbvcds|FJ349220_S_P-D Feature FT:CDS FJ349220_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H144). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ349228_S_P-D Feature FT:CDS FJ349228_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349229_S_P-D Feature FT:CDS FJ349229_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C26). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ349230_S_P-D Feature FT:CDS FJ349230_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcctacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349231_S_P-D Feature FT:CDS FJ349231_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C22). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggttttgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349232_S_P-D Feature FT:CDS FJ349232_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C51). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgacttctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349233_S_P-D Feature FT:CDS FJ349233_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C54). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcttggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349234_S_P-D Feature FT:CDS FJ349234_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C82). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349235_S_P-D Feature FT:CDS FJ349235_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C90). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386590_S_P-D Feature FT:CDS FJ386590_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1841). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562309_S_P-D Feature FT:CDS FJ562309_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I200). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacctgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562338_S_P-D Feature FT:CDS FJ562338_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I192). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgacttctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
tgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621799_S_P-D Feature FT:CDS FJ621799_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2898). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactwccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ622444_S_P-D Feature FT:CDS FJ622444_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2816). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagmacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ622867_S_P-D Feature FT:CDS FJ622867_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S4534). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaayctgcacgmytcctgctcaaggaacctctatgt
atccctcttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ622868_S_P-D Feature FT:CDS FJ622868_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2943). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaayctctatgt
atccctcctgttgctgtacaaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ622869_S_P-D Feature FT:CDS FJ622869_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S4146). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcarttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ622870_S_P-D Feature FT:CDS FJ622870_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2786). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ622871_S_P-D Feature FT:CDS FJ622871_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S4757). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
ggtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692502_S_P-D Feature FT:CDS FJ692502_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_48020). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggttttttttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692504_S_P-D Feature FT:CDS FJ692504_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_48075). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aatacctcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692505_S_P-D Feature FT:CDS FJ692505_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50151). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactattgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggcaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692506_S_P-D Feature FT:CDS FJ692506_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50157). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactattgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692507_S_P-D Feature FT:CDS FJ692507_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50158). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactattgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692508_S_P-D Feature FT:CDS FJ692508_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48050). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692509_S_P-D Feature FT:CDS FJ692509_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48063). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692510_S_P-D Feature FT:CDS FJ692510_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48064). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692511_S_P-D Feature FT:CDS FJ692511_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48082). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692512_S_P-D Feature FT:CDS FJ692512_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48092). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccttgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692513_S_P-D Feature FT:CDS FJ692513_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48099). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692514_S_P-D Feature FT:CDS FJ692514_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48100). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcaraacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692515_S_P-D Feature FT:CDS FJ692515_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48101). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggcyttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692516_S_P-D Feature FT:CDS FJ692516_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48102). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692517_S_P-D Feature FT:CDS FJ692517_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48106). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacarcatcttgagkccctttwtac
ckctgtkaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692518_S_P-D Feature FT:CDS FJ692518_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48108). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692519_S_P-D Feature FT:CDS FJ692519_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48110). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacmaaaccttcggatggaaactgcacctgtattcccatcccatcrtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692520_S_P-D Feature FT:CDS FJ692520_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48112). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692521_S_P-D Feature FT:CDS FJ692521_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48114). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692522_S_P-D Feature FT:CDS FJ692522_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48115). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692523_S_P-D Feature FT:CDS FJ692523_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48116). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692524_S_P-D Feature FT:CDS FJ692524_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48117). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692525_S_P-D Feature FT:CDS FJ692525_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48118). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgyctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacggctcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692526_S_P-D Feature FT:CDS FJ692526_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48119). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692527_S_P-D Feature FT:CDS FJ692527_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48120). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692528_S_P-D Feature FT:CDS FJ692528_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_48121). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692529_S_P-D Feature FT:CDS FJ692529_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50003). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcmtgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagamtgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692530_S_P-D Feature FT:CDS FJ692530_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50044). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctatttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692531_S_P-D Feature FT:CDS FJ692531_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50051). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692532_S_P-D Feature FT:CDS FJ692532_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50053). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692533_S_P-D Feature FT:CDS FJ692533_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50064). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692534_S_P-D Feature FT:CDS FJ692534_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50071). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692535_S_P-D Feature FT:CDS FJ692535_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50072). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692537_S_P-D Feature FT:CDS FJ692537_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50078). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692538_S_P-D Feature FT:CDS FJ692538_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50079). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=687 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ctacccccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccct
ttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692539_S_P-D Feature FT:CDS FJ692539_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50153). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692541_S_P-D Feature FT:CDS FJ692541_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate E_48105). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggararcatcacatcaggattcctaggacccctgctcgtgttacaggcgggrtttttcttgttgacaaraatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggarctmccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcytgtcctccaayttgtcctggytatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcwtcaaccaccagcacgggaccctgcmgaacctgcacgactcytgctcaaggaacctctatgt
wtccctcmtgttgctgtwcaaaaccttcggayggaaaytgcacytgtattcccatcccatcrtcmtgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcytggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacarcatcttgagtccctttwtac
ckctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ709467_S_P-D Feature FT:CDS FJ709467_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CHI11). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactamcaaggtatcttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacatgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactactcagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ709474_S_P-D Feature FT:CDS FJ709474_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CHI18). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagaatctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacttgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggattgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ709475_S_P-D Feature FT:CDS FJ709475_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CHI19). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ709486_S_P-D Feature FT:CDS FJ709486_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CHI33). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ709492_S_P-D Feature FT:CDS FJ709492_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CHI39). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ751383_S_P-D Feature FT:CDS FJ751383_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WX39). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ899792_S_P-D Feature FT:CDS FJ899792_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D146-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacgtcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccggcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904395_S_P-D Feature FT:CDS FJ904395_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A10a). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagartctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcatgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgttgtattgggggccaactctgcacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904399_S_P-D Feature FT:CDS FJ904399_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A18). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904402_S_P-D Feature FT:CDS FJ904402_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A26). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904410_S_P-D Feature FT:CDS FJ904410_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A54b). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttggcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904412_S_P-D Feature FT:CDS FJ904412_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A56). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904415_S_P-D Feature FT:CDS FJ904415_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A63). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904418_S_P-D Feature FT:CDS FJ904418_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A69a). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904419_S_P-D Feature FT:CDS FJ904419_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A70). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgtttcaggcggggtgtttcttgttgacaagaatcctcac
aatgccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtccctttttac
cgctgtttccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904420_S_P-D Feature FT:CDS FJ904420_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A71a). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904421_S_P-D Feature FT:CDS FJ904421_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A71b). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904422_S_P-D Feature FT:CDS FJ904422_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A76). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccmtgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904424_S_P-D Feature FT:CDS FJ904424_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A79a). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgacacctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904426_S_P-D Feature FT:CDS FJ904426_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904427_S_P-D Feature FT:CDS FJ904427_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgccttggccaaaattcgc
agtccccgacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggaaagaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904429_S_P-D Feature FT:CDS FJ904429_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aatgccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaaccttctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904431_S_P-D Feature FT:CDS FJ904431_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B12). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgtggacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcacatcttgastccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904432_S_P-D Feature FT:CDS FJ904432_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcaaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ904433_S_C-D Feature FT:CDS FJ904433_S_C-D of [Viruses] Hepatitis B Virus genotype D (isolate B15). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtccatacagcatctwgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904435_S_P-D Feature FT:CDS FJ904435_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B27). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904438_S_P-D Feature FT:CDS FJ904438_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B32). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtgcaccaycttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904439_S_P-D Feature FT:CDS FJ904439_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B34). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904443_S_P-D Feature FT:CDS FJ904443_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B46). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904445_S_P-D Feature FT:CDS FJ904445_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B62). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagaatctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904446_S_P-D Feature FT:CDS FJ904446_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B64a). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctagaacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccctaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200190_S_P-D Feature FT:CDS FM200190_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200191_S_P-D Feature FT:CDS FM200191_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200192_S_P-D Feature FT:CDS FM200192_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctcccaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtwaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200194_S_P-D Feature FT:CDS FM200194_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcaraacctgcacgactcctgctcaaggaacctctatrt
wtccctcctgttgctgtacaaaaccttcggatggaaaytgcacctgtattcccatcccatcatcytgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttwtac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200196_S_P-D Feature FT:CDS FM200196_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctcycaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaycaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200197_S_P-D Feature FT:CDS FM200197_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200200_S_P-D Feature FT:CDS FM200200_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200205_S_P-D Feature FT:CDS FM200205_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200212_S_P-D Feature FT:CDS FM200212_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatat
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200213_S_P-D Feature FT:CDS FM200213_S_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtyttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295498_S_P-D Feature FT:CDS FN295498_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295500_S_P-D Feature FT:CDS FN295500_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggccgggtttttcttgttgacaagaatcctcac
aataccgcagaatctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcttgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaacctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295501_S_P-D Feature FT:CDS FN295501_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295504_S_P-D Feature FT:CDS FN295504_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctccaccaccagcacgggaccatgcagagcctgcacgactcctgctcaaggaacctctatat
atccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|FN295506_S_P-D Feature FT:CDS FN295506_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaccctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN295512_S_P-D Feature FT:CDS FN295512_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M20). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatattgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaactttcggaaagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN295513_S_P-D Feature FT:CDS FN295513_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M21). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaactttcggacagaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN295514_S_P-D Feature FT:CDS FN295514_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M22). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactatcgagtgtcttggccaaaattcgc
agtccccaacctccaagcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295515_S_P-D Feature FT:CDS FN295515_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M23). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295516_S_P-D Feature FT:CDS FN295516_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M24). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295517_S_P-D Feature FT:CDS FN295517_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M25). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcatttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacaaaacctttggatggaaactgcacctgtattcccatcccatcatcatgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgtcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295519_S_P-D Feature FT:CDS FN295519_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M27). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggccggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295523_S_P-D Feature FT:CDS FN295523_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M33). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctgrctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN295524_S_P-D Feature FT:CDS FN295524_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M34). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagaatctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggactatgcagaacctgcacgattcctgctcaaggaacctctattc
atccctcctgttgctgtaccaaaccttcggtcggaaattgcacctgtattcccatcccaccatcttgggctttcggaaaa
ttcctatgggagttggcctcagcccgtttctcctggctcagttcactagtgccatttgttcggtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttac
tgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295525_S_P-D Feature FT:CDS FN295525_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M35). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatca
atccctcctgttgctgtaccaaaagtttggacaaaaattgcacttgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgctatttgttcagtggttcgtagatcgttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295526_S_P-D Feature FT:CDS FN295526_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M36). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggattgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295545_S_P-D Feature FT:CDS FN295545_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D2_D). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtattacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggatggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295546_S_P-D Feature FT:CDS FN295546_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_D). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatccttctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295547_S_P-D Feature FT:CDS FN295547_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_D). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295548_S_P-D Feature FT:CDS FN295548_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D5_D). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295549_S_P-D Feature FT:CDS FN295549_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D6_D). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ167301_S_P-D Feature FT:CDS GQ167301_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM452). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactatcgaggtatgttgcccgtttg
tccggtaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggcctttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ167302_S_P-D Feature FT:CDS GQ167302_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4521). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgcgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactatcgaggtatgttgcccgtttg
tccggtaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggcctttagttatacggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183448_S_P-D Feature FT:CDS GQ183448_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4629). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183449_S_P-D Feature FT:CDS GQ183449_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4591). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcaacaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183450_S_P-D Feature FT:CDS GQ183450_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4589). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183451_S_P-D Feature FT:CDS GQ183451_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4588). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183452_S_P-D Feature FT:CDS GQ183452_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4590). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183453_S_P-D Feature FT:CDS GQ183453_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4574). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183454_S_P-D Feature FT:CDS GQ183454_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4582). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183455_S_P-D Feature FT:CDS GQ183455_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4573). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183456_S_P-D Feature FT:CDS GQ183456_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4572). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183457_S_P-D Feature FT:CDS GQ183457_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4583). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183458_S_P-D Feature FT:CDS GQ183458_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4587). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183459_S_P-D Feature FT:CDS GQ183459_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4585). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183460_S_P-D Feature FT:CDS GQ183460_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4584). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183461_S_P-D Feature FT:CDS GQ183461_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4586). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183462_S_P-D Feature FT:CDS GQ183462_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4567). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183463_S_P-D Feature FT:CDS GQ183463_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4613). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183464_S_P-D Feature FT:CDS GQ183464_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4703). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183465_S_P-D Feature FT:CDS GQ183465_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4614). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183466_S_P-D Feature FT:CDS GQ183466_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4577). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183467_S_P-D Feature FT:CDS GQ183467_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4705). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtgtgctgcgcggc
atcatattactcttcctcttgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttttctttgggtatacatttaa
>gnl|hbvcds|GQ183468_S_P-D Feature FT:CDS GQ183468_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4632). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
cataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183469_S_P-D Feature FT:CDS GQ183469_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4602). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183470_S_P-D Feature FT:CDS GQ183470_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4639). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183471_S_P-D Feature FT:CDS GQ183471_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4610). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgacttctgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183472_S_P-D Feature FT:CDS GQ183472_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4691). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgacaactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183473_S_P-D Feature FT:CDS GQ183473_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4601). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcccttattac
cgctgttaccatttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183474_S_P-D Feature FT:CDS GQ183474_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4594). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183475_S_P-D Feature FT:CDS GQ183475_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4575). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183476_S_P-D Feature FT:CDS GQ183476_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4603). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183477_S_P-D Feature FT:CDS GQ183477_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4604). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtcttgactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgacaactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183478_S_P-D Feature FT:CDS GQ183478_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4605). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183479_S_P-D Feature FT:CDS GQ183479_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4607). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgcgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183480_S_P-D Feature FT:CDS GQ183480_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4609). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccgcagagtcttgactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaccctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183481_S_P-D Feature FT:CDS GQ183481_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4569). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgttcaaggagcctctatgt
atccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183482_S_P-D Feature FT:CDS GQ183482_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4570). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgt
atccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183483_S_P-D Feature FT:CDS GQ183483_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4566). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgt
atccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183484_S_P-D Feature FT:CDS GQ183484_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4598). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgactttgggtatacatttaa
>gnl|hbvcds|GQ183485_S_P-D Feature FT:CDS GQ183485_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4599). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtcttgactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ184322_S_P-D Feature FT:CDS GQ184322_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4522). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttg
tccggtaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggcctttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ205380_S_P-D Feature FT:CDS GQ205380_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1245). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcacggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ205382_S_P-D Feature FT:CDS GQ205382_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1360d). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccagcttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ205384_S_P-D Feature FT:CDS GQ205384_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1434d). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccggcttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ205385_S_P-D Feature FT:CDS GQ205385_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1469). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaatttcaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacgaaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ205388_S_P-D Feature FT:CDS GQ205388_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1562). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ205389_S_P-D Feature FT:CDS GQ205389_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1667). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacgaaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ325778_S_P-D Feature FT:CDS GQ325778_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcmtggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatrtggatgatgtggtattgggggccaagtctgtacagcaccttgaagccctttttac
cgctgttaccaattttcttktgtctttgggtatacatctaa
>gnl|hbvcds|GQ353298_S_P-D Feature FT:CDS GQ353298_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacattaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcactttacac
cgctgttactaattttctgttgtctttgggcatacatttaa
>gnl|hbvcds|GQ353299_S_P-D Feature FT:CDS GQ353299_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ353300_S_P-D Feature FT:CDS GQ353300_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ353301_S_P-D Feature FT:CDS GQ353301_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ353302_S_P-D Feature FT:CDS GQ353302_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK5). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgatgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ353303_S_P-D Feature FT:CDS GQ353303_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ353304_S_P-D Feature FT:CDS GQ353304_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ377589_S_P-D Feature FT:CDS GQ377589_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate J145). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477452_S_P-D Feature FT:CDS GQ477452_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P32). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctgattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcaaagtctgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477453_S_P-D Feature FT:CDS GQ477453_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P39). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttccaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaa
ttcctatgggaatgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaggccctttttac
agctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477454_S_P-D Feature FT:CDS GQ477454_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P68). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcaa
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatttgcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcgtcaaccaccagcacgggaacatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctttctcagttcactaccgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttac
cgccgtgaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ477455_S_P-D Feature FT:CDS GQ477455_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P73). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcaaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477456_S_P-D Feature FT:CDS GQ477456_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P84). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477457_S_P-D Feature FT:CDS GQ477457_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P118). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477458_S_P-D Feature FT:CDS GQ477458_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P126). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcatcaa
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcttgctcaaggaacctctatgt
atccctcctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477459_S_P-D Feature FT:CDS GQ477459_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P127). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486036_S_P-D Feature FT:CDS GQ486036_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcarttttctagggggaacyaccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacwtgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccamgtctgtacagcatcttgagtccctttttac
cgctgtwaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486037_S_P-D Feature FT:CDS GQ486037_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttycttgttgacaagaatcctcac
aataccrmagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatctkcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagracctgcacgactcctgctcaaggaacctctatgw
atccctcytgttgctgtaccaaaccttcggmcggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486039_S_P-D Feature FT:CDS GQ486039_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtwttgggggccaaatctgtacarcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486040_S_P-D Feature FT:CDS GQ486040_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486041_S_P-D Feature FT:CDS GQ486041_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttycttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcttcaaccaccagcgcgggamcatgcagaacctgcacgactactgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgsaaaa
ttcctatgggrgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctwtttac
cgctgttacyaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486042_S_P-D Feature FT:CDS GQ486042_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaycatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486043_S_P-D Feature FT:CDS GQ486043_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS8). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgmagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcaraacctgcacgactyctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatctygagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486044_S_P-D Feature FT:CDS GQ486044_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486045_S_P-D Feature FT:CDS GQ486045_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgyagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgaggccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486046_S_P-D Feature FT:CDS GQ486046_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS11). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttwcaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tccyctrattccaggatcctcaaccaccagcacgggahcatgccgaacctgcacgactcctgctcaaggaahctctatry
atccctcmtgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486047_S_P-D Feature FT:CDS GQ486047_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagaatctagactcgtggtggacttctctcaattttctaggggraamcaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtsctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcraggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttyagttatatggatgatgtggtattgggggccaagwctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486048_S_P-D Feature FT:CDS GQ486048_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS13). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486049_S_P-D Feature FT:CDS GQ486049_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS14). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaargtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaargaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgtkaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486051_S_P-D Feature FT:CDS GQ486051_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS16). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaytgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacascatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486052_S_P-D Feature FT:CDS GQ486052_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS17). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctmcacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486053_S_P-D Feature FT:CDS GQ486053_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS18). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctcwaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgytgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486054_S_P-D Feature FT:CDS GQ486054_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS19). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgmagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatctkcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttwtgtctttgggtatacatttaa
>gnl|hbvcds|GQ486055_S_P-D Feature FT:CDS GQ486055_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS20). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacmaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacaccaccttgamgccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486056_S_P-D Feature FT:CDS GQ486056_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS21). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccrcagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcttggccaarattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtytg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtacmaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggaygatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486058_S_P-D Feature FT:CDS GQ486058_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS23). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacwaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagkggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacmgcaycttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486059_S_P-D Feature FT:CDS GQ486059_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS24). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaacgaccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccracttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
atccykcctgttgctgtacmaaaccttcggacggaaattgcacatgtattcccatcccatcrtcttgggctttcggaaaa
ttcctatgggartgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggaygatgtggtattgggggccaartctgwstcgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486060_S_P-D Feature FT:CDS GQ486060_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS25). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tccymtrattccgggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgt
wtccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486064_S_P-D Feature FT:CDS GQ486064_S_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GS29). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctkctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggracyaccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcarggtatgttgcccgtktg
tcctctaattccaggatcytcaacyaccagcacgggaccatgcmgaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcca