HBVdb

Dataset for nucleotide sequence S of genotype D

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                               *                                
ATGGAGAACATCACATCAGGATTCCTAGGACCCCTgCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCAC
     a g             c             t                      c           ag        
                     y                                                          
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                  *               *                                *            
AATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGaACtACCGTGTGTCTTGGCCAAAATTCGC
      aa                              g           ag ac          g              
                                                      y                         
                                                      g                         
                                                      a                         

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                    *                             *  * **                *      
AGTCCCCAACCTCCAATCACTCACCAACCTCCTGTCCTCCAACTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTT
                               t        g     a     a     t       a             
                                        r                                       
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **     *    *                                                                 
ATCATcTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTtTG
     a                                                       gg              c  
     m                                                        c              g  
                                                                                
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TCCTCTAATTCCA------GGATCtTCAACcACCAGCacGGGACCaTGCaGAACCTGCACGACTcCTGcTCAAGGAACCT
      gc                c  g  t      gt    t c   cag       t   aat  t  g        
                        a     a            a       c           c                
                        g                                                       
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                         *             *  * *        *       *  
CTATGTATCCCTCCTGTTGCTGTACcAAACCTTCGGACGGAAATTGCACCTGTATTCCCATCCCATCATCcTGGGCTTTC
     at      a  c  t    ta     c t   t     c     a                 g  t         
             t           m                       t                    a         
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *          *                                             *     *             
GGAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCcTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGG
 c                          t         t          c         c                c   
                                      a                                         
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                      *                         
GCTTT------CCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAgCATCTTGA
                 t           t      g t                       aa   cgtca  c     
                 y           y                                r     t  c  y     
                                                                       r        
                                                                                

       650       660       670       680       690   
....:....|....:....|....:....|....:....|....:....|...
                 *       *                           
GTCCCTTTTTACCGCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAA
 g      a                      c     c    cg      ---
                                     g             g 
                                                     
                                                     
© 1998-2020Legal notice