HBVdb

Dataset for nucleotide sequence PreC of genotype C

[Download (right click)] [Alignment] [Repertoires]

2910 sequence(s)

>gnl|hbvcds|AB014360_PreC_P-C Feature FT:CDS AB014360_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01D01HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggatttagtagtcagctatgtcaatgttaatatgggcataaaaatcagacaactattgtggttccaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014361_PreC_P-C Feature FT:CDS AB014361_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 02D02HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaacctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaacgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014362_PreC_P-C Feature FT:CDS AB014362_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 03D03HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014363_PreC_P-C Feature FT:CDS AB014363_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 04D04HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctagacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccaca
tttcctgtcttacttttggaagagacactgtttgtgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccatcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB014364_PreC_P-C Feature FT:CDS AB014364_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 05D05HCC). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccgggacattgtacacctcac
catacagcactcaggcaagccattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014365_PreC_P-C Feature FT:CDS AB014365_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01D06HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacccctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014367_PreC_P-C Feature FT:CDS AB014367_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 08D08HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratctcaatgttag
>gnl|hbvcds|AB014368_PreC_P-C Feature FT:CDS AB014368_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 09D09HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagccctcaggcaagctattctgtgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctcgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014369_PreC_P-C Feature FT:CDS AB014369_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10D10HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcttaaaactcaggcaactactgtggtttcaca
tttcctgtctcacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB014371_PreC_P-C Feature FT:CDS AB014371_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 12D12HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctcatgacttctttc
cttccattcgagatctcctcgacaccgcttcagctctgtatcgggaggccttggagtctccggaacattgttcacctcac
cayacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttagaaga
cccaacatccagggaagcagtagtcggctatgtcaacgttaatatgggcttaaaactcaggcaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaggct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB014372_PreC_P-C Feature FT:CDS AB014372_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 13D13HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014373_PreC_P-C Feature FT:CDS AB014373_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 14D14HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgyaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattatctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014374_PreC_P-C Feature FT:CDS AB014374_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 15D15HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgcctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014376_PreC_P-C Feature FT:CDS AB014376_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 17T02HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtctgttggggtgagttgatgaatctggccacatgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014377_PreC_P-C Feature FT:CDS AB014377_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18T03HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacctctggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctmccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014378_PreC_P-C Feature FT:CDS AB014378_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 19Y01HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacgtttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctacccct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014379_PreC_P-C Feature FT:CDS AB014379_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 20Y02HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|AB014380_PreC_P-C Feature FT:CDS AB014380_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 21Y03HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014381_PreC_P-C Feature FT:CDS AB014381_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 22Y04HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcagacaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccatcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB014382_PreC_P-C Feature FT:CDS AB014382_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23Y05HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttctgcgctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagctctcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB014383_PreC_P-C Feature FT:CDS AB014383_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 24Y06HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctatacgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tctcctgtcttacttttggaagagacactgttcttgagtacttggtgtctttcggagtgtggattcgcactcctactgct
tacagaccaacaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB014384_PreC_P-C Feature FT:CDS AB014384_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 25Y07HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcttgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagacccccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB014385_PreC_P-C Feature FT:CDS AB014385_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26Y08HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014386_PreC_P-C Feature FT:CDS AB014386_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 27Y09HCC). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggacga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcatcacttccggaaacttgtgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttaa
>gnl|hbvcds|AB014387_PreC_P-C Feature FT:CDS AB014387_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 28Y10HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrggacatggacattgacccatataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaagccttagagtctccggagcattgttcacctcac
catacagcacttaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagcaatttagaaga
tccagcatccagggaattagtagtcaggtatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|AB014388_PreC_P-C Feature FT:CDS AB014388_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 29Y11HCC). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagccgttctgtgttggggggagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtctcacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|AB014390_PreC_P-C Feature FT:CDS AB014390_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 31Y13HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcmtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014391_PreC_P-C Feature FT:CDS AB014391_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 32Y14HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcgattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB014392_PreC_P-C Feature FT:CDS AB014392_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 33Y15HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctcctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014393_PreC_P-C Feature FT:CDS AB014393_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 34Y16HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtcttcggaacattgtacacctcac
catacagcactcaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagacactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctmctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|AB014394_PreC_P-C Feature FT:CDS AB014394_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 35Y17HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctactctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggcaga
cccagcatccagggacttagtagtcaactatgtcaatgttaatatgggcctaaaattcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014395_PreC_P-C Feature FT:CDS AB014395_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 36Y18HCC). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcaatcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014396_PreC_P-C Feature FT:CDS AB014396_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 37Y19HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcaattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB014397_PreC_P-C Feature FT:CDS AB014397_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 38Y20HCC). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttccattcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB014398_PreC_P-C Feature FT:CDS AB014398_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 39Y21HCC). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctmccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaacttgtgttgttagacaacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB014399_PreC_P-C Feature FT:CDS AB014399_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 40Y22HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB026811_PreC_P-C Feature FT:CDS AB026811_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;97.Feb.). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB026812_PreC_P-C Feature FT:CDS AB026812_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;98.May). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB026813_PreC_P-C Feature FT:CDS AB026813_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;97.Sep.). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacgactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB026814_PreC_P-C Feature FT:CDS AB026814_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Donor 3;98.May). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB026815_PreC_P-C Feature FT:CDS AB026815_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 2:full). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacactgcctctgctctgtatcgcgaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB031262_PreC_P-C Feature FT:CDS AB031262_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV VietA-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggggagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacagctgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB033550_PreC_P-C Feature FT:CDS AB033550_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NDR260). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB033551_PreC_P-C Feature FT:CDS AB033551_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK300). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB033552_PreC_P-C Feature FT:CDS AB033552_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK494). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB033553_PreC_P-C Feature FT:CDS AB033553_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK619). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB033556_PreC_P-C Feature FT:CDS AB033556_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AK66). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB042282_PreC_P-C Feature FT:CDS AB042282_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtaagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattattagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB042283_PreC_P-C Feature FT:CDS AB042283_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB042284_PreC_P-C Feature FT:CDS AB042284_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcnacaccgcctctgctctgtatcgggaggccttacagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB042285_PreC_P-C Feature FT:CDS AB042285_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-4). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
acgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttc
ctgctgttcgagatctcctcgacaccgcctctgctctgtatctggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggatgagttgatgaaactggccacctgggtgggaggtaatttggatga
ccaagcatccagggacttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB049610_PreC_P-C Feature FT:CDS AB049610_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV AN29). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctactattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgcacacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatggatctggccacctgggtgggaagtaatttggacga
cccagcatccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB050018_PreC_P-C Feature FT:CDS AB050018_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcttaaaaatcaggcaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB074047_PreC_P-C Feature FT:CDS AB074047_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcctgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggcgcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcgcctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaaga
cccagcatcccgggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttttagagtatttggtgtcttttggagtgtggattcgcactcctactcct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtagcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB074755_PreC_P-C Feature FT:CDS AB074755_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th44). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagaatcttcggaacattgttcacctcac
catacagcactaagacaagctattctgtgttggggtgagatgatgaatctggccacctgggtgggaagtaatttgcaaga
cccagcatccagggaattagtagtaagctatgtcaacgttaatatgggcctaaacatcagacaactattgtggtttcaca
tttcctgtcttacctttggaacagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB074756_PreC_P-C Feature FT:CDS AB074756_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th55). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctttgtatcgggaggccttagaatcttcggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttactttcggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB105173_PreC_P-C Feature FT:CDS AB105173_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hawaii 16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagactccggaacatagctcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB105174_PreC_P-C Feature FT:CDS AB105174_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hawaii 60). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcgtcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcgagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB106895_PreC_P-C Feature FT:CDS AB106895_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate pHB4-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaagttgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|AB111112_PreC_P-C Feature FT:CDS AB111112_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgyggagttactctcttttttgccttctgacttctttc
cttctrttcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgntcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaantcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB111113_PreC_P-C Feature FT:CDS AB111113_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgctgagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctggacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagccatgtcaatgttaatatgggcctgaaaatccgacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AB111114_PreC_P-C Feature FT:CDS AB111114_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB111116_PreC_P-C Feature FT:CDS AB111116_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctatggagttactctctttcttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB111117_PreC_P-C Feature FT:CDS AB111117_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctatggagttactctctttcttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB111118_PreC_P-C Feature FT:CDS AB111118_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggctgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattggtagtcagccatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacaaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB111119_PreC_P-C Feature FT:CDS AB111119_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB111120_PreC_P-C Feature FT:CDS AB111120_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB111121_PreC_P-C Feature FT:CDS AB111121_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB111122_PreC_P-C Feature FT:CDS AB111122_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagatgatgaatctggccacctgggtgggcagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB111123_PreC_P-C Feature FT:CDS AB111123_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggcagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB111124_PreC_P-C Feature FT:CDS AB111124_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
ctaatattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttctccgcac
catacagcactcaggcaagctattctgtgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB111125_PreC_P-C Feature FT:CDS AB111125_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
ctaatattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttctccgcac
catacagcactcaggcaagctattctgtgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggcttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcaagct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB111946_PreC_P-C Feature FT:CDS AB111946_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT103). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgtcttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctaatattcgtgatctcctcgacaccgcctctgctctgtttcgggaggcattagagtctccggaacattgtacacctcac
catacagcaataaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaggctatgtcaatgttaatatgggcctaaaattcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|AB112063_PreC_P-C Feature FT:CDS AB112063_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT101). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgtttacgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctaatattcgtgatctcctcgacaccgcctctgctctgtttcgggaggcattagagtctccggaacattgtacacctcac
catacagcaataaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaggctatgtcaatgttaatatgggcctaaaaatcagacagctgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB112065_PreC_P-C Feature FT:CDS AB112065_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT140). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctgttcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaattcggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacagctgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB112066_PreC_P-C Feature FT:CDS AB112066_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY624). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctgttcgggatctcctcgacactgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactaaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtactaagctatgtcaatgttaacatgggcctaaaaatcagacagctgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacccgct
tacagaccaccaaatgcccccatcttatcaacactcccggaaactactgttgttagacgacgaggcaggtcccctagaaa
gagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB112348_PreC_P-C Feature FT:CDS AB112348_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY656). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttggggggct
ttggggcatggacattgacccgtataaagtatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacagctgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggccggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB112408_PreC_P-C Feature FT:CDS AB112408_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY683). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttgaattcttcctaatcatctcatgctcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgaggagttactctcttttttaccttctgactactttc
cgtctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacagctgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB112471_PreC_P-C Feature FT:CDS AB112471_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TH123). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgaataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB112472_PreC_P-C Feature FT:CDS AB112472_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TH124). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgaataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgctcctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaattccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB113875_PreC_P-C Feature FT:CDS AB113875_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcgtttatgccttctgacttctttc
cttctattcgagatctcctcgataccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattaggcaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB113876_PreC_P-C Feature FT:CDS AB113876_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcgtttatgccttctgacttctttc
cttctattcgagatctcctcgataccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattaggcaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB113877_PreC_P-C Feature FT:CDS AB113877_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctatacgagatctcctcgataccgcctcagctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgcctaacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AB113878_PreC_P-C Feature FT:CDS AB113878_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgctactttttcacctttgcctaatcatctcttgctcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccatataaagaatttggagcctctgctgagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagaatctcaagaacattgttcagctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacttgggtgggcagtaatttggaaga
cccagcatcccgggaattggtagtcagctatgtcaatgttaacatgggcctgaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB113879_PreC_P-C Feature FT:CDS AB113879_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgcactgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcc
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB115417_PreC_P-C Feature FT:CDS AB115417_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-O47). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttgaattctgcctaatcatctcatgttcatgccctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgaataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctatgcgagatctcctcgacactgcatctgctctgtatcgggaggcattagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaggcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgccttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB115418_PreC_P-C Feature FT:CDS AB115418_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-O55). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcccctctgcctaatcatctcatgttcacgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgaataaagaattcggagcttctacggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctatgttggggcgaattgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatggcaatggtaatatgggcctaaaactcagacacctactgtgggttcaca
attcctggcttacttttggaagagaaactggtcttgagtatttggtgtcttctggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagaccccgaggcaggtcctctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB117758_PreC_P-C Feature FT:CDS AB117758_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CB10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgcggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
catctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgtcaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttactttcggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB176642_PreC_P-C Feature FT:CDS AB176642_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-115). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggrcatggacattgacccgtataaagaatttggagcttctgtggagttrctctcttttttgccttctgacttctttc
cttctgctcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcac
catacagcaatcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttgganga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaattcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgctggagtatttggtgtcttttggagtgtggattcgcactcctgctcct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccttagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttag
>gnl|hbvcds|AB176643_PreC_P-C Feature FT:CDS AB176643_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-NK1). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggrcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctactctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctraaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB182589_PreC_P-C Feature FT:CDS AB182589_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CH:Mat-Ko). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagcttgtccttgggtggct
tgggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgataccgcctctgctctgtatcgggaggccttagagtctccggaacatggttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195930_PreC_P-C Feature FT:CDS AB195930_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgctactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccatataaagaatttggagcttctgctgagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagaatctcaagaacattgttcagctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacttgggtgggcagtaatttggaaga
cccagcatcccgggaattggtagtcagctatgtcaatgttaacatgggcctgaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195931_PreC_P-C Feature FT:CDS AB195931_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgctactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccatataaagaatttggagcttctgctgagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagaatctcaagaacattgttcagctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacttgggtgggcagtaatttggaaga
cccagcatcccgggaattggtagtcagctatgtcaatgttaacatgggcctgaaactcagacaaatattgtggtttcaca
tttcctgtcttactttcggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195932_PreC_P-C Feature FT:CDS AB195932_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgctactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccatataaagaatttggagcttctgctgagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagaatctcaagaacattgttcagctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacttgggtgggcagtaatttggaaga
cccagcatcccgggaattggtagtcagctatgtcaatgttaacatgggcctgaaactcagacaaatattgtggtttcaca
tttcctgtcttactttcggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195936_PreC_P-C Feature FT:CDS AB195936_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccttccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195937_PreC_P-C Feature FT:CDS AB195937_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccttccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195938_PreC_P-C Feature FT:CDS AB195938_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccttccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195942_PreC_P-C Feature FT:CDS AB195942_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195943_PreC_P-C Feature FT:CDS AB195943_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195944_PreC_P-C Feature FT:CDS AB195944_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195945_PreC_P-C Feature FT:CDS AB195945_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctccttgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccaagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|AB195946_PreC_P-C Feature FT:CDS AB195946_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB195947_PreC_P-C Feature FT:CDS AB195947_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttactttcggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195948_PreC_P-C Feature FT:CDS AB195948_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttactttcggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195949_PreC_P-C Feature FT:CDS AB195949_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctttgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195952_PreC_P-C Feature FT:CDS AB195952_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcaca
tttgctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195953_PreC_P-C Feature FT:CDS AB195953_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattactgtggtttcaca
tttgctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195954_PreC_P-C Feature FT:CDS AB195954_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattactgtggtttcaca
tttgctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB198076_PreC_P-C Feature FT:CDS AB198076_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttgctctcttttttgccttctgacttctttc
cwtctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagggaaactgttttagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB198077_PreC_P-C Feature FT:CDS AB198077_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB198078_PreC_P-C Feature FT:CDS AB198078_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB198079_PreC_P-C Feature FT:CDS AB198079_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcatctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB198080_PreC_P-C Feature FT:CDS AB198080_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB198081_PreC_P-C Feature FT:CDS AB198081_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctccgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgtcaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB198082_PreC_P-C Feature FT:CDS AB198082_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB198083_PreC_P-C Feature FT:CDS AB198083_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctccgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB202071_PreC_P-C Feature FT:CDS AB202071_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattatgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttgttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB202072_PreC_P-C Feature FT:CDS AB202072_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttgttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205123_PreC_P-C Feature FT:CDS AB205123_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CN578-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcgctcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205124_PreC_P-C Feature FT:CDS AB205124_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TJ3-1-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtagatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aaggactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205125_PreC_P-C Feature FT:CDS AB205125_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VH34-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactacggcaagctattctgtgttggggtgagttgatgaaccttgccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB222714_PreC_P-C Feature FT:CDS AB222714_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UZNVC7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB222715_PreC_P-C Feature FT:CDS AB222715_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UZNVC7M). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB241110_PreC_P-C Feature FT:CDS AB241110_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhLC03). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgatttctttc
cttctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
cataccgcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaggcaactgttgtggtttcaca
tttcttgtcttacttttggaagagaaacggttcttgagtatctggtgtccttcggggtgtggattcgtacaccccccgca
tataggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB241111_PreC_P-C Feature FT:CDS AB241111_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhLC14). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgatttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaggcaactgttgtggtttcaca
tttcttgtcttacttttggaagagaaacggttcttgagtatctggtgtccttcggggtgtggattcgtacacctcccgca
tataggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246344_PreC_P-C Feature FT:CDS AB246344_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
ctaatattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttctccgcac
catacagcactcaggcaagctattctgtgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246345_PreC_P-C Feature FT:CDS AB246345_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246346_PreC_P-C Feature FT:CDS AB246346_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctctcgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB247916_PreC_P-C Feature FT:CDS AB247916_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB250109_PreC_P-C Feature FT:CDS AB250109_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IH030213). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagccctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactccggcaagctattctgtgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaacgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagatgtcgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB288026_PreC_P-C Feature FT:CDS AB288026_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcagggaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcttaaaantcaggcaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB298720_PreC_P-C Feature FT:CDS AB298720_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BAJT2006-1S). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcata
tttcctgtctcacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcc
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB298721_PreC_P-C Feature FT:CDS AB298721_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BAJT2006-1C). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggargccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcata
tttcctgtctcacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcc
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB299858_PreC_P-C Feature FT:CDS AB299858_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB300359_PreC_P-C Feature FT:CDS AB300359_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB300360_PreC_P-C Feature FT:CDS AB300360_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccttagctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattctatgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacaggct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB300361_PreC_P-C Feature FT:CDS AB300361_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggaggttctgtggagccactctcttttttaccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtctcacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB300362_PreC_P-C Feature FT:CDS AB300362_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB300363_PreC_P-C Feature FT:CDS AB300363_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB300365_PreC_P-C Feature FT:CDS AB300365_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB300368_PreC_P-C Feature FT:CDS AB300368_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagacacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctacagct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgctag
>gnl|hbvcds|AB300372_PreC_P-C Feature FT:CDS AB300372_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient14). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctccgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB300373_PreC_P-C Feature FT:CDS AB300373_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient15). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctcatgacttctttc
cttctattcgagatctcctcgacactgcctctgctctgtatcgggaggccttggagtctccggaacattgttctccgcac
catacagcactcaggcaagctgttgtgtgttggggggaattgatgaatctggccacctgggtgggaggtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctgtcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB362932_PreC_P-C Feature FT:CDS AB362932_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggtagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB365451_PreC_P-C Feature FT:CDS AB365451_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BOL196). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttaatctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggggagttgatgaatctggccacctgggtgggaggtaatttggaaga
cccagcatccagggaagcagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagacaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagaagaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367392_PreC_P-C Feature FT:CDS AB367392_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgcctcctgacttctttc
cttcggttcgagatctcatcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatcattcacctcac
catacagcactcaggcaaggtattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagagaattagtagtcggctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367394_PreC_P-C Feature FT:CDS AB367394_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 3/Adefovir-treated Pt. 8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367395_PreC_P-C Feature FT:CDS AB367395_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367396_PreC_P-C Feature FT:CDS AB367396_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367397_PreC_P-C Feature FT:CDS AB367397_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcaggcaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367398_PreC_P-C Feature FT:CDS AB367398_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 7/Adefovir-treated Pt. 20). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcttttctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacgactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367399_PreC_P-C Feature FT:CDS AB367399_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 8/Adefovir-treated Pt. 29). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367401_PreC_P-C Feature FT:CDS AB367401_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 10/Adefovir-treated Pt. 9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagttgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattggtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|AB367402_PreC_P-C Feature FT:CDS AB367402_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367403_PreC_P-C Feature FT:CDS AB367403_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 12/Adefovir-treated Pt. 17). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367404_PreC_P-C Feature FT:CDS AB367404_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 13/Adefovir-treated Pt. 22). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcata
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367405_PreC_P-C Feature FT:CDS AB367405_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 14/Adefovir-treated Pt. 25). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgcacacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367406_PreC_P-C Feature FT:CDS AB367406_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 15/Adefovir-treated Pt. 7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttc
cttcaattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacttgggtgggaggtaatttggaaga
cccagcatcccgggaattagtagtcggctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccacct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB367407_PreC_P-C Feature FT:CDS AB367407_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 16/Adefovir-treated Pt. 11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB367408_PreC_P-C Feature FT:CDS AB367408_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 17/Adefovir-treated Pt. 14). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367409_PreC_P-C Feature FT:CDS AB367409_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 18). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttctagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367410_PreC_P-C Feature FT:CDS AB367410_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 19/Adefovir-treated Pt. 19). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatcccgggaattggtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctctagcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367411_PreC_P-C Feature FT:CDS AB367411_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 20). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgataccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367412_PreC_P-C Feature FT:CDS AB367412_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 21). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgcctctgctctgtatcgggaggccttggagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattggtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367413_PreC_P-C Feature FT:CDS AB367413_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 22/Adefovir-treated Pt. 4). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagagcttatcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctcttctgtgttggggtgagttgatgaatctggccacctgggtgggcagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367414_PreC_P-C Feature FT:CDS AB367414_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 23/Adefovir-treated Pt. 3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcaattcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccttctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367416_PreC_P-C Feature FT:CDS AB367416_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 25). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367417_PreC_P-C Feature FT:CDS AB367417_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 26). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367418_PreC_P-C Feature FT:CDS AB367418_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 27/Adefovir-treated Pt. 21). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctggagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367420_PreC_P-C Feature FT:CDS AB367420_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 29). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgagtggct
ttagggcatggacattgacccatataaagaatttggagcttctgcggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctttatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaaga
cccagcatcacgggaattagtagtcagctatgtcaatgttaatatgggcctgaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacaggccaccaaatgcccctatcctatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttaa
>gnl|hbvcds|AB367421_PreC_P-C Feature FT:CDS AB367421_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 30). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatcttgtggtttcata
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatggtag
>gnl|hbvcds|AB367422_PreC_P-C Feature FT:CDS AB367422_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 31/Adefovir-treated Pt. 12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcatcgacactgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB367423_PreC_P-C Feature FT:CDS AB367423_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 32/Adefovir-treated Pt. 28). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367424_PreC_P-C Feature FT:CDS AB367424_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 33). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367425_PreC_P-C Feature FT:CDS AB367425_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 34/Adefovir-treated Pt. 15). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaaga
cccagcgtcccgggaattagtagtcagctatgtcaatgttaatgcgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367426_PreC_P-C Feature FT:CDS AB367426_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 35). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctatacgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgcacacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggttccaca
tttcctgtattacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB367427_PreC_P-C Feature FT:CDS AB367427_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 36/Adefovir-treated Pt. 18). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgataccgcctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB367428_PreC_P-C Feature FT:CDS AB367428_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 37/Adefovir-treated Pt. 10). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtcgagttactctcttttttgccttctgacttctttc
cttccgttcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattttatgttgggttgaattgatgaatttggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367429_PreC_P-C Feature FT:CDS AB367429_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 38). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgctgagttactctcgtttttgccttctgacttctttc
cttccatccgagatctcctcgacaccgcctctgctctgtatcgggaggccctagagtctccggagcattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtggtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tatcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|AB367430_PreC_P-C Feature FT:CDS AB367430_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 39/Adefovir-treated Pt. 5). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctggcgagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactccgacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367431_PreC_P-C Feature FT:CDS AB367431_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 40). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB367432_PreC_P-C Feature FT:CDS AB367432_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 41). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
cataccgcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggagctaatttagacga
cccagcatccagggaatcagtagtcagctatgttaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367433_PreC_P-C Feature FT:CDS AB367433_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 42/Adefovir-treated Pt. 27). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtccccgagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgttag
>gnl|hbvcds|AB367434_PreC_P-C Feature FT:CDS AB367434_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 43/Adefovir-treated Pt. 26). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctactcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgttaatgttaatatgggcttaaaaatcaggcaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttgttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcatgtctcctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367435_PreC_P-C Feature FT:CDS AB367435_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 44/Adefovir-treated Pt. 23). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgctcct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB367801_PreC_P-C Feature FT:CDS AB367801_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 30). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctatacgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgcacacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggttccaca
tttcctgtattacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB367802_PreC_P-C Feature FT:CDS AB367802_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 16). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgctgagttactctcgtttttgccttctgacttctttc
cttccatccgagatctcctcgacaccgcctctgctctgtatcgggaggccctagagtctccggagcattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tatcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367803_PreC_P-C Feature FT:CDS AB367803_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 13). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaatgtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB367804_PreC_P-C Feature FT:CDS AB367804_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
cataccgcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggagctaatttagacga
cccagcatccagggaatcagtagtcagctatgttaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB426467_PreC_P-C Feature FT:CDS AB426467_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB471848_PreC_P-C Feature FT:CDS AB471848_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-F). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB471849_PreC_P-C Feature FT:CDS AB471849_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-C2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB471850_PreC_P-C Feature FT:CDS AB471850_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-C1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB471851_PreC_P-C Feature FT:CDS AB471851_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2NK-F). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB471852_PreC_P-C Feature FT:CDS AB471852_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2S-C2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB471853_PreC_P-C Feature FT:CDS AB471853_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2S-C3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB485808_PreC_P-C Feature FT:CDS AB485808_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-IT). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB485809_PreC_P-C Feature FT:CDS AB485809_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FEP1). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttcttcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtcaccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaacttagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB485810_PreC_P-C Feature FT:CDS AB485810_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FEP2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttcttcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtcaccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctgggcacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaacttagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB640730_PreC_P-C Feature FT:CDS AB640730_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ehime-EPCH-HBV-C1-HN). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttactttcggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB642095_PreC_P-C Feature FT:CDS AB642095_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2000-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagatactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgct
tacagaccagcaaatgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttaa
>gnl|hbvcds|AB642097_PreC_P-C Feature FT:CDS AB642097_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2003-1). Complete genome. [Hepadnaviridae] (length=639 residues).
ttgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtcgagttactctcttttttgcctwckgacttctttc
cttctattcgagatctcctcgataccgccgctgctctgtatcgggaggccttagagtctccggaacattgytcagctcac
catacagcactcaggcaagccattctrtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggamga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttatgtttgggagagatactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgttag
>gnl|hbvcds|AB642099_PreC_P-C Feature FT:CDS AB642099_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2005-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcttaaaaatcagacaactactgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB642100_PreC_P-C Feature FT:CDS AB642100_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2006-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670237_PreC_P-C Feature FT:CDS AB670237_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggcctnagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
yccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtctcacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670238_PreC_P-C Feature FT:CDS AB670238_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggcattagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670239_PreC_P-C Feature FT:CDS AB670239_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagmtattctgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670240_PreC_P-C Feature FT:CDS AB670240_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagmtattctgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670241_PreC_P-C Feature FT:CDS AB670241_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagagaattagtagtcggctatgtcaatgttaatatgggcctaaaacttagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB670242_PreC_P-C Feature FT:CDS AB670242_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgtcaatatgggcctgaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtrtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttrttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccacgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670243_PreC_P-C Feature FT:CDS AB670243_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.7). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagmtattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB670246_PreC_P-C Feature FT:CDS AB670246_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.10). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccrtataaagaatttggagcttctgtggagttactctcttttttgccgcctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcaatcaggcaagctattgtctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggattcagtagtcagctatgtcaatgtgaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB670247_PreC_P-C Feature FT:CDS AB670247_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670249_PreC_P-C Feature FT:CDS AB670249_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.13). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcttaaaactcagacaactactgtggtttcacg
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaggct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670252_PreC_P-C Feature FT:CDS AB670252_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctrttctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagggaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670253_PreC_P-C Feature FT:CDS AB670253_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.17). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaaga
cccagcatcccgggaattagttgtcagctatgtcaacgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB670254_PreC_P-C Feature FT:CDS AB670254_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.18). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctrttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670255_PreC_P-C Feature FT:CDS AB670255_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.19). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgcacacctcac
catacagcaatcaggcaagctgttctatgttggggtgagttgatgagtctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaagcagtagtcaactatgtcaatgttaatatgggcctaaaattcagacaactattgtggtttcacg
tttcctgtcttacttttgggagacaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670256_PreC_P-C Feature FT:CDS AB670256_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.20). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670258_PreC_P-C Feature FT:CDS AB670258_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.22). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccgagctgtgccttgggtggct
ttaggrcatggacattgacccctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|AB670259_PreC_P-C Feature FT:CDS AB670259_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.23). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacatataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctrttcgagatctcctcgacaccgccactgctctgtatcgggaggccctagagtctcgggaacattgttcacctcac
catacagcactcaggcaagctattgtctgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcccaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgttag
>gnl|hbvcds|AB670260_PreC_P-C Feature FT:CDS AB670260_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.24). Complete genome. [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
atcatccagggaattagtagtcagctatgtcaatgttcatatgggcctaaaaatcagacaactattgtggtttcacattt
cctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttac
agaccaccaaatgcccctatcttatcaacacttccggaaactactgttrttagatgtcgaggcaggtcccctagaagaag
aactccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670261_PreC_P-C Feature FT:CDS AB670261_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.25). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctcagctctgtatcgggaggccctagagtctccggaacattgttcacctcac
catacagcaatcaggcaagctattctgtgttgggttgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB670262_PreC_P-C Feature FT:CDS AB670262_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.26). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaagtagtagtcagctatgtcaatgttaatatgggcctaaaattcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagacactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgcccct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactcccaatgttag
>gnl|hbvcds|AB670263_PreC_P-C Feature FT:CDS AB670263_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.27). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggrcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttgggktgagttgatgaatttggccacctgggtgggaagtaatttggawga
cccagcatccagagaattagtagtcarccatgtcaatgttaatatgggcctaaaaatcagacaamtattgtggtttcaca
tttcctgtcttacctttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|AB670264_PreC_P-C Feature FT:CDS AB670264_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.28). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacmcstataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcgattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatytggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctatcgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB670265_PreC_P-C Feature FT:CDS AB670265_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.29). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaactgttag
>gnl|hbvcds|AB670266_PreC_P-C Feature FT:CDS AB670266_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.30). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggrcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670267_PreC_P-C Feature FT:CDS AB670267_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.31). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaggcaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670268_PreC_P-C Feature FT:CDS AB670268_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.32). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcrgctatgtcaatgttaatatgggcmtaaaamtcagaccactactgtggtttcaca
tttcctgtcttacgtttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctccggct
tacagaccaccaaatgcccctatcttatcmacacttccggaaactactattgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttaa
>gnl|hbvcds|AB670269_PreC_P-C Feature FT:CDS AB670269_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.33). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattctatgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattaatagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttgttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670270_PreC_P-C Feature FT:CDS AB670270_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.34). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcatcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactaaggcaagctattctgtgttgggttgagttgatgaacctggccacttgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcaaccatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670272_PreC_P-C Feature FT:CDS AB670272_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.36). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatccggaggccctagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
tcccgcatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagatactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaactgttag
>gnl|hbvcds|AB670273_PreC_P-C Feature FT:CDS AB670273_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.37). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattstgtgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaaga
cccagcatcccgggaattagttgtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|AB670274_PreC_P-C Feature FT:CDS AB670274_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctccttgacaccgcatctgctctatatcgggaggccttagagtctccacaacattgttcacctcac
catacagcactccggcaagctattctatgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggacga
ccaggcatccagggatttagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactmttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtrtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactrttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcmgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgttar
>gnl|hbvcds|AB670275_PreC_P-C Feature FT:CDS AB670275_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcgtcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacagctattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670276_PreC_P-C Feature FT:CDS AB670276_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670277_PreC_P-C Feature FT:CDS AB670277_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcaagct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670278_PreC_P-C Feature FT:CDS AB670278_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
cccagcatccagggaactagtagtcagctatgtcaatgttaatatgggactaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670279_PreC_P-C Feature FT:CDS AB670279_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttgcaaga
cccagcatccagggaatcagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtctcacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccttccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670281_PreC_P-C Feature FT:CDS AB670281_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaaga
cccarcatcccgggaattarcagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670282_PreC_P-C Feature FT:CDS AB670282_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670283_PreC_P-C Feature FT:CDS AB670283_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670285_PreC_P-C Feature FT:CDS AB670285_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcsggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctattaatcaggcaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670287_PreC_P-C Feature FT:CDS AB670287_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.14). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacgtttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670288_PreC_P-C Feature FT:CDS AB670288_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.15). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattstctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcrgctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AB670289_PreC_P-C Feature FT:CDS AB670289_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670290_PreC_P-C Feature FT:CDS AB670290_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.17). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacagatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670291_PreC_P-C Feature FT:CDS AB670291_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.18). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagctctcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670292_PreC_P-C Feature FT:CDS AB670292_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.19). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670294_PreC_P-C Feature FT:CDS AB670294_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.21). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcatctgctctgtatcgggaggccctagagtctccggagcattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
tccagcatccagggagttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670295_PreC_P-C Feature FT:CDS AB670295_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.22). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggaccttgacccgtataaagaatttggagcttctgcggagttagtctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcaatcaggcaagctattatctgttggggtgagttgatgaatctggccacctgggtgggaggtaatctagacga
tcaagcatccagggatttagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacc
tttcctgtcttatgtttggaagagatactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670297_PreC_P-C Feature FT:CDS AB670297_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.24). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgataccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattstgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670298_PreC_P-C Feature FT:CDS AB670298_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.25). Complete genome. [Hepadnaviridae] (length=639 residues).
attcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgccgagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcgggaacattgttcagctcac
catacagctctcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacc
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB670300_PreC_P-C Feature FT:CDS AB670300_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.27). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|AB670301_PreC_P-C Feature FT:CDS AB670301_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.28). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcac
catacagcactcaggcaagctattctctgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670302_PreC_P-C Feature FT:CDS AB670302_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.29). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctccttgacaccgcatctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactmttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670304_PreC_P-C Feature FT:CDS AB670304_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.31). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgccgccgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattctatgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcataaaactcagaacactactgtggtttcaca
tttcctgtcttatgtttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctccggct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670305_PreC_P-C Feature FT:CDS AB670305_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.32). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcatctgctctgtatcgggaggccctagagtctccggagcattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
tccagcatccagggagttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670306_PreC_P-C Feature FT:CDS AB670306_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.33). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactrttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttaa
>gnl|hbvcds|AB670307_PreC_P-C Feature FT:CDS AB670307_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.34). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattctatgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670308_PreC_P-C Feature FT:CDS AB670308_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.35). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcatcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactaaggcaagctattctgtgttgggttgagttgatgaatctggccacttgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcaaccatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670309_PreC_P-C Feature FT:CDS AB670309_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.36). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
aacagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670310_PreC_P-C Feature FT:CDS AB670310_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.37). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttactttcggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaacttgtattgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB670311_PreC_P-C Feature FT:CDS AB670311_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.38). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcytgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB675674_PreC_P-C Feature FT:CDS AB675674_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A33). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcaccgcac
catacagcactcaggcaagctattctgtgttggggcgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattggtagtcagctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcaca
tttcctgtcttactttcggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB675675_PreC_P-C Feature FT:CDS AB675675_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A34). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcaccgcac
catacagcactcaggcaagctattctgtgttggggcgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattggtagtcagctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcaca
tttcctgtcttactttcggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB675677_PreC_P-C Feature FT:CDS AB675677_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A39). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697490_PreC_P-C Feature FT:CDS AB697490_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697494_PreC_P-C Feature FT:CDS AB697494_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No9). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccaagcatccagggacttagtagtcagctatgtcaatgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697500_PreC_P-C Feature FT:CDS AB697500_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No17). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697502_PreC_P-C Feature FT:CDS AB697502_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No20). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcwtgttcttgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctctggagttactctcttttttgcctcaggacttctttc
cttctgttcgagatctcctcgacaccgcctccgctctgtatagggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttggggtgaattgatgaatctggccacctgggtgggaggtaatttggacga
cccatcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaattcagacaactactgtggttccaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcctcct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacaacgaggtaggtccactagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB697510_PreC_P-C Feature FT:CDS AB697510_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No33). Complete genome. [Hepadnaviridae] (length=639 residues).
attcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttc
cttctattcgagatctcctagacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
tccagcatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacc
tttcctgtattacttttggaagagaaattgttcttgagtatttggtgtcttttggagtgtggattcgtactcctccccct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttcttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctaggggatctcaatgttag
>gnl|hbvcds|AB900099_PreC_P-C Feature FT:CDS AB900099_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgctgagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
tcaagcatccagggatttagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB900109_PreC_P-C Feature FT:CDS AB900109_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttcttcgcagttactctcttttttgcctgctgacttttttc
cttctgttcgcgacctactcgacaccgcctctgctctgtatggggaggccttagagtctccygaacattgttcacctcac
cacacagcaatcaggcaagctattctatgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacga
ccaaggatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaattcagacaactactgtggtttcaca
tttcctgtmttacctttggaagagacactgtccttgagtatttggtgtcatttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB900113_PreC_P-C Feature FT:CDS AB900113_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcaatcaggcaagctattctatgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcataaaactcagacaactactgtggtttcacc
tttcctgtcttatgtttgggagagacactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB900115_PreC_P-C Feature FT:CDS AB900115_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttc
ctaatattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtcttctgaacattgttcagctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB900116_PreC_P-C Feature FT:CDS AB900116_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaaga
cccagcatcccgggaattagttgtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB931170_PreC_P-C Feature FT:CDS AB931170_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2P_HB11-0921). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatactatgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
cccagcatccagggaagcagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB931171_PreC_P-C Feature FT:CDS AB931171_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2S_HB11-0922). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatactatgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
cccagcatccagggaagcagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB971714_PreC_P-C Feature FT:CDS AB971714_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB11-1026). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cgtccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB971715_PreC_P-C Feature FT:CDS AB971715_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB11-1027). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cgtccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF068756_PreC_P-C Feature FT:CDS AF068756_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF182802_PreC_P-C Feature FT:CDS AF182802_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactaaggcaagagattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagttagctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcttgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacaaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF182803_PreC_P-C Feature FT:CDS AF182803_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactaaggcaagagattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcttgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF182804_PreC_P-C Feature FT:CDS AF182804_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttagagatctcctcgacaccgccgcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactaaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcata
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF182805_PreC_P-C Feature FT:CDS AF182805_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactaaggcaagagattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcttgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AF223954_PreC_P-C Feature FT:CDS AF223954_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF223955_PreC_P-C Feature FT:CDS AF223955_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtggggagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF223956_PreC_P-C Feature FT:CDS AF223956_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtggggagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF223957_PreC_P-C Feature FT:CDS AF223957_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgccttgtatagagaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF223958_PreC_P-C Feature FT:CDS AF223958_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF223959_PreC_P-C Feature FT:CDS AF223959_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtggggagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF223960_PreC_P-C Feature FT:CDS AF223960_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaycaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggsaatctcaatgttag
>gnl|hbvcds|AF223961_PreC_P-C Feature FT:CDS AF223961_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatctggaaga
cccagcatccagggaattggtagtarrccatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacmaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF241410_PreC_P-C Feature FT:CDS AF241410_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 3270). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacg
tgtcttgtcttacttttggaagagaaacggttcttgagtatttggtgtccttcggggtgtggattcgcacaccccccgca
tataggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF241411_PreC_P-C Feature FT:CDS AF241411_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8290). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattgtgtgttggggtgagttgatgaatttggcaacctgggtgggaagtaatttggaaga
cccagcatccagagaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcaca
tttcttgtcttacttttggaagagaaacggttcttgagtatttggtgtccttcggggtgtggattcgtacaccacccgca
tataggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF286594_PreC_P-C Feature FT:CDS AF286594_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF363961_PreC_P-C Feature FT:CDS AF363961_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcgtgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccatatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF384364_PreC_P-C Feature FT:CDS AF384364_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate XC-86-3). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF384365_PreC_P-C Feature FT:CDS AF384365_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate XC-86-4). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF384366_PreC_P-C Feature FT:CDS AF384366_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate XC-86-5). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF384367_PreC_P-C Feature FT:CDS AF384367_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate XC-86-6). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactgttgtggtttcgca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF384371_PreC_P-C Feature FT:CDS AF384371_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G376-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF384372_PreC_P-C Feature FT:CDS AF384372_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G376-A6). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcatgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF411408_PreC_P-C Feature FT:CDS AF411408_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggatttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcagatcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF411410_PreC_P-C Feature FT:CDS AF411410_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttccattcgagatctcctcgacaccgcttcagctttgtatcgggaggccttagagtccccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF411411_PreC_P-C Feature FT:CDS AF411411_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggatttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcagatcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF411412_PreC_P-C Feature FT:CDS AF411412_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctccgctctttatcgggaggccttagagtctccggagcattgcacacctcgc
catacagcactcaggcaagctattctatgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcataaaactcagacaactactgtggtttcaca
tttcctgtcttacatttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF458664_PreC_P-C Feature FT:CDS AF458664_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C84). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccgggaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF458665_PreC_P-C Feature FT:CDS AF458665_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C733). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccctagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaaccatccagggatttagtagttagctatgtcaatgttaatatgggcctaaaactcagacaattactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF461357_PreC_P-C Feature FT:CDS AF461357_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcac
catacagcactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagccagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
acgaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF461363_PreC_P-C Feature FT:CDS AF461363_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcac
catacagcactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagccagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
acgaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF473543_PreC_P-C Feature FT:CDS AF473543_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2e). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgtgatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF533983_PreC_P-C Feature FT:CDS AF533983_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggggcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacctttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctctcgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgtagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ748098_PreC_P-C Feature FT:CDS AJ748098_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient Z1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctcgccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011097_PreC_P-C Feature FT:CDS AP011097_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011098_PreC_P-C Feature FT:CDS AP011098_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011099_PreC_P-C Feature FT:CDS AP011099_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaatgttaatatgggcctaaagatcaggcaactgttgtggtttcaca
tttcttgtcttacttttggaagagaaacggttcttgagtatctggtgtccttcggggtgtggattcgtacaccccccgca
tataggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011100_PreC_P-C Feature FT:CDS AP011100_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaggcaactgttgtggtttcaca
tttcttgtcttacctttggaagagaaacggttcttgagtatctggtgtccttcggggtgtggattcgtacaccccccgca
tataggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011101_PreC_P-C Feature FT:CDS AP011101_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaatgttaatatgggcctaaagatcaggcaactgttgtggtttcaca
tttcttgtcttacttttggaagagaaacggttcttgagtatctggtgtccttcggggtgtggattcgtacaccccccgca
tataggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011106_PreC_P-C Feature FT:CDS AP011106_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagttgtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtatcttttggggtgtggattcgcacccctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011107_PreC_P-C Feature FT:CDS AP011107_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagttgtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggggtgtggattcgcacccctcctgct
tacaggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY057947_PreC_P-C Feature FT:CDS AY057947_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Tibet705). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY066028_PreC_P-C Feature FT:CDS AY066028_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactccgacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY167090_PreC_P-C Feature FT:CDS AY167090_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacgactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY167091_PreC_P-C Feature FT:CDS AY167091_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ic). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttaatctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcaccccac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggacga
cccagcatccagggaactagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagacactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccagcaaatgcccctatcttatcaacacttccggaaactactgttattagaggacgaagcagggcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AY167092_PreC_P-C Feature FT:CDS AY167092_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Id). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattaatagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY167096_PreC_P-C Feature FT:CDS AY167096_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IIIa). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcatccgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY167099_PreC_P-C Feature FT:CDS AY167099_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IVb). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcaactgtggagttactctcttttttgccctctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctctgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacctttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY206376_PreC_P-C Feature FT:CDS AY206376_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcctctatggagttaatctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagcactgtatcgggaggccttagagtctccggaacattgcacacctcac
catacagcactcaggcaagagattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY206378_PreC_P-C Feature FT:CDS AY206378_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgtggtgtgttggggggagttggtgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaagatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY206379_PreC_P-C Feature FT:CDS AY206379_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcctctatggagttaatctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagcactgtatcgggaggccttagagtctccggaacattgcacacctcac
catacagcactcaggcaagagattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY206381_PreC_P-C Feature FT:CDS AY206381_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccatcaaatgcccctatcttatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcacagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY206382_PreC_P-C Feature FT:CDS AY206382_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
cacacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY206384_PreC_P-C Feature FT:CDS AY206384_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcac
cataccgcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY206385_PreC_P-C Feature FT:CDS AY206385_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY206386_PreC_P-C Feature FT:CDS AY206386_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagctctcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggatgcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggagtctcaatgttag
>gnl|hbvcds|AY206389_PreC_P-C Feature FT:CDS AY206389_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgcctcctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY206392_PreC_P-C Feature FT:CDS AY206392_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
ccccgcatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaaaagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY220699_PreC_P-C Feature FT:CDS AY220699_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagccctcaggcaagctactctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactatgcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY220700_PreC_P-C Feature FT:CDS AY220700_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagccctcaggcaagctactctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggatga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY220702_PreC_P-C Feature FT:CDS AY220702_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagattctccggaacattgttcacctcac
catacagcactcaggcaagctattcagtgttggggtgaggtgatgaatctggccacctgggtgggaagtaatttggacga
cccagcatccagggaattagttgtcagctatgtcaatgttaatatgggcctaaaaatgagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacccttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY247031_PreC_P-C Feature FT:CDS AY247031_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUHB84). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtctcacttttggaagagaaactgttcttgagtatttggtatctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY247032_PreC_P-C Feature FT:CDS AY247032_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUHB95). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccaacatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269099_PreC_P-C Feature FT:CDS AY269099_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate mutant 8). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggcgcttctgtggagttactctcttttttgccttcggacttctttc
cttctgttcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269140_PreC_P-C Feature FT:CDS AY269140_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate mutant 31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcatactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctatatcgggatgctttagagtctgcagaacattgtacagctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaaga
tccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgccttacttttggaagacaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY306136_PreC_P-C Feature FT:CDS AY306136_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H85). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattggcccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctactctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccaacatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacgactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY596107_PreC_P-C Feature FT:CDS AY596107_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib-1). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggtaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY596108_PreC_P-C Feature FT:CDS AY596108_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaatcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY641558_PreC_P-C Feature FT:CDS AY641558_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He74). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgtgtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcaagatcgcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY641559_PreC_P-C Feature FT:CDS AY641559_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He53). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttgctctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY641560_PreC_P-C Feature FT:CDS AY641560_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He100). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaagatcagacaactattgtggtttcaca
tttcctgccttactttcggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY641561_PreC_P-C Feature FT:CDS AY641561_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He127). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattttatgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY641562_PreC_P-C Feature FT:CDS AY641562_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He82). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctggacactgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY641563_PreC_P-C Feature FT:CDS AY641563_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He52). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgcggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY862869_PreC_P-C Feature FT:CDS AY862869_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H8). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcgc
catacagcactaaggcaagctattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D00630_PreC_P-C Feature FT:CDS D00630_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
taggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctttgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattggtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgagtatttggtatctgttggagtgtggattcgcactcctcaagcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D12980_PreC_P-C Feature FT:CDS D12980_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D23680_PreC_P-C Feature FT:CDS D23680_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B4-HBVST1). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D23681_PreC_P-C Feature FT:CDS D23681_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C4-HBVST2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D23682_PreC_P-C Feature FT:CDS D23682_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B5-HBVKO1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttagtctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcagctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttatgtttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D23683_PreC_P-C Feature FT:CDS D23683_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C5-HBVKO2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcgtctgtggagttagtctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcagctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttatgtttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D23684_PreC_P-C Feature FT:CDS D23684_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C6-TKB588). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacg
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D28880_PreC_P-C Feature FT:CDS D28880_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Plasma 1992-085-9434). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccagaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|D50517_PreC_P-C Feature FT:CDS D50517_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttatgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcctgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D50518_PreC_P-C Feature FT:CDS D50518_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttatgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcctgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D50519_PreC_P-C Feature FT:CDS D50519_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D50520_PreC_P-C Feature FT:CDS D50520_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089756_PreC_P-C Feature FT:CDS DQ089756_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK75). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctaatgacttctttc
cttctattcgtgatctcctcgacaccgcttctgctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaaggtattctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggacga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagacactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ089757_PreC_P-C Feature FT:CDS DQ089757_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2342). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggargtaatttggawga
yccagcatccagggaakyagtagtaagctatgtcaatgttaatatgggcctaaaamtcagacaamtattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctmccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|DQ089758_PreC_P-C Feature FT:CDS DQ089758_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1733). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cytctattcgtgatctcctcgacaccgcctctgctctgtatcgrgaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089759_PreC_P-C Feature FT:CDS DQ089759_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1512). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctactcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctactctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaactcagacractmttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089760_PreC_P-C Feature FT:CDS DQ089760_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK454). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaattgggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttctggagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089761_PreC_P-C Feature FT:CDS DQ089761_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK515). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaattcggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggacttagtagtaagctatgtcaatgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|DQ089762_PreC_P-C Feature FT:CDS DQ089762_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1644). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtmagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctmaatgttag
>gnl|hbvcds|DQ089763_PreC_P-C Feature FT:CDS DQ089763_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1048). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaagacaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
taccgaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089764_PreC_P-C Feature FT:CDS DQ089764_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK967). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|DQ089765_PreC_P-C Feature FT:CDS DQ089765_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK428). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089766_PreC_P-C Feature FT:CDS DQ089766_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK553). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgcactgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcttgtcttacttttggaagagatactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|DQ089767_PreC_P-C Feature FT:CDS DQ089767_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1663). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctkctgtggagttactctcttttttgccttctgacttctttc
cttctrttcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089768_PreC_P-C Feature FT:CDS DQ089768_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1814). Complete genome. [Hepadnaviridae] (length=639 residues).
ctgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttcttcggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcttctgctctgtatcgggaggccttagaatctccggaacattgtacacctcac
catacagcaataaggcaagctattctatgttggggwgagttgatgaatctggccacctgggtgggaagtaatttggaaga
yccaggatccagggaattagtagtaggctaygtcaatgtcaatatgggcctaaaattcagacaactattgtggtttcaca
tttcctgccttacttttggaagacaaactgttctggagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089769_PreC_P-C Feature FT:CDS DQ089769_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK430). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089770_PreC_P-C Feature FT:CDS DQ089770_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1272). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggayattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcytgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagccaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089771_PreC_P-C Feature FT:CDS DQ089771_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1629). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtctcactgttcaagcctccaagctgtgccttgggtggct
ttgaggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctactattcgtgatctcctcgacaccgccgctgctttgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaagcagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccccct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|DQ089772_PreC_P-C Feature FT:CDS DQ089772_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK910). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttc
cttctattcgtgatctactcgacaccgcctctgctttgtatagggaggccttagagtctccggaacattgttcatatcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaagcagtagtaagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagatactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ089773_PreC_P-C Feature FT:CDS DQ089773_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1193). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaactcagacacctattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcccactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttyttagacgacgaggcagctcccctagaag
aagaactccctcgcctcgcagacgaagttctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089775_PreC_P-C Feature FT:CDS DQ089775_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK290). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgtgatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcagctcac
catacagcactaaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggatga
tccggcatccagggaagtagtagtaaactatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagacaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagaggacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089776_PreC_P-C Feature FT:CDS DQ089776_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK884). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacga
ccagggatccagggacttagtagtaagctatgtcaatgttaatatgggcctaaaagttagacaactattgtggtttcaca
tctcctgtcttacttttggaagasatactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089777_PreC_P-C Feature FT:CDS DQ089777_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1159). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacga
ccaggsatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaagttagacaactattgtggtttcaca
tctcctgtcttacttttggaagagatactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089778_PreC_P-C Feature FT:CDS DQ089778_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1442). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcmtgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctrttcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttrgagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttgggktgagttgatgaacctggccacctgggtgggaagtaatttggacga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagacactgttcttgagtatttggtgtcttttggagtgtggattcgcactccaaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089779_PreC_P-C Feature FT:CDS DQ089779_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK554). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089780_PreC_P-C Feature FT:CDS DQ089780_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK947). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcttctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcttgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089781_PreC_P-C Feature FT:CDS DQ089781_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1476). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089782_PreC_P-C Feature FT:CDS DQ089782_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2032). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctctttttggccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaaga
cccggcttccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089783_PreC_P-C Feature FT:CDS DQ089783_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1402). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgttag
>gnl|hbvcds|DQ089784_PreC_P-C Feature FT:CDS DQ089784_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1285). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtyccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacc
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacctccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089785_PreC_P-C Feature FT:CDS DQ089785_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1386). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccatataaagaatttggagcttctcaggagttaatctcttttttgccttctgacttctttc
ctactattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgagtctggccacatgggtgggaggtaatttggacga
ccctgcatccmgagacgcagtagtaagctatgtcaatgttaatatgggcctgaaactcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagataccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagaagaaggtctcaatcgccgcgtcgccgaagaactcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ089786_PreC_P-C Feature FT:CDS DQ089786_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2074). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaaga
cccggcttccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagaccactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccagcaaatgcccctatcttatccacacttccggaaactactgttgttagacaacgaggcaggtcccttagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ089787_PreC_P-C Feature FT:CDS DQ089787_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK352). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctttgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattgtgtgttggggtgaggtgatgaatctggccacctgggtgggaagtaatttggatga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctatcgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089788_PreC_P-C Feature FT:CDS DQ089788_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK820). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccgtataaagaatttggagcttctctggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgaaaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaacttagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|DQ089789_PreC_P-C Feature FT:CDS DQ089789_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK926). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgacctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcata
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089790_PreC_P-C Feature FT:CDS DQ089790_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1248). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgataccgcatctgctctstatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttgggktgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgataatatgggcctaaaaaccagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggwcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089791_PreC_P-C Feature FT:CDS DQ089791_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1205). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccgtataaagaatttggagcttctgtcgagttactctcttttttgccttctgacttctttc
ctaatattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaagcagtagttggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccccccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089792_PreC_P-C Feature FT:CDS DQ089792_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK870). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgtgatctcctcgacaccgcctctgctctgtatcgggaagccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttgggktgagttgatgaatctggccacctgggtgggaagtaatttggaaga
yccagcatccagggaattagtagtaagctatgtcaaygwtaatatgggcctaaaaaycagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttsttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccacmaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaag
amgaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089793_PreC_P-C Feature FT:CDS DQ089793_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK343). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagttgtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089794_PreC_P-C Feature FT:CDS DQ089794_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1896). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcaatcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagttgtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacatcaatgttag
>gnl|hbvcds|DQ089795_PreC_P-C Feature FT:CDS DQ089795_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1465). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccatataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttggagtctccggaacattgttcacctcac
catacagcactcaggcgagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089796_PreC_P-C Feature FT:CDS DQ089796_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK751). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattggtagtcggctatgtcaacgttaatatgggcctgaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagggaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089797_PreC_P-C Feature FT:CDS DQ089797_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1169). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaaaccagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089799_PreC_P-C Feature FT:CDS DQ089799_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK734). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaamtcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctmctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089800_PreC_P-C Feature FT:CDS DQ089800_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK741). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactctggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089801_PreC_P-C Feature FT:CDS DQ089801_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2100). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctggctaatcatctcatgttcatgtcctactgttcaagcctccaagcggtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089802_PreC_P-C Feature FT:CDS DQ089802_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1371). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattaatagtcagctatgtcaatgttaatatgggcctraaaatcagacaattattgtggtttcaca
tttcctgycttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089803_PreC_P-C Feature FT:CDS DQ089803_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK931). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacaatgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaactagtagtaagctatgtcaatgttaacatgggcctcaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgtt
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ089804_PreC_P-C Feature FT:CDS DQ089804_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK262). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctattgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggatgctctgcgcagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgccactgctctgtatggggaggccttagagtctccggaacattgttcagctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggacttggtagtaggctatgtcaacgttaacatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagatactgttctagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccacmaaatgcccctatcttatcaacacttccggaaactactgttgttagaggacgacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ144553_PreC_P-C Feature FT:CDS DQ144553_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cq2-A2). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144603_PreC_P-C Feature FT:CDS DQ144603_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cq5-14). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144604_PreC_P-C Feature FT:CDS DQ144604_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cq5-17). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ246215_PreC_P-C Feature FT:CDS DQ246215_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GZ-DYH). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcactcctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ315781_PreC_P-C Feature FT:CDS DQ315781_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI0398). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctttatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtggtaagctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacctttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ315782_PreC_P-C Feature FT:CDS DQ315782_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI0423). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacgcatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
cccagcatccagggacttagtagtaagctatgtcaatgttaacatgggcctaaaactcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ315783_PreC_P-C Feature FT:CDS DQ315783_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI03188). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctttatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtggtaagctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacctttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ361526_PreC_P-C Feature FT:CDS DQ361526_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NK-586). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cgtctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcaataaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaggctatgtcaatgttaacatgggcctaaaattcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacgcttccggagactggtgttgttagacaacgaggcaggtcctctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ361534_PreC_P-C Feature FT:CDS DQ361534_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CR-081). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ377160_PreC_P-C Feature FT:CDS DQ377160_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT16). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgccctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
tttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ377161_PreC_P-C Feature FT:CDS DQ377161_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT14). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ377162_PreC_P-C Feature FT:CDS DQ377162_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT20). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatacgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggaaatctcaatgttag
>gnl|hbvcds|DQ377163_PreC_P-C Feature FT:CDS DQ377163_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT32). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctactctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtggtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ377164_PreC_P-C Feature FT:CDS DQ377164_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatacgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ377165_PreC_P-C Feature FT:CDS DQ377165_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT35). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactcccttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatacgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ478885_PreC_P-C Feature FT:CDS DQ478885_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-D12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgatttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaacctcgggaatctcaatgttag
>gnl|hbvcds|DQ478899_PreC_P-C Feature FT:CDS DQ478899_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-D20). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccagaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtcgtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggcctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ478900_PreC_P-C Feature FT:CDS DQ478900_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-H172). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgcctgctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttgttgagtatttggtatcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgtagttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatttcaatgttag
>gnl|hbvcds|DQ478901_PreC_P-C Feature FT:CDS DQ478901_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-H155). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaattatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggatga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ536410_PreC_P-C Feature FT:CDS DQ536410_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagccctcaggcaagctattctgtgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcgca
tttcctgtcttacttttggaagagaaactgttctcgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ536411_PreC_P-C Feature FT:CDS DQ536411_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagccctcaggcaagctattctgtgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctcgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatttgga
>gnl|hbvcds|DQ536413_PreC_P-C Feature FT:CDS DQ536413_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcacctttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagccctcaggcaagctattctgtgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctcgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatttgga
>gnl|hbvcds|DQ536414_PreC_P-C Feature FT:CDS DQ536414_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcacctttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagccctcaggcaagctattctgtgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctcgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatttgga
>gnl|hbvcds|DQ683578_PreC_P-C Feature FT:CDS DQ683578_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ788835_PreC_P-C Feature FT:CDS DQ788835_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgccgcagctctgtatcgggaggccttagagtctccggaacattgatctcctcac
catacagcactaaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcata
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatttgga
>gnl|hbvcds|DQ890381_PreC_P-C Feature FT:CDS DQ890381_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctactgatttctttc
cttctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagacactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtagacaacaaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|DQ922649_PreC_P-C Feature FT:CDS DQ922649_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagagg
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggaaatctcaatgttag
>gnl|hbvcds|DQ922650_PreC_P-C Feature FT:CDS DQ922650_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggggcttcagtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactttggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ922651_PreC_P-C Feature FT:CDS DQ922651_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacagcac
catgcaacactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtgcattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcagtgttag
>gnl|hbvcds|DQ975272_PreC_P-C Feature FT:CDS DQ975272_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcaagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggacga
cccagcatccagggaattagtagtcggctatgttgatgttaatatgggcctaaaactcagacaactacagtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ975273_PreC_P-C Feature FT:CDS DQ975273_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaattagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcttgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ975274_PreC_P-C Feature FT:CDS DQ975274_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcgagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcccgaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcttcttgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatcccaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ980549_PreC_P-C Feature FT:CDS DQ980549_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcatcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggctgaggtgacgaatctggccacctgggtgggaagtaatttggaaga
cctagcatccagggaattggtagtcaactatgttgatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacgtttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ980550_PreC_P-C Feature FT:CDS DQ980550_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaattagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcttgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ980551_PreC_P-C Feature FT:CDS DQ980551_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggcttcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacaacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ986375_PreC_P-C Feature FT:CDS DQ986375_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgctgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ986376_PreC_P-C Feature FT:CDS DQ986376_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgctgcagctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaggct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|DQ993690_PreC_P-C Feature FT:CDS DQ993690_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 204-1113-Nature1.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993691_PreC_P-C Feature FT:CDS DQ993691_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4007-0803-Nature2.2-unSero). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993692_PreC_P-C Feature FT:CDS DQ993692_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4007-0810-Nature2.1-unSero). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctgtgttgggttgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993693_PreC_P-C Feature FT:CDS DQ993693_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 232-1125-Nature1.1-unSero). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcgtgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaattcggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF137802_PreC_P-C Feature FT:CDS EF137802_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgggtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgcggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF137803_PreC_P-C Feature FT:CDS EF137803_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcagacaagccattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgcagcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EF197911_PreC_P-C Feature FT:CDS EF197911_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=634 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgtgatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaactcagacacctattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
>gnl|hbvcds|EF384201_PreC_P-C Feature FT:CDS EF384201_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CUIT-02). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctcagctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctccctct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF494377_PreC_P-C Feature FT:CDS EF494377_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TW1138). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcattcaggcaagctatactgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaaga
tccagcgtccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacagctattatggtttcata
tttcctgtcttacttttggaagagaaattgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|EF494379_PreC_P-C Feature FT:CDS EF494379_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TW8585). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttttttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactaaggcaagctattctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF536065_PreC_P-C Feature FT:CDS EF536065_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgttaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF536066_PreC_P-C Feature FT:CDS EF536066_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgttaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF688062_PreC_P-C Feature FT:CDS EF688062_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GZ28-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagagactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU305540_PreC_P-C Feature FT:CDS EU305540_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-123). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU305541_PreC_P-C Feature FT:CDS EU305541_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-190). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU305542_PreC_P-C Feature FT:CDS EU305542_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-1251). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306673_PreC_P-C Feature FT:CDS EU306673_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306674_PreC_P-C Feature FT:CDS EU306674_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcgtcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcgcctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtaattggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306675_PreC_P-C Feature FT:CDS EU306675_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcgtcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcgcctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgtttatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtaattggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306685_PreC_P-C Feature FT:CDS EU306685_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306687_PreC_P-C Feature FT:CDS EU306687_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagcctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306688_PreC_P-C Feature FT:CDS EU306688_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306689_PreC_P-C Feature FT:CDS EU306689_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306690_PreC_P-C Feature FT:CDS EU306690_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306691_PreC_P-C Feature FT:CDS EU306691_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306694_PreC_P-C Feature FT:CDS EU306694_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306713_PreC_P-C Feature FT:CDS EU306713_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306714_PreC_P-C Feature FT:CDS EU306714_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306719_PreC_P-C Feature FT:CDS EU306719_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgcctcgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcagcacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306720_PreC_P-C Feature FT:CDS EU306720_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306721_PreC_P-C Feature FT:CDS EU306721_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306722_PreC_P-C Feature FT:CDS EU306722_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccatggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctattttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306724_PreC_P-C Feature FT:CDS EU306724_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtaccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU306726_PreC_P-C Feature FT:CDS EU306726_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU306727_PreC_P-C Feature FT:CDS EU306727_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggcc
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctactctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306728_PreC_P-C Feature FT:CDS EU306728_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU306729_PreC_P-C Feature FT:CDS EU306729_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU410079_PreC_P-C Feature FT:CDS EU410079_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph109). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcwactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccmagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaastcaggcacctgttgtggtttcaca
tttcttgtcttacttttggaagagaaacggttcttgagtatctggtgtccttcggggtgtggattcgtacaccccccgca
tataggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU410080_PreC_P-C Feature FT:CDS EU410080_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph76). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaggcaactattgtggtttcaca
tttcttgtcttacttttggaagagaaacggttcttgagtatctggtgtccttcggggtgtggattcgtacaccccccgca
tataggccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU410081_PreC_P-C Feature FT:CDS EU410081_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph80). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgatttctttc
cttctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
cataccgcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaggcaactgttgtggtttcaca
tttcttgtcttacttttggaagagaaacggttcttgagtatctggtgtccttcggggtgtggattcgtacaccccccgca
tataggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU439005_PreC_P-C Feature FT:CDS EU439005_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccatcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU439008_PreC_P-C Feature FT:CDS EU439008_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU439009_PreC_P-C Feature FT:CDS EU439009_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactagtgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU439010_PreC_P-C Feature FT:CDS EU439010_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcacgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaagctcgggaatcttaatgttag
>gnl|hbvcds|EU439011_PreC_P-C Feature FT:CDS EU439011_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggcgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaagctcgggaatcttaatgttag
>gnl|hbvcds|EU439012_PreC_P-C Feature FT:CDS EU439012_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcaccccac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU439013_PreC_P-C Feature FT:CDS EU439013_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=634 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgagaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatacgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttaagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccgccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
>gnl|hbvcds|EU439014_PreC_P-C Feature FT:CDS EU439014_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=634 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatattaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatacgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagaggaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
>gnl|hbvcds|EU439015_PreC_P-C Feature FT:CDS EU439015_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctccccac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU439025_PreC_P-C Feature FT:CDS EU439025_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaaccatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctactctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaagctcgggaatcttaatgttag
>gnl|hbvcds|EU498227_PreC_P-C Feature FT:CDS EU498227_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JL). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggctttagagtctccggaacattgctcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaaga
tccagcatccagggaatcagtcgtaacctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagacaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccccct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522068_PreC_P-C Feature FT:CDS EU522068_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 5N). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaagccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522069_PreC_P-C Feature FT:CDS EU522069_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 5T). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactcacttttttgccttccgacttctttc
cttctattcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcttgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522071_PreC_P-C Feature FT:CDS EU522071_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 7T). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccccgcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacc
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU547559_PreC_P-C Feature FT:CDS EU547559_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MC02). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctcccaaattactctcttttttgccttctgacttctttc
cttctattcatgatctcctctacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttggggtgagttgatgaatctggcaacatgggtgggaggaaatttgcaaga
ccmagcatccagggaatcagtagtaagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggttccaca
tttcctgtcttacttttggaagagacactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaccacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU547562_PreC_P-C Feature FT:CDS EU547562_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MC05). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtgcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggmatggacattgacccgtataaagaatttggagcttctgtggagttaatctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcccgaacattgttcagctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttgcaaga
cccaacatccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaacttttgtggtttcaca
tttcctgtcttacttttggaagacagactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagagcaagatgcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|EU554535_PreC_P-C Feature FT:CDS EU554535_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S472-20). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU554536_PreC_P-C Feature FT:CDS EU554536_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S472-24). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcatgctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU554537_PreC_P-C Feature FT:CDS EU554537_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-13). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctctttcttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtacagggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU554538_PreC_P-C Feature FT:CDS EU554538_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-15). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctctttcttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtacagggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU554539_PreC_P-C Feature FT:CDS EU554539_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-21). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctctttcttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtacagggaggccttagagtctccggaacattgttcacctcgc
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU554540_PreC_P-C Feature FT:CDS EU554540_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S304-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcaattcgagatctcctcgacaccggctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactgctgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccatcaaatgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU554541_PreC_P-C Feature FT:CDS EU554541_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S696-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaatattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacctaatgcccctatcctatcaatacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU554542_PreC_P-C Feature FT:CDS EU554542_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S696-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacctaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU560438_PreC_P-C Feature FT:CDS EU560438_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2-B74). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgaatatttggtgtcgtttggagtgtgggttcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU560439_PreC_P-C Feature FT:CDS EU560439_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7-B74). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgaatatttggtgtcgtttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacggtctcaatcaccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU560440_PreC_P-C Feature FT:CDS EU560440_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1-S869). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU560441_PreC_P-C Feature FT:CDS EU560441_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4-S869). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU562215_PreC_P-C Feature FT:CDS EU562215_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catactgcactccggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU562216_PreC_P-C Feature FT:CDS EU562216_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 13). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcc
cttctattcaagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catactgccctccggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatacgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU562217_PreC_P-C Feature FT:CDS EU562217_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catactgcactccggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU562218_PreC_P-C Feature FT:CDS EU562218_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
catctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggggtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU570067_PreC_P-C Feature FT:CDS EU570067_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18-S541). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctctttcttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtacagggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttattaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU570068_PreC_P-C Feature FT:CDS EU570068_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26-S541). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctctttcttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtacagggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattggtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU570072_PreC_P-C Feature FT:CDS EU570072_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1-B74). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgtgtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaaccgttcttgaatatttggtgtcgtttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttgg
>gnl|hbvcds|EU570073_PreC_P-C Feature FT:CDS EU570073_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8-S698). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccctagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggagga
cccagcatccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggactctcaatgttag
>gnl|hbvcds|EU570074_PreC_P-C Feature FT:CDS EU570074_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 11-S698). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccctagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggagga
cccagcatccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggactctcaatgttag
>gnl|hbvcds|EU579442_PreC_P-C Feature FT:CDS EU579442_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU579443_PreC_P-C Feature FT:CDS EU579443_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ctcagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccatcaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU589336_PreC_P-C Feature FT:CDS EU589336_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1175-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ctcagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaacaccaaatgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU589340_PreC_P-C Feature FT:CDS EU589340_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S852-7). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU589341_PreC_P-C Feature FT:CDS EU589341_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S852-10). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctcttcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtacttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU589342_PreC_P-C Feature FT:CDS EU589342_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S852-13). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtacttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU589344_PreC_P-C Feature FT:CDS EU589344_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S624-1). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctgttcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcattcaggcaagccattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU589345_PreC_P-C Feature FT:CDS EU589345_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S624-2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU670263_PreC_P-C Feature FT:CDS EU670263_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph105). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttc
cttctatacgagatctcctcgacaccgcctcagctctatatagggaggccttagaatctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaaga
tccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacctttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU717212_PreC_P-C Feature FT:CDS EU717212_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D26K-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcatttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcttaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaacgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU717214_PreC_P-C Feature FT:CDS EU717214_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G62K-8). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccgtataaagaatttggagcttctcgagagttactctcttttttgccttcggacttttttc
cttctattcgcgatctccttgacaccgcctctgctctgtatcgggaggccttagaatctccggaacattgttcacctcac
catacagcactaagacaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaacttcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttgttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgagggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|EU717215_PreC_P-C Feature FT:CDS EU717215_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Q67K-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaacttggaaga
ccaagcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaaactcagacagatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU717217_PreC_P-C Feature FT:CDS EU717217_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Q53K-4). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcatgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU717218_PreC_P-C Feature FT:CDS EU717218_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 107-3/C8). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagatg
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU796069_PreC_P-C Feature FT:CDS EU796069_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctgctattcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggcagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgggtatttggtgtcttttggagtgtggattcgcactcctccggct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU796070_PreC_P-C Feature FT:CDS EU796070_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggatttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccccctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacggcgaggcagatcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU796072_PreC_P-C Feature FT:CDS EU796072_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggatttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccccctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacggcgaggcagatcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871969_PreC_P-C Feature FT:CDS EU871969_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctacggttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactaaggcaagagattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcttgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871970_PreC_P-C Feature FT:CDS EU871970_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttccgttcgagatctcctcgacaccgccgcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactaaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaattagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttag
>gnl|hbvcds|EU871971_PreC_P-C Feature FT:CDS EU871971_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcggctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcattaaggcaagagattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcata
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcttgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871972_PreC_P-C Feature FT:CDS EU871972_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttccgttcgagatctcctcgacaccgccgcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactaaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaattagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU871973_PreC_P-C Feature FT:CDS EU871973_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-99-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgccgcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactaaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcata
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU871974_PreC_P-C Feature FT:CDS EU871974_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024A-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactaaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcagtgttag
>gnl|hbvcds|EU871975_PreC_P-C Feature FT:CDS EU871975_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024A-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcttcagctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcacccctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871976_PreC_P-C Feature FT:CDS EU871976_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 179-04-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacg
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871977_PreC_P-C Feature FT:CDS EU871977_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcttcagctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggcgtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871978_PreC_P-C Feature FT:CDS EU871978_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-95-2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcttcagctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgataatatgggcctaaaaaccagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagccgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU871979_PreC_P-C Feature FT:CDS EU871979_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-95-4). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcttcagctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgataatatgggcctaaaaaccagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU871980_PreC_P-C Feature FT:CDS EU871980_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-01-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
cataccgcactcaggcaagagattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcaactatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggggtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871982_PreC_P-C Feature FT:CDS EU871982_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-96-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggggtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU871998_PreC_P-C Feature FT:CDS EU871998_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-00-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
cataccgcactcaggcaagagattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcaactatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggggtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU872000_PreC_P-C Feature FT:CDS EU872000_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-92-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctatgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctaatattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacatcac
catacagcactcaggcaagctattctgtgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccaggatccagggaattagtagtcggctgtgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcacc
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU872001_PreC_P-C Feature FT:CDS EU872001_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-92-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctaatattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacagctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacga
cccaggatccagggacttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcacc
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU872002_PreC_P-C Feature FT:CDS EU872002_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-97-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctaatattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacatcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccaggatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcacc
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU872003_PreC_P-C Feature FT:CDS EU872003_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-97-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctaatattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacagctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacga
cccaggatccagggacttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcacc
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU872004_PreC_P-C Feature FT:CDS EU872004_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-97-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctaatattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacatcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccaggatccagggaattagtagtcggctatgccaatgttaatatgggcctaaaaatcagacaactcctgtggtttcacc
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU872005_PreC_P-C Feature FT:CDS EU872005_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 179-96-1). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggagcatggacattgacccgtataaagaatttggagcttctcgggagttactctcttttttgccttctgacttttttc
ctcctgttcgcgatctccttgacaccgcctctgctctgtatcgggaggccttagaatctccggaacattgttcacctcac
catacagcactaaggcaagctattctatgttggggtgagctgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaacttcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttgttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|EU872008_PreC_P-C Feature FT:CDS EU872008_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252A-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcttcagctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctggagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU872010_PreC_P-C Feature FT:CDS EU872010_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-92-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttcagctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU872013_PreC_P-C Feature FT:CDS EU872013_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-99-6). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctattcgagatctcctcgacaccgcttcagctctgtatcgggagaccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcaactatgttaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggggtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU881996_PreC_P-C Feature FT:CDS EU881996_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient17). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggcgcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916210_PreC_P-C Feature FT:CDS EU916210_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S2.4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggtgttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcaattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916211_PreC_P-C Feature FT:CDS EU916211_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3.1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccctctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatggtag
>gnl|hbvcds|EU916212_PreC_P-C Feature FT:CDS EU916212_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3.2). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaggagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916213_PreC_P-C Feature FT:CDS EU916213_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3.3). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgaggtctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatggtag
>gnl|hbvcds|EU916214_PreC_P-C Feature FT:CDS EU916214_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3.4). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatggtag
>gnl|hbvcds|EU916215_PreC_P-C Feature FT:CDS EU916215_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S4.1). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccgggaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916216_PreC_P-C Feature FT:CDS EU916216_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S4.2). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctttgctctccatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916217_PreC_P-C Feature FT:CDS EU916217_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S4.3). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttgggagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916218_PreC_P-C Feature FT:CDS EU916218_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S4.4). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcacgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916223_PreC_P-C Feature FT:CDS EU916223_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S6.1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctctcgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916224_PreC_P-C Feature FT:CDS EU916224_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S6.2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactccggcaagctattctatgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916225_PreC_P-C Feature FT:CDS EU916225_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S6.3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaacatgggcctgaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916226_PreC_P-C Feature FT:CDS EU916226_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S7.1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacatatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactccggcaagttattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcacactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916227_PreC_P-C Feature FT:CDS EU916227_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S7.2). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctccgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacggcgaggcaggtcccctagaag
aagaactcccccgcctcgcagacgatggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916229_PreC_P-C Feature FT:CDS EU916229_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S7.4). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttagtgtcttttggagtgtggattcgcactcctcttgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916233_PreC_P-C Feature FT:CDS EU916233_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT1.1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcgtctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagacctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916234_PreC_P-C Feature FT:CDS EU916234_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT1.2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcgtctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916237_PreC_P-C Feature FT:CDS EU916237_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT2.2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatcccaatctcgggaatctcaatgttag
>gnl|hbvcds|EU916238_PreC_P-C Feature FT:CDS EU916238_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT2.3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaattttag
>gnl|hbvcds|EU919165_PreC_P-C Feature FT:CDS EU919165_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient24). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgctgagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacg
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgcaggggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|EU919168_PreC_P-C Feature FT:CDS EU919168_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient26). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccccaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU919169_PreC_P-C Feature FT:CDS EU919169_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient26). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcac
cacacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
cccagcatccagggaatcagtagtcagctatgtcaatgttaatatgggcataaaaatcagacaactactgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccccaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU939536_PreC_P-C Feature FT:CDS EU939536_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C3). Complete genome. [Hepadnaviridae] (length=639 residues).
atggaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttccattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939537_PreC_P-C Feature FT:CDS EU939537_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C8). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcctactgttcaagcctctaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgcactgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|EU939538_PreC_P-C Feature FT:CDS EU939538_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggawttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939539_PreC_P-C Feature FT:CDS EU939539_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C22). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccctataaagaatttggagcttctgtggagttactctcttttttgcctaatgacttctttc
cttctgctcgcgatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattgtgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
gcaagcatccagggatttagtagtcagctatgtcaatgttaatatgggcataaaaatgagacaactattgtggtttcaca
tttcctgtattacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccagcaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttag
>gnl|hbvcds|EU939540_PreC_P-C Feature FT:CDS EU939540_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C24). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttgtcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939541_PreC_P-C Feature FT:CDS EU939541_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C25). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttaaagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaaa
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaaacaactattgtggtttcaca
tttcctgtcttacttttggaaaaaaaactgttctagagtatttggtgtcttttggagtgtggattcgcacacctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacaaggcaggtcccctaaaaa
aaaaactccctcgcctcgcaaacaaaggtctcaatcgccgcgtcgcaaaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939542_PreC_P-C Feature FT:CDS EU939542_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C26). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtgcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgctggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
tccagcatccagggaatcagtagtcggctatgtcaatgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggcccactagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939543_PreC_P-C Feature FT:CDS EU939543_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C38). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccacagctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939544_PreC_P-C Feature FT:CDS EU939544_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C39). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccaacatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacgtttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939545_PreC_P-C Feature FT:CDS EU939545_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C41). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcttgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939546_PreC_P-C Feature FT:CDS EU939546_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C44). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccagaacattgttcgcctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagttgtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939548_PreC_P-C Feature FT:CDS EU939548_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C46). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcattaaggcaagagattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggagttagtagtcggctatgtcaatactaatatgggcctaaaactcagacaactattgtggtttcacc
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccagtaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939549_PreC_P-C Feature FT:CDS EU939549_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C49). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacactgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939550_PreC_P-C Feature FT:CDS EU939550_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C55). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|EU939552_PreC_P-C Feature FT:CDS EU939552_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C57). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaaacaactattgtggtttcaca
tttcctgtcttacttttggaaaagaaactgttctagaatatttggtgtcttttggagtgtggattcccactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttaaacaaccaggcaggtcccctagaaa
aagaactccctcgcctcgcaaacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939553_PreC_P-C Feature FT:CDS EU939553_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C60). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcactcctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|EU939554_PreC_P-C Feature FT:CDS EU939554_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C61). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgctactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccattataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctggacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttgggktgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939555_PreC_P-C Feature FT:CDS EU939555_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C63). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctgttcaagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtaagtcatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagamactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU939556_PreC_P-C Feature FT:CDS EU939556_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C64). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU939557_PreC_P-C Feature FT:CDS EU939557_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C65). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcrgctatgtcaatgttaatatgggcctaaaamtcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939558_PreC_P-C Feature FT:CDS EU939558_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C66). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgtgaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggtggtaatttggaaga
tccagcatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaacggttctggagtatttggtgtcttttggagtgtggattcgcactcctctccct
tacagacccccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|EU939560_PreC_P-C Feature FT:CDS EU939560_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C69). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939561_PreC_P-C Feature FT:CDS EU939561_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C70). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939562_PreC_P-C Feature FT:CDS EU939562_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C75). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttaaagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggatatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcccactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttat
>gnl|hbvcds|EU939563_PreC_P-C Feature FT:CDS EU939563_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctggagagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939564_PreC_P-C Feature FT:CDS EU939564_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C77). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaattaagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939566_PreC_P-C Feature FT:CDS EU939566_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C88). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtcgtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|EU939567_PreC_P-C Feature FT:CDS EU939567_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C91). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacactgttcacctcac
catacagcactcaggcaagctaatctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaattactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccccaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939568_PreC_P-C Feature FT:CDS EU939568_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C93). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgaccactataaagaatttggagcttctggagagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgccactgctctatatcgagaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaaga
ccaagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939569_PreC_P-C Feature FT:CDS EU939569_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C102). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactcttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU939570_PreC_P-C Feature FT:CDS EU939570_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C103). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggatttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939571_PreC_P-C Feature FT:CDS EU939571_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C104). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggatccgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939572_PreC_P-C Feature FT:CDS EU939572_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C105). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcggctatgtcaatgtcaacatgggcctgaaacttagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939573_PreC_P-C Feature FT:CDS EU939573_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C106). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagagctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagccatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttttagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939574_PreC_P-C Feature FT:CDS EU939574_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C109). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939576_PreC_P-C Feature FT:CDS EU939576_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C115). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagagacttagtagtcggctatgtcaatgttaatatgggcctaaaacttagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939578_PreC_P-C Feature FT:CDS EU939578_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C119). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939579_PreC_P-C Feature FT:CDS EU939579_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C120). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagaggctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939580_PreC_P-C Feature FT:CDS EU939580_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939582_PreC_P-C Feature FT:CDS EU939582_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B25). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagttgtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccccaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU939583_PreC_P-C Feature FT:CDS EU939583_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B31). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgttgagttactctcgtttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagatgtcgaggcaggtccgctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcagtgttag
>gnl|hbvcds|EU939584_PreC_P-C Feature FT:CDS EU939584_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B107). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctactctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacgactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939585_PreC_P-C Feature FT:CDS EU939585_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B126). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacctatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttttttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgtacacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccccccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939586_PreC_P-C Feature FT:CDS EU939586_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B142). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgaccattataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcttttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaattactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcacagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939587_PreC_P-C Feature FT:CDS EU939587_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctttgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcccaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939588_PreC_P-C Feature FT:CDS EU939588_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C173). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccagaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939590_PreC_P-C Feature FT:CDS EU939590_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C127). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccgctgctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatactgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacagctattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939591_PreC_P-C Feature FT:CDS EU939591_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C131). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccgctgctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatactgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacagctattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939592_PreC_P-C Feature FT:CDS EU939592_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C141). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccttccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacggggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939593_PreC_P-C Feature FT:CDS EU939593_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C144). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939594_PreC_P-C Feature FT:CDS EU939594_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C146). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcagctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaacttagacaactactgtggtttcaca
tttcctgtctcacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939595_PreC_P-C Feature FT:CDS EU939595_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C147). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtcggctatgtcaatgttaatatgggcataaaactcagacaactactgtggtttcaca
tctcctgtcttactttcggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939596_PreC_P-C Feature FT:CDS EU939596_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C149). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttc
ctaatattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggttccaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|EU939597_PreC_P-C Feature FT:CDS EU939597_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C151). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaattagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939599_PreC_P-C Feature FT:CDS EU939599_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C172). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaagccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgaggtgacgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcaactatgtcaatgtcaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcatacgaaggtctcaatcgccgcgtcgcacaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|EU939600_PreC_P-C Feature FT:CDS EU939600_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C176). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939601_PreC_P-C Feature FT:CDS EU939601_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C177). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctctgctctatatcgggaggccttagagtctcaggaacactggtcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaacgttaatatgggcctaaaactcaggcaactattgtggtttcaca
tttcctgtcttacttttggaagagacactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939603_PreC_P-C Feature FT:CDS EU939603_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C183). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctactgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtccattagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939604_PreC_P-C Feature FT:CDS EU939604_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C192). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939605_PreC_P-C Feature FT:CDS EU939605_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C200). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcataaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaatacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|EU939607_PreC_P-C Feature FT:CDS EU939607_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C207). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggaattagtagtcggctatgtcaatgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgcccct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939609_PreC_P-C Feature FT:CDS EU939609_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C209). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattaatagtcggctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939610_PreC_P-C Feature FT:CDS EU939610_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C211). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939611_PreC_P-C Feature FT:CDS EU939611_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C212). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939612_PreC_P-C Feature FT:CDS EU939612_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C213). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939613_PreC_P-C Feature FT:CDS EU939613_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C214). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catactgcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgtcaatatgggcctaaaactcagacaactactgtggtttcaca
tttcttgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcacccctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939614_PreC_P-C Feature FT:CDS EU939614_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C217). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939615_PreC_P-C Feature FT:CDS EU939615_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C226). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcggctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcata
tttcctgtcttacttttggaagagacactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939616_PreC_P-C Feature FT:CDS EU939616_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C228). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctctgctctacatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU939617_PreC_P-C Feature FT:CDS EU939617_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C229). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
tcaagcatcccgggacttagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaatgtactgttattagacaacgaggcaggccccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939618_PreC_P-C Feature FT:CDS EU939618_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C230). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcwtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactccgacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggggtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939619_PreC_P-C Feature FT:CDS EU939619_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C233). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939625_PreC_P-C Feature FT:CDS EU939625_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C167). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaatcagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacatcaatgttag
>gnl|hbvcds|EU939626_PreC_P-C Feature FT:CDS EU939626_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D158). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgaaactttttcacctctgcctaatcatctcttgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939640_PreC_P-C Feature FT:CDS EU939640_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C239). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagagaattaatagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcttgccttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939641_PreC_P-C Feature FT:CDS EU939641_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D18). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctrttcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaamattgtacacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggactaaaactcagacgactattgtggtttcaca
tttcctgtcttactttcggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939642_PreC_P-C Feature FT:CDS EU939642_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D20). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgcctttggacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcaactatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939643_PreC_P-C Feature FT:CDS EU939643_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D32). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctttgctttacatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgtcaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgcctaacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939644_PreC_P-C Feature FT:CDS EU939644_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D36). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacgcctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagccctcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggatttagtagttggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939645_PreC_P-C Feature FT:CDS EU939645_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D38). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacactgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttattagacgacaatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU939646_PreC_P-C Feature FT:CDS EU939646_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D88). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaacatgggcctaaaactcaggcaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU939647_PreC_P-C Feature FT:CDS EU939647_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D90). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939648_PreC_P-C Feature FT:CDS EU939648_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D96). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttc
cttctattcgagatctcctcgacaccgccactgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgttctttgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939649_PreC_P-C Feature FT:CDS EU939649_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D98). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattcaatgttggggtgaggtgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtcgtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU939651_PreC_P-C Feature FT:CDS EU939651_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D104). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcacctatgtcaatgttaatatgggcctaaaactcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|EU939652_PreC_P-C Feature FT:CDS EU939652_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D107). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccttccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939653_PreC_P-C Feature FT:CDS EU939653_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D109). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccatataaagaatttggagcttctgcggagttaatctcttttttgcctaatgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagaaattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgccttacttttggaagagagactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939654_PreC_P-C Feature FT:CDS EU939654_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D115). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgactcatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtcgtcggctatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatggtag
>gnl|hbvcds|EU939655_PreC_P-C Feature FT:CDS EU939655_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D116). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgggatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctactctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaattcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939656_PreC_P-C Feature FT:CDS EU939656_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D117). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgggatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctactctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaattcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939657_PreC_P-C Feature FT:CDS EU939657_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D139). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgaccactataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagctctcaggcaagctattatttgttggggtgagttgatgaatctggccacctgggtgggaggaaatttggacga
cccagcatccagggaagcagtagtcaactatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagaacaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcaggct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU939658_PreC_P-C Feature FT:CDS EU939658_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D142). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagactccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaccaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939659_PreC_P-C Feature FT:CDS EU939659_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D165). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacgcctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccggcatccagggaattagtagtcggctatgtcaatgttaatatgggtctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ023566_PreC_P-C Feature FT:CDS FJ023566_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M04-0026). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagatctactcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcaca
tttcatgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatacccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023567_PreC_P-C Feature FT:CDS FJ023567_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M04-0026). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagatctactcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgtcctgtgttggggtgagttaatgactctagctacctgggtgggaagtaatttggaaga
ccctgcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcaca
tttcatgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023568_PreC_P-C Feature FT:CDS FJ023568_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M04-0026). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagatctactcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcaca
tttcatgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023571_PreC_P-C Feature FT:CDS FJ023571_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M04-0197). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctttgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatctagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023587_PreC_P-C Feature FT:CDS FJ023587_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M04-2742). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagatctactcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcaca
tttcatgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023589_PreC_P-C Feature FT:CDS FJ023589_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M04-2742). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctaccgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagatctactcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcaca
tttcatgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggccccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023590_PreC_P-C Feature FT:CDS FJ023590_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M04-2742). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagatctactcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcaca
tttcatgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023591_PreC_P-C Feature FT:CDS FJ023591_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M04-2742). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagatctactcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcaca
tttcatgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023592_PreC_P-C Feature FT:CDS FJ023592_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M04-2742). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagatctactcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgagtgggaagtaatttggaaga
ccctgcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcaca
tttcatgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagagg
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023624_PreC_P-C Feature FT:CDS FJ023624_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M04-3733). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaacttattcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtcattcgaagatctactcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcaca
tttcatgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023625_PreC_P-C Feature FT:CDS FJ023625_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M04-3733). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagatctactcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgtcctgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcaca
tttcatgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttaccaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023639_PreC_P-C Feature FT:CDS FJ023639_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-0968). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcattaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaaga
cccmgcatccagggaattagtagtgagctatgtcaatgttaacatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagaatatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacggggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023640_PreC_P-C Feature FT:CDS FJ023640_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1206). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaaacaactattgtggtttcaca
tttcttgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggggtgtggattcgcactccccccgca
tacgggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023641_PreC_P-C Feature FT:CDS FJ023641_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1237). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactmaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaacagttctagagtatttggtgtcttttggagtgtggattcgcactccccccgcn
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023642_PreC_P-C Feature FT:CDS FJ023642_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1257). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcg
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023643_PreC_P-C Feature FT:CDS FJ023643_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1306). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaagccttagagtctccggaacattgttcccctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccccccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023644_PreC_P-C Feature FT:CDS FJ023644_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1318). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaagccttagagtctccggaacattgttcccctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccccccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023645_PreC_P-C Feature FT:CDS FJ023645_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0071). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgactcgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctctcgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023646_PreC_P-C Feature FT:CDS FJ023646_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0201). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccctagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgttag
>gnl|hbvcds|FJ023647_PreC_P-C Feature FT:CDS FJ023647_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0214). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttttagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023648_PreC_P-C Feature FT:CDS FJ023648_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0273). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctgcatcgggaagccttagagtctccggaacattgttctcctcac
catacagcactaaggcaagctattgtgtgttggggtgagttgatgaatttggccacctgggttgggagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023649_PreC_P-C Feature FT:CDS FJ023649_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0289). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctttatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023650_PreC_P-C Feature FT:CDS FJ023650_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0341). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgcgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccccgcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023651_PreC_P-C Feature FT:CDS FJ023651_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0391). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctgtttcgggaggccttagagtctccggaacattgttcacctcac
catacagcaataaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagagaattagtagtaagctatgtcaatgttaacatgggcctaaaactcagacaaatattgtggtttcacg
tttcctgtcttatgtttggaagagaaactgttctagaatatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023652_PreC_P-C Feature FT:CDS FJ023652_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0648). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgctgagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggacga
cccagcatccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctctcgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccacgaggcaggtccactagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023653_PreC_P-C Feature FT:CDS FJ023653_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0909). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcattaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023654_PreC_P-C Feature FT:CDS FJ023654_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1412). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggtagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023655_PreC_P-C Feature FT:CDS FJ023655_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0754). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaagtagtagtaagttatgtcaatgttaatatgggcctgaaaattagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctccccct
tacagaccaccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023656_PreC_P-C Feature FT:CDS FJ023656_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0938). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttttagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023657_PreC_P-C Feature FT:CDS FJ023657_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0987). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttaccttccgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023658_PreC_P-C Feature FT:CDS FJ023658_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-1116). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagagaattagtagtaagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023677_PreC_P-C Feature FT:CDS FJ023677_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I1/I2_M04-0309). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctgttcgagatcttctcgacaccgcctcagctttatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcaatcaggcaagctattctatgttggggtgagttgatgactctagcatcctgggtgggaggtaatttggaaga
ccctgcatccagggatttagtagtcaactatgtcaatgttaatatgggcctaaaacttaaacaactattgtggtttcaca
tttcatgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccccccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccatagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ032331_PreC_P-C Feature FT:CDS FJ032331_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S193-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032332_PreC_P-C Feature FT:CDS FJ032332_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S265-10). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032333_PreC_P-C Feature FT:CDS FJ032333_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S359-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcctttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032334_PreC_P-C Feature FT:CDS FJ032334_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S445-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaacttctgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032336_PreC_P-C Feature FT:CDS FJ032336_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S462-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032338_PreC_P-C Feature FT:CDS FJ032338_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S462-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagtcgatgaatctggccacctgggcgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttagaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcatgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032339_PreC_P-C Feature FT:CDS FJ032339_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S462-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccagaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032340_PreC_P-C Feature FT:CDS FJ032340_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S529-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032341_PreC_P-C Feature FT:CDS FJ032341_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S529-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032345_PreC_P-C Feature FT:CDS FJ032345_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S696-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacctaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032346_PreC_P-C Feature FT:CDS FJ032346_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S732-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccatataaagaatttggagcttccgtggagttactctcttttttgcctactgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032347_PreC_P-C Feature FT:CDS FJ032347_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S732-7). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgcctactgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032350_PreC_P-C Feature FT:CDS FJ032350_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S943-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaacgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032351_PreC_P-C Feature FT:CDS FJ032351_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S943-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctagaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032355_PreC_P-C Feature FT:CDS FJ032355_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1030-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcgcctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032356_PreC_P-C Feature FT:CDS FJ032356_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1030-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcggcaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcgcctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032359_PreC_P-C Feature FT:CDS FJ032359_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1634-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtttcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032360_PreC_P-C Feature FT:CDS FJ032360_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1634-2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032361_PreC_P-C Feature FT:CDS FJ032361_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1634-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ151413_PreC_P-C Feature FT:CDS FJ151413_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=634 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagccttcaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacctctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtttttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
>gnl|hbvcds|FJ151414_PreC_P-C Feature FT:CDS FJ151414_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgccgcagctctgtatcgggaggccctagagtctccggaacattgatctcctcac
catacagcactaaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctggaaatcagacaactactgtggtttcata
tttcctgtcttacttttggaagagaaactgtacttgagtgtttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacactttccggaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatttgga
>gnl|hbvcds|FJ349225_PreC_P-C Feature FT:CDS FJ349225_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H94). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctataccgggaggccctagagtctccagaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386574_PreC_P-C Feature FT:CDS FJ386574_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1743). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386575_PreC_P-C Feature FT:CDS FJ386575_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1745). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacagctattgtggtttcaca
tttcctgtcttacttttggaagagaaacggttctcgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386576_PreC_P-C Feature FT:CDS FJ386576_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1746). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386577_PreC_P-C Feature FT:CDS FJ386577_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1747). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcatgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386579_PreC_P-C Feature FT:CDS FJ386579_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1762). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgcctttggacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386587_PreC_P-C Feature FT:CDS FJ386587_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1812). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgtactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386588_PreC_P-C Feature FT:CDS FJ386588_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1828). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386589_PreC_P-C Feature FT:CDS FJ386589_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1830). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386591_PreC_P-C Feature FT:CDS FJ386591_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1869). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctatgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386592_PreC_P-C Feature FT:CDS FJ386592_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1870). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttttttc
cttctatccgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ386594_PreC_P-C Feature FT:CDS FJ386594_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1878). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcagctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaagcagtagtcagctatgtcaatgttaacatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaggct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386595_PreC_P-C Feature FT:CDS FJ386595_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1879). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386596_PreC_P-C Feature FT:CDS FJ386596_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1887). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacgcatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcccgaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaggcaatctggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386597_PreC_P-C Feature FT:CDS FJ386597_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1888). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaattcggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcgtttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|FJ386598_PreC_P-C Feature FT:CDS FJ386598_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1889). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcwtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgataccgcctcagctctgyatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386601_PreC_P-C Feature FT:CDS FJ386601_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1912). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386602_PreC_P-C Feature FT:CDS FJ386602_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1914). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386603_PreC_P-C Feature FT:CDS FJ386603_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1949). Complete genome. [Hepadnaviridae] (length=639 residues).
ttgcaactttttcacctctgcctaatcttctcatgttcatgtcctactggtcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctctgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386604_PreC_P-C Feature FT:CDS FJ386604_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1950). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386605_PreC_P-C Feature FT:CDS FJ386605_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1965). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactccggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386607_PreC_P-C Feature FT:CDS FJ386607_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1967). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386609_PreC_P-C Feature FT:CDS FJ386609_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1999). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcatcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386611_PreC_P-C Feature FT:CDS FJ386611_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2018). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccatataaagaatttggagcgtctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatcccgggaattagtagtcagctacgttaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcacgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ386612_PreC_P-C Feature FT:CDS FJ386612_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2019). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
cacacagcactcagacaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386613_PreC_P-C Feature FT:CDS FJ386613_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2039). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctgctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386614_PreC_P-C Feature FT:CDS FJ386614_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2040). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catactgcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaaga
cccaggatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaattactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctacggct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccttaatgttaa
>gnl|hbvcds|FJ386616_PreC_P-C Feature FT:CDS FJ386616_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2064). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctgtgcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcaatcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacg
tttcctgtcttacttttggacgagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactccacccgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ386617_PreC_P-C Feature FT:CDS FJ386617_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2093). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttggggggct
ttgggacatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttttgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattggggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386618_PreC_P-C Feature FT:CDS FJ386618_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2111). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386619_PreC_P-C Feature FT:CDS FJ386619_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2119). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattggtagtcagctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386620_PreC_P-C Feature FT:CDS FJ386620_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2121). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggaattactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcctttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386621_PreC_P-C Feature FT:CDS FJ386621_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2123). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacatataaagaatttggagcttccgtggagttactctcttttttgcctcatgacttctttc
cttctatgcaagatctcgtcgacaccgcctatgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaataataatatgggcctaaaaatcagacaaatattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ386623_PreC_P-C Feature FT:CDS FJ386623_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2165). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgagtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatctggtgtctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386624_PreC_P-C Feature FT:CDS FJ386624_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2187). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcaattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattaatagtcggctatgtcaatgttaacatgggcctgaaaatcagacaactactgtggtttcata
tttcctgtcttactttcggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactccttccggt
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ386625_PreC_P-C Feature FT:CDS FJ386625_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2190). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacctttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386626_PreC_P-C Feature FT:CDS FJ386626_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2205). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacaatgcaggtcctctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386627_PreC_P-C Feature FT:CDS FJ386627_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2242). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttc
cttccattcgcgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcatgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386628_PreC_P-C Feature FT:CDS FJ386628_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2255). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaaccagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386629_PreC_P-C Feature FT:CDS FJ386629_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2286). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386630_PreC_P-C Feature FT:CDS FJ386630_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2336). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgggatctcctcgacaccgcctctgctctataccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattggtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|FJ386631_PreC_P-C Feature FT:CDS FJ386631_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2359). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgactcatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386632_PreC_P-C Feature FT:CDS FJ386632_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2370). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctcaaattaagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386637_PreC_P-C Feature FT:CDS FJ386637_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2151). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386638_PreC_P-C Feature FT:CDS FJ386638_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2015). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatyttctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagttgtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386639_PreC_P-C Feature FT:CDS FJ386639_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1929). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386640_PreC_P-C Feature FT:CDS FJ386640_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2168). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgactgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcttcccgagaattagtagtcagctatgtcaatgttaacatgggcataaagatcagacaactgctgtggtttcaca
tttcctgtcttacttttggaagagacacggtcattgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccatcaaatgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386641_PreC_P-C Feature FT:CDS FJ386641_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2236). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacccatataaagaatttggagcttcckcggagttactctcttttttgccttctgacttytttc
cttctrttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
cccagcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386644_PreC_P-C Feature FT:CDS FJ386644_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S737). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaaatttttcacctttgcttaatcatttcatgttcatgtcatactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttttgaattctttc
tttccattcgagatctcctggacaccgcctctgctctgtatcgggagcccttagagtctccggaacattgttcccctcac
catacagcactcaggcaagctattttatgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatattaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386645_PreC_P-C Feature FT:CDS FJ386645_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S897). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggacga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaaaagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaggct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386647_PreC_P-C Feature FT:CDS FJ386647_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2400). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386650_PreC_P-C Feature FT:CDS FJ386650_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2468). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctactcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgctgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggatttagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386651_PreC_P-C Feature FT:CDS FJ386651_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2476). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctcggctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386652_PreC_P-C Feature FT:CDS FJ386652_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2518). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagagactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386653_PreC_P-C Feature FT:CDS FJ386653_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcaattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386657_PreC_P-C Feature FT:CDS FJ386657_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S165). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgagtatttggtntcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386659_PreC_P-C Feature FT:CDS FJ386659_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S219). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacmcstataaagaatttggagcttctgyggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactttggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386661_PreC_P-C Feature FT:CDS FJ386661_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S251). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcgattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagacaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttaa
>gnl|hbvcds|FJ386662_PreC_P-C Feature FT:CDS FJ386662_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S269). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcwtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacctgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctgctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccctagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgataaatctggccacctgggtgggaagtaatgtggaaga
tccagcatccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386663_PreC_P-C Feature FT:CDS FJ386663_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S307). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcatcgacaccgcctcagctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386664_PreC_P-C Feature FT:CDS FJ386664_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S310). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386665_PreC_P-C Feature FT:CDS FJ386665_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S359). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386667_PreC_P-C Feature FT:CDS FJ386667_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S379). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggttccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386670_PreC_P-C Feature FT:CDS FJ386670_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S454). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcwtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctaacattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtctaacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386671_PreC_P-C Feature FT:CDS FJ386671_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S586). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactactgtggtttcata
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386672_PreC_P-C Feature FT:CDS FJ386672_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S606). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggatcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaattcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactccttccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386673_PreC_P-C Feature FT:CDS FJ386673_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S633). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttcgattcgagatctcctcgacaccgcctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386677_PreC_P-C Feature FT:CDS FJ386677_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1104). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgcctaatgacttctttc
cttccattcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttggggcgagttgatgaatctggccacctgggtgggaggaaatttggaaga
ccctgcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ386678_PreC_P-C Feature FT:CDS FJ386678_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1147). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactgctgtggtttcata
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386679_PreC_P-C Feature FT:CDS FJ386679_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1217). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttcaattcgagatctcctcgacactgccactgctctgtatcgggaggccttggagtctccggaacattgttcccctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccaagcatccagggatttagttgtcggctatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ386685_PreC_P-C Feature FT:CDS FJ386685_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1568). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcwtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacmcatataaagaatttggagcttctgyggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcmtcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386687_PreC_P-C Feature FT:CDS FJ386687_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1600). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacgcatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcccgaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaggcaatctggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386689_PreC_P-C Feature FT:CDS FJ386689_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1649). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|FJ518810_PreC_P-C Feature FT:CDS FJ518810_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcaagatctcatcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggccccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ518813_PreC_P-C Feature FT:CDS FJ518813_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562218_PreC_P-C Feature FT:CDS FJ562218_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562220_PreC_P-C Feature FT:CDS FJ562220_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I12). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagagctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattttgtgttgggttgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggccatgttaatggtaatatgggcctaaaaatcagacaactaatgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcctatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562221_PreC_P-C Feature FT:CDS FJ562221_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I13). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggcggtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaacatgggcctgaaactcagacaactgttgtggtttcaca
tttcctgtcttactttcggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562225_PreC_P-C Feature FT:CDS FJ562225_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I19). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcaacatctcctcgacaccgcctctgctctctatcgggaggccttggagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgaggtgatgaatttggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562228_PreC_P-C Feature FT:CDS FJ562228_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I33). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcagagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
ccaacaatccagggaagcagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtctcacttttggaagacaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaggacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562230_PreC_P-C Feature FT:CDS FJ562230_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I38). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562232_PreC_P-C Feature FT:CDS FJ562232_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I45). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagacactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562233_PreC_P-C Feature FT:CDS FJ562233_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I48). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562235_PreC_P-C Feature FT:CDS FJ562235_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I50). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttttttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactttggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562238_PreC_P-C Feature FT:CDS FJ562238_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I62). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacctgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgcggtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagagatttagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562239_PreC_P-C Feature FT:CDS FJ562239_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I64). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacctatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccatcgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562241_PreC_P-C Feature FT:CDS FJ562241_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I67). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcgattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctgaagcttagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgagtatttggtgtcctttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ562242_PreC_P-C Feature FT:CDS FJ562242_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I68). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ562243_PreC_P-C Feature FT:CDS FJ562243_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I71). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctgttcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562244_PreC_P-C Feature FT:CDS FJ562244_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I72). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562245_PreC_P-C Feature FT:CDS FJ562245_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I73). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaacttctgtggtttcaca
tttcttgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562248_PreC_P-C Feature FT:CDS FJ562248_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I76). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcagtcaggcaagccattgtttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattggtagtcggctatgtcaaagttaatatgggcctaaaacggggacaaaagagttggtttcaca
tttcctgtcctacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562249_PreC_P-C Feature FT:CDS FJ562249_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I79). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562250_PreC_P-C Feature FT:CDS FJ562250_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I83). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttc
cttctattcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccgcaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaagttgtccttgagtatttggtatcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562251_PreC_P-C Feature FT:CDS FJ562251_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I84). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttggctgaat
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctactattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgccctcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562252_PreC_P-C Feature FT:CDS FJ562252_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I85). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ562255_PreC_P-C Feature FT:CDS FJ562255_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I92). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttaatgaacctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtccactagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562256_PreC_P-C Feature FT:CDS FJ562256_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I95). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggaccttgacacgtataaaccatttggagcttctgtggagttactctcttttttgccttctgacttytttc
cttccattcgtgatcttctcgacaccgcctccgctctgtatcgggaggctctagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562258_PreC_P-C Feature FT:CDS FJ562258_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I97). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggagga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562261_PreC_P-C Feature FT:CDS FJ562261_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I109). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtctaacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcacctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562264_PreC_P-C Feature FT:CDS FJ562264_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I114). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgactattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562265_PreC_P-C Feature FT:CDS FJ562265_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I116). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctrttcgagatctcctcgacaccgcctctgctctatatcgggaggccctagagtctccggaacattgctcacctcac
catacagcactcaggcaagctactctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagagaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562266_PreC_P-C Feature FT:CDS FJ562266_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I118). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctatgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ562268_PreC_P-C Feature FT:CDS FJ562268_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I121). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagaatatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562269_PreC_P-C Feature FT:CDS FJ562269_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I122). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactcctgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562270_PreC_P-C Feature FT:CDS FJ562270_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I123). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttytttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcacgctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggacttagtagtcggctatgttaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ562272_PreC_P-C Feature FT:CDS FJ562272_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I125). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtccattcgagatctcctcgacaccgccactgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcacccctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562273_PreC_P-C Feature FT:CDS FJ562273_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I127). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccactgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgacgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgttaatggtaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562274_PreC_P-C Feature FT:CDS FJ562274_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I128). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttagtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562275_PreC_P-C Feature FT:CDS FJ562275_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I129). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562276_PreC_P-C Feature FT:CDS FJ562276_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I130). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccatataaagaatttggagcttccgtggagttaatctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562279_PreC_P-C Feature FT:CDS FJ562279_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I140). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccaagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562280_PreC_P-C Feature FT:CDS FJ562280_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I141). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcwtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacmcatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttytttc
cttccattcgagatctcctcgacaccgcctctgctttatatcgggaggccttagagtctccggaacattgttcacctcac
catactgcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgcctaacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562281_PreC_P-C Feature FT:CDS FJ562281_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I143). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562282_PreC_P-C Feature FT:CDS FJ562282_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I144). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttctcctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaacatgggcctgaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562283_PreC_P-C Feature FT:CDS FJ562283_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I145). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562284_PreC_P-C Feature FT:CDS FJ562284_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I146). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562285_PreC_P-C Feature FT:CDS FJ562285_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I147). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562286_PreC_P-C Feature FT:CDS FJ562286_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I149). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
acttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcctgcttacagaccgcc
aaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccct
cgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggac
tcataaggtgggaaactttacggggctttattcttctactgttcctgtctttaatcctgagtggcaaactccctcctttc
ctcacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggaga
ttaaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggtattaaaccatatta
tcctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaga
gagaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtctt
>gnl|hbvcds|FJ562288_PreC_P-C Feature FT:CDS FJ562288_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I153). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttc
cttctattcgagatctcatcgacaccgcctctgctctataccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatctagggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcaggcaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562290_PreC_P-C Feature FT:CDS FJ562290_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I162). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562291_PreC_P-C Feature FT:CDS FJ562291_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I163). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ562292_PreC_P-C Feature FT:CDS FJ562292_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I164). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacctatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562293_PreC_P-C Feature FT:CDS FJ562293_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I167). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaattcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562295_PreC_P-C Feature FT:CDS FJ562295_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I169). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaaga
cccagcatcccgggaattagttgtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562297_PreC_P-C Feature FT:CDS FJ562297_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I172). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562298_PreC_P-C Feature FT:CDS FJ562298_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I174). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562299_PreC_P-C Feature FT:CDS FJ562299_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I175). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tatcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562300_PreC_P-C Feature FT:CDS FJ562300_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I182). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaaccatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562301_PreC_P-C Feature FT:CDS FJ562301_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I185). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagccattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttttagagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562304_PreC_P-C Feature FT:CDS FJ562304_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I190). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatagggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagagattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacggcgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562306_PreC_P-C Feature FT:CDS FJ562306_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I196). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcacgctattctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
tcaagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562307_PreC_P-C Feature FT:CDS FJ562307_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I197). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562308_PreC_P-C Feature FT:CDS FJ562308_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I199). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcaattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatacgggcctaaaaatcagacaaatcctgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaatgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562310_PreC_P-C Feature FT:CDS FJ562310_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I201). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcaattcgagatctcctcgacactgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgcccaggcaggtccactagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ562313_PreC_P-C Feature FT:CDS FJ562313_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I204). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctttgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ562315_PreC_P-C Feature FT:CDS FJ562315_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I207). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcaagacctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatacgggcctaaaaattagacaactactgtggtttcaca
tttcttgtctcacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgctgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562318_PreC_P-C Feature FT:CDS FJ562318_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I211). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctacatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562319_PreC_P-C Feature FT:CDS FJ562319_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I212). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562320_PreC_P-C Feature FT:CDS FJ562320_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I213). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562323_PreC_P-C Feature FT:CDS FJ562323_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I217). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctatccgagatcttctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562324_PreC_P-C Feature FT:CDS FJ562324_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I219). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttcagtggagttactctcttttttgccttctgacttctttc
cttctgttcaagatctcctcgacaccgcctcagctttgtatagggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatacgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctattgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562325_PreC_P-C Feature FT:CDS FJ562325_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I223). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacgcatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562326_PreC_P-C Feature FT:CDS FJ562326_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I227). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccatataaagaatttggagcttctgcggaattactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagagaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagatacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaag
aagaactccctcacctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|FJ562327_PreC_P-C Feature FT:CDS FJ562327_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I228). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcactcctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgctgct
tacagaccaccaaatgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562329_PreC_P-C Feature FT:CDS FJ562329_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I230). Complete genome. [Hepadnaviridae] (length=639 residues).
aagcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgttgattgggtggct
ttggggcatggacattgacccgtataaagaatttggagctcctgtggatatacttttttttttcccttctgacttctttc
cctctattcaagatctccttgacaccgcctggccactgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattgggggtcggctatgtcaatggtaatatgggcctaaaattcagacagatatggtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacctaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562330_PreC_P-C Feature FT:CDS FJ562330_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I231). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctacatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562331_PreC_P-C Feature FT:CDS FJ562331_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I9). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcktctgtggagttactctcttttttgccttctgacttttttc
cttctattygagatctcatcgacaccgcctcagctctgcatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctcttgtgtgttggggtgagttgataaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggacttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcttgtcttacttttggaagagaaactgttctcgattatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ562332_PreC_P-C Feature FT:CDS FJ562332_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I42). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttctcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562333_PreC_P-C Feature FT:CDS FJ562333_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I78). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562334_PreC_P-C Feature FT:CDS FJ562334_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I82). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacgcatataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562335_PreC_P-C Feature FT:CDS FJ562335_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I108). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctttgcagttactctcttttttgcctgctgacttctttc
cttctgttcgagatctcctcgacaccgccattgctctgtttcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgatttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagtatccagggaattagtagtcaactatgtcaatgttaatatgggcctaaaattcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttgttgagtatttggtgtcttttggagtgtggattcgcactcctattgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562337_PreC_P-C Feature FT:CDS FJ562337_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I173). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcytgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctctgctttgtatcgggaggccttaragtctccggaamattgttcacctcac
catacagcactcaggcaagcttttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaattcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccatcaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ562339_PreC_P-C Feature FT:CDS FJ562339_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I205). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctactcgagatctcmttgacaccgcctcagctctgcatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgataatatgggcctaaaaatcagacaactactgtggtttcaca
tctcctgtcttacttttggaagagaaacggtccttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ562340_PreC_P-C Feature FT:CDS FJ562340_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I220). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccacagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacctaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715341_PreC_P-C Feature FT:CDS FJ715341_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC11). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
cacacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715342_PreC_P-C Feature FT:CDS FJ715342_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaatgtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715343_PreC_P-C Feature FT:CDS FJ715343_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC13). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggtcacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tatagaccaccaaatgcccttttcttatcaacactcgcggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715344_PreC_P-C Feature FT:CDS FJ715344_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC14). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaaacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcatgtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715350_PreC_P-C Feature FT:CDS FJ715350_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC33). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagacctcctcgacactgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcgagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715351_PreC_P-C Feature FT:CDS FJ715351_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC41). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgcagtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcttgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715352_PreC_P-C Feature FT:CDS FJ715352_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC42). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctaatgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715353_PreC_P-C Feature FT:CDS FJ715353_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC43). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctaatgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715355_PreC_P-C Feature FT:CDS FJ715355_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC52). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgtcaatatgggcctaaaaatcagacaactactgtggtttcata
tttcctgtcttacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715357_PreC_P-C Feature FT:CDS FJ715357_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC54). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctggcttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcata
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715358_PreC_P-C Feature FT:CDS FJ715358_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC55). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcata
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715359_PreC_P-C Feature FT:CDS FJ715359_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC61). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715360_PreC_P-C Feature FT:CDS FJ715360_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC62). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccgtctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccagcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ715364_PreC_P-C Feature FT:CDS FJ715364_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC72). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaaccgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagactaccaaatgcccctatcttatcaacacttcccgaaactactgttgttagacgacgaggcagttcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715365_PreC_P-C Feature FT:CDS FJ715365_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC73). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctaatgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715366_PreC_P-C Feature FT:CDS FJ715366_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC74). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcctctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715367_PreC_P-C Feature FT:CDS FJ715367_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC75). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttgtgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715368_PreC_P-C Feature FT:CDS FJ715368_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC81). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgcagtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcttgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715370_PreC_P-C Feature FT:CDS FJ715370_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC83). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctaatgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715371_PreC_P-C Feature FT:CDS FJ715371_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaacttttccacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715372_PreC_P-C Feature FT:CDS FJ715372_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgctcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaacctcgggaatctcaatgttag
>gnl|hbvcds|FJ715374_PreC_P-C Feature FT:CDS FJ715374_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM21). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctatacgagatctcctagacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggggtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715375_PreC_P-C Feature FT:CDS FJ715375_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM22). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctatacgagatctcctagacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaagctgttcctgagtatttggtgtcttttggggtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715376_PreC_P-C Feature FT:CDS FJ715376_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM23). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctatacgagatctcctagacaccacctcagctctgtatcgggaggccctagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggggtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715377_PreC_P-C Feature FT:CDS FJ715377_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM31). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaactagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactcctgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715378_PreC_P-C Feature FT:CDS FJ715378_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM32). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715379_PreC_P-C Feature FT:CDS FJ715379_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM33). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715380_PreC_P-C Feature FT:CDS FJ715380_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM34). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcctctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattctgtgttggggtgagttaatgaacctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715381_PreC_P-C Feature FT:CDS FJ715381_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM41). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcgtgtcctactgttcaagcctccaagctgtgccttgggtggct
ctggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttctgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgtgaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccact
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715382_PreC_P-C Feature FT:CDS FJ715382_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM42). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttctgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgtgaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715383_PreC_P-C Feature FT:CDS FJ715383_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM43). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttctgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgtgaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgcggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcggacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715389_PreC_P-C Feature FT:CDS FJ715389_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM62). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttttatacgagatctcctagacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggggtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715390_PreC_P-C Feature FT:CDS FJ715390_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM63). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgcagtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttgatatcttttggagtgtggattcgcactcctcttgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715391_PreC_P-C Feature FT:CDS FJ715391_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM64). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgcagtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcttgct
tacagaccaccaaatgcccctatcttatcaacacttcgggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtcccaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715392_PreC_P-C Feature FT:CDS FJ715392_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM71). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgcgaggccttagagtctccggaatattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggcgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacctttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715395_PreC_P-C Feature FT:CDS FJ715395_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM81). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715397_PreC_P-C Feature FT:CDS FJ715397_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM83). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715398_PreC_P-C Feature FT:CDS FJ715398_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715400_PreC_P-C Feature FT:CDS FJ715400_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN13). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715402_PreC_P-C Feature FT:CDS FJ715402_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN22). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggcc
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttctgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgtgaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715403_PreC_P-C Feature FT:CDS FJ715403_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN23). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttctgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgtgaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgcggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcggacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715404_PreC_P-C Feature FT:CDS FJ715404_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN31). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttaccctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgctgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715405_PreC_P-C Feature FT:CDS FJ715405_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN32). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcgtgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cctctatacgagatctcctagacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggggtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggagtctcaatgttag
>gnl|hbvcds|FJ715406_PreC_P-C Feature FT:CDS FJ715406_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN33). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttaccctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggagtctcaatgttag
>gnl|hbvcds|FJ715407_PreC_P-C Feature FT:CDS FJ715407_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN41). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttctgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgtgaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715409_PreC_P-C Feature FT:CDS FJ715409_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN43). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttctgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtggtcagctatgtcaatgtgaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715415_PreC_P-C Feature FT:CDS FJ715415_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN61). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccagcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715416_PreC_P-C Feature FT:CDS FJ715416_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN62). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaggaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccagcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715418_PreC_P-C Feature FT:CDS FJ715418_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN64). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgcagtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcttgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715421_PreC_P-C Feature FT:CDS FJ715421_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN71). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcgtgtcctactgttcaagcctccaagctgtgccttgggtggct
ctggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttctgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcagtgtgaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccact
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715422_PreC_P-C Feature FT:CDS FJ715422_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN72). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaacttttccacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgcgaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacctttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttatacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ715424_PreC_P-C Feature FT:CDS FJ715424_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN74). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgcgaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacctttggaagagaaactgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcggaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ751764_PreC_P-C Feature FT:CDS FJ751764_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtggtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctggagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccatcaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ751765_PreC_P-C Feature FT:CDS FJ751765_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttttttt
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtggtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctggagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccatcaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ751770_PreC_P-C Feature FT:CDS FJ751770_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=634 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtggtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctggagtatttggtatcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
>gnl|hbvcds|FJ787437_PreC_P-C Feature FT:CDS FJ787437_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S129-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcagtcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787439_PreC_P-C Feature FT:CDS FJ787439_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S157-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcgagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787441_PreC_P-C Feature FT:CDS FJ787441_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S157-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787442_PreC_P-C Feature FT:CDS FJ787442_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S171-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttcgggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattaatagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787443_PreC_P-C Feature FT:CDS FJ787443_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S171-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattaatagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787445_PreC_P-C Feature FT:CDS FJ787445_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S425-2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcggggggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctttgttgaggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatctttcggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787447_PreC_P-C Feature FT:CDS FJ787447_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S461-2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcatgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgcggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787449_PreC_P-C Feature FT:CDS FJ787449_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S567-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cctctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|FJ787451_PreC_P-C Feature FT:CDS FJ787451_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S627-3). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctactctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ787452_PreC_P-C Feature FT:CDS FJ787452_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S955-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatattgacgtgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttag
>gnl|hbvcds|FJ787453_PreC_P-C Feature FT:CDS FJ787453_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1049-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcata
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787454_PreC_P-C Feature FT:CDS FJ787454_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1049-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaaccttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcata
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787455_PreC_P-C Feature FT:CDS FJ787455_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1092-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccgtctgacttctttc
cttctactcgagatctcctcgacaccgcctcggctctatatagggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaacatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcggaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787456_PreC_P-C Feature FT:CDS FJ787456_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1092-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccgtctgacttctttc
cttctattcaagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcacccatgtcaatgttaacacgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787457_PreC_P-C Feature FT:CDS FJ787457_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1248-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccatataaagaatttggagcttctgtggagttattctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactccggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattaatagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatttcaatgttag
>gnl|hbvcds|FJ787458_PreC_P-C Feature FT:CDS FJ787458_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1248-9). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcggctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactccggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattaatagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787459_PreC_P-C Feature FT:CDS FJ787459_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1348-1). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagtctctctcttttttgccttctgacttctttc
ctgctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccccctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgtcag
>gnl|hbvcds|FJ787461_PreC_P-C Feature FT:CDS FJ787461_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1357-2). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagaaattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787462_PreC_P-C Feature FT:CDS FJ787462_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1357-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787463_PreC_P-C Feature FT:CDS FJ787463_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1357-6). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787464_PreC_P-C Feature FT:CDS FJ787464_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcacccctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787465_PreC_P-C Feature FT:CDS FJ787465_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-5). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtaccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787466_PreC_P-C Feature FT:CDS FJ787466_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattaatagtcagctatgtcaatattaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787467_PreC_P-C Feature FT:CDS FJ787467_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattaatagtcagctatgtcaatattaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacaggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787468_PreC_P-C Feature FT:CDS FJ787468_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1426-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacagctattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787469_PreC_P-C Feature FT:CDS FJ787469_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1426-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacagctattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactcccttgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787470_PreC_P-C Feature FT:CDS FJ787470_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1538-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgaccactataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatacgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacctttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacatcaatgttag
>gnl|hbvcds|FJ787471_PreC_P-C Feature FT:CDS FJ787471_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1538-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttccgtggagttactcccttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacatcaatgttag
>gnl|hbvcds|FJ787479_PreC_P-C Feature FT:CDS FJ787479_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S157-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggggcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787481_PreC_P-C Feature FT:CDS FJ787481_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S852-2). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtgcttgagtacttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactaccgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787482_PreC_P-C Feature FT:CDS FJ787482_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1158-7). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagaggctccggagcattgttcacctcac
catacagcaatcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ787483_PreC_P-C Feature FT:CDS FJ787483_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1158-8). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagaggctccggagcattgttcacctcac
catacagcaatcgggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ787484_PreC_P-C Feature FT:CDS FJ787484_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1348-3). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccgggacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtgatttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccccctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgacgcagaagatctcaatctcgggaatcttaatgttaa
>gnl|hbvcds|FJ787485_PreC_P-C Feature FT:CDS FJ787485_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1656-8). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgtctcagctctgtatcgggaggccttagaggctccggagcattgttcacctcac
catacagcaatcaggcaagctattctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaagatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggccccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ787486_PreC_P-C Feature FT:CDS FJ787486_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S2235-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787487_PreC_P-C Feature FT:CDS FJ787487_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate DMY-1). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccgttcgaggtctcctcgacaccgcatctgctctgcatcgggaggccttagagtctccggaacattgttctcctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaaga
tcaagcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ787488_PreC_P-C Feature FT:CDS FJ787488_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate DMY-5). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccgttcgagatctcctcgacaccgcatctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggatttagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ787489_PreC_P-C Feature FT:CDS FJ787489_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate DMY-6). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccgttcgagatctcctcgacaccgcatctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtatgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
tcaagcatccagggatttagtagtcagctatgtcaacgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ787490_PreC_P-C Feature FT:CDS FJ787490_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LHZ-1). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaggcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctggcttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtttcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ848339_PreC_P-C Feature FT:CDS FJ848339_PreC_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, Pol, HBSP). [Hepadnaviridae] (length=633 residues).
ttttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggg
catggacattgacacctataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctg
ttcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccataca
gcactcaggcaagcttttgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagc
atccagggaactagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcct
gtcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggattcgcactcctcccgcttacaga
ccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggccccctagaagaagaac
tccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899761_PreC_P-C Feature FT:CDS FJ899761_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccaagcatccagggatttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ899763_PreC_P-C Feature FT:CDS FJ899763_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899764_PreC_P-C Feature FT:CDS FJ899764_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggatttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899765_PreC_P-C Feature FT:CDS FJ899765_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9-13). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggatttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ899767_PreC_P-C Feature FT:CDS FJ899767_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C26-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtgcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgctggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
tccagcatccagggaatcagtagtcggctatgtcaatgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcctttggagtgtggatccgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggcccactagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899768_PreC_P-C Feature FT:CDS FJ899768_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C56-7). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttc
catctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggaattaatagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899769_PreC_P-C Feature FT:CDS FJ899769_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctggagagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899770_PreC_P-C Feature FT:CDS FJ899770_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76-4). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctggagagttactctcttttttgccttctgacttctttc
cttctattcgagaactcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcataaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899771_PreC_P-C Feature FT:CDS FJ899771_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctggagagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgtttacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899774_PreC_P-C Feature FT:CDS FJ899774_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C120-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttagggcatggacattgacccgtataaagaatctggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagaggctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899775_PreC_P-C Feature FT:CDS FJ899775_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C120-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899776_PreC_P-C Feature FT:CDS FJ899776_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C122-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctatgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899777_PreC_P-C Feature FT:CDS FJ899777_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C127-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcgtccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagacctcctcgacaccgcctcagctctgtatcgggaggccctagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899778_PreC_P-C Feature FT:CDS FJ899778_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C173-1). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccagaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899783_PreC_P-C Feature FT:CDS FJ899783_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C207-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagctactgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccgaaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggaattagtagtcggctatgtcaatgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagatactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccacct
tacagaccaccaaatgcccctatcttatcaacacttccggaaattactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899788_PreC_P-C Feature FT:CDS FJ899788_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C226-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattaatagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtctcata
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899789_PreC_P-C Feature FT:CDS FJ899789_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C226-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattaatagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcata
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaaccccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899793_PreC_P-C Feature FT:CDS FJ899793_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C122-2). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ctaggacatggacattgacacgtataaagaatttggagcttccgtggagttactctcttttttgcctgctgacttttttc
cttctattcgagatctcctcgacactgcctctgctctgcatcgggaggccttagagtctccggaacattgttcccctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgtcag
>gnl|hbvcds|FJ899794_PreC_P-C Feature FT:CDS FJ899794_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C122-3). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ctaggacatggacattgacacgtataaagaatttggagcttccgtggagttactctcttttttgcctgctgacttttttc
cttctattcgagatctcctcgacactgcctctgctctgcatcgggaggccttagagtctccggaacattgttcccctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaacggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgtcag
>gnl|hbvcds|FJ899795_PreC_P-C Feature FT:CDS FJ899795_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C122-9). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacatataaagaatttggagcttccgtggagttactctcttttttgcctgctgacttctttc
cttctattcgggatctcctcgacaccgcctttgctctgcgtagggaggccttagagtctccggaacatgtttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttctggagtatttagtgtcttttggagtgtggattcgcactcctcccgct
tacagaccacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaagcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgtcag
>gnl|hbvcds|FJ904423_PreC_P-C Feature FT:CDS FJ904423_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate A78). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctctggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttggagtctccggaacattgttcacctcac
catacagcattaaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacga
cccagcatccagggaatcagtagtaagctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagacactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgct
tacagaccatcaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ184326_PreC_P-C Feature FT:CDS GQ184326_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ZADGM501). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cgtctatacgggatctcctcgacaccgcatttgctctgcatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactaaggcaagctattgtgtgttggggtgagttgatgaatctggctacctgggtgggaagtaatttggaaga
tccagcatccagggaattggtagtaagctatgtcaatgttaacatgggcctaaaagtcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctggagtatttggtatcttttggagtgtggattcgcactcctccacct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaggacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ227692_PreC_P-C Feature FT:CDS GQ227692_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z3-1). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcgtgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgaccactataaagaatttggggcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccaagcatccagggatttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccgccaaatgcccctatcttatcaacacttccggaaactactgtcgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ227693_PreC_P-C Feature FT:CDS GQ227693_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-1). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctactcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccaagcatccagggacttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggagtctcaatgttag
>gnl|hbvcds|GQ227694_PreC_P-C Feature FT:CDS GQ227694_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctactcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccaagcatccagggacttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgccttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ227695_PreC_P-C Feature FT:CDS GQ227695_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-5). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcacggacattgaccactataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctactcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccaagcatccagggacttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgagggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ227696_PreC_P-C Feature FT:CDS GQ227696_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-6). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctactcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctgaccacctgggtgggaagtaatttggaaga
ccaagcatccagggacttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ227697_PreC_P-C Feature FT:CDS GQ227697_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z3-2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgaccactataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccaagcatccagggacttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ259588_PreC_P-C Feature FT:CDS GQ259588_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-22). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcatctgtggagttactctcttttttgccttctgacttttttc
cttctactcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccaagcatccagggacttagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358153_PreC_P-C Feature FT:CDS GQ358153_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EIHB006). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgggatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tcaagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaagctcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctgccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358154_PreC_P-C Feature FT:CDS GQ358154_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SLK126). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358157_PreC_P-C Feature FT:CDS GQ358157_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M007). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacctttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggatacgcacacctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|GQ358158_PreC_C-C Feature FT:CDS GQ358158_PreC_C-C of [Viruses] Hepatitis B Virus genotype C (isolate M154). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcttgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ372968_PreC_P-C Feature FT:CDS GQ372968_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6380-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcaattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattaatagtcggctatgtcaatgttaacatgggcctgaaaatcagacaactactgtggtttcata
tttcctgtcttactttcggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactccttccggt
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ377514_PreC_P-C Feature FT:CDS GQ377514_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J8). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactccggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377515_PreC_P-C Feature FT:CDS GQ377515_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377517_PreC_P-C Feature FT:CDS GQ377517_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377518_PreC_P-C Feature FT:CDS GQ377518_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J14). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagatactgttcttgagtatttggtgtcttttggagtgtggatccgcactcctctcgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ377521_PreC_P-C Feature FT:CDS GQ377521_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J19). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377523_PreC_P-C Feature FT:CDS GQ377523_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J21). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcacacctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377524_PreC_P-C Feature FT:CDS GQ377524_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J23). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377526_PreC_P-C Feature FT:CDS GQ377526_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J27). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaagcagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377527_PreC_P-C Feature FT:CDS GQ377527_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J28). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctatacgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377528_PreC_P-C Feature FT:CDS GQ377528_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J29). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cctctattcgagatctcctcgacaccgcctcagctctataccgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377529_PreC_P-C Feature FT:CDS GQ377529_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J34). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatctggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377530_PreC_P-C Feature FT:CDS GQ377530_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J35). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctatccgggatctcctcgacaccgcctctgctctgtagcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgtcag
>gnl|hbvcds|GQ377531_PreC_P-C Feature FT:CDS GQ377531_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J36). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377533_PreC_P-C Feature FT:CDS GQ377533_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J39). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattagagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggacgagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377535_PreC_P-C Feature FT:CDS GQ377535_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J45). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggggagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377536_PreC_P-C Feature FT:CDS GQ377536_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J47). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccctagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377538_PreC_P-C Feature FT:CDS GQ377538_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J52). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagagtttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377540_PreC_P-C Feature FT:CDS GQ377540_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J57). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377541_PreC_P-C Feature FT:CDS GQ377541_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J58). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgcactgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377543_PreC_P-C Feature FT:CDS GQ377543_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J63). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctgctcgacaccgcctcagctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatattaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ377545_PreC_P-C Feature FT:CDS GQ377545_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J76). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggcattagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377546_PreC_P-C Feature FT:CDS GQ377546_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J77). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcacccctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377551_PreC_P-C Feature FT:CDS GQ377551_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J82). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377552_PreC_P-C Feature FT:CDS GQ377552_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J83). Complete genome. [Hepadnaviridae] (length=639 residues).
aagcaactttttcacctctgcctaatcatctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggaggttccgaggagttactctcttttttgccttctgacctctttc
cttttattcgagatattctggacaggggcgatgctctgtatcgggaggccttagagtgtccggaacattgttcacctccc
catacagcactcaggcaagctattctgtgttggggggagttgatgaatctgaccccctgggtgggaagtaacttggaaga
cccggcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377553_PreC_P-C Feature FT:CDS GQ377553_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J84). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggggagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377554_PreC_P-C Feature FT:CDS GQ377554_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J85). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgggatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377555_PreC_P-C Feature FT:CDS GQ377555_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J86). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggcaacctgggtgggcagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377557_PreC_P-C Feature FT:CDS GQ377557_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J88). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgagtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaagcagtcgtcagctatgtcaatgttaatatgggcctaaaacttagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaggct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377559_PreC_P-C Feature FT:CDS GQ377559_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J92). Complete genome. [Hepadnaviridae] (length=639 residues).
acgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377562_PreC_P-C Feature FT:CDS GQ377562_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J97). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcaagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377563_PreC_P-C Feature FT:CDS GQ377563_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J98). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgagtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377570_PreC_P-C Feature FT:CDS GQ377570_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J110). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgggatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377571_PreC_P-C Feature FT:CDS GQ377571_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J112). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtcaccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377572_PreC_P-C Feature FT:CDS GQ377572_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J113). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctcagctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaacatgggcctgaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377574_PreC_P-C Feature FT:CDS GQ377574_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J115). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctatcctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377575_PreC_P-C Feature FT:CDS GQ377575_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J116). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttagagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgccacagcactgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactcaggcaagctgttctgtgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactacagttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377576_PreC_P-C Feature FT:CDS GQ377576_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J117). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactacagttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377577_PreC_P-C Feature FT:CDS GQ377577_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J118). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagctctatatcgagaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagccattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaaccgttcttgagtacttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377578_PreC_P-C Feature FT:CDS GQ377578_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J125). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
ccctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377579_PreC_P-C Feature FT:CDS GQ377579_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J126). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctttgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377580_PreC_P-C Feature FT:CDS GQ377580_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J127). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacatgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacccaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377583_PreC_P-C Feature FT:CDS GQ377583_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J132). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377584_PreC_P-C Feature FT:CDS GQ377584_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J133). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377585_PreC_P-C Feature FT:CDS GQ377585_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J134). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377586_PreC_P-C Feature FT:CDS GQ377586_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J135). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttc
cttctattcgagatctcctcgacactgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaaga
tccagcatccagggaattagttgtcggctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcaca
tttcctgccttacttttggaagagaaactgttctggagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaacttctgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|GQ377591_PreC_P-C Feature FT:CDS GQ377591_PreC_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J148). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactac