HBVdb

Dataset for nucleotide sequence PreC of genotype C

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
ATGCAACTTTTTCACCTCTGCCTAATCATCTCaTGTTCATGTCCtACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCT
  t tt                          t         t c                                   
                                c                                               
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TTgGGGCATGGACATTGACCCgTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTC---TTTTTTGCCTTCTGACTTCT
  a aa         c   aaa                 a  c c               g        gg g  t  t 
                     c                    a                             c       
                     t                                                          

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TTCCtTCtATTCGaGATCTCCTCGACACCGCCTCtGCTCTgTATCGGGAGGCCTTAGAGTCTCCGGAACATTGTTCACCT
 c  ga cg    t  c  ta t        ta a  ct ac ca a  t                 g     ca tg  
    a  g     g  g  a           ag c     c                                       
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CACCATACAGCACTcAGGCAAGCTATTCTGTGTTGGGGTGAGTTGATGAATCTGGCCACCTGGGTGGGAAGTAATTTGGA
  t  c  c  ta a        cg cg a       t      a    gct a  a  t         g c   c    
           c               t t                          t                       
                             c                                                  

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
AGAcCCAGCATCCAGGGAATTAGTAGTcaGCTATGTCAATGTTAATATGGGCCTAAAAaTCAGACAAcTAtTGTGGTTTC
c  t ag      c a  tgcga t  agat     t  ca    c      a g  gc t  g   a gc       c 
      t           c                                       t        t c          
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                   *    *    * *        * *     
ACATTTCCTGTCTTACTTTTGGAAGAGAAACTGTTCTtGAGTATTTGGTGTCTTTTGGAGTGTGGATTCGCACTCCTcCc
 t  c  t  c  c  c           c  g  c  a  a   c    a  c  c  g        c     a  catt
                            t  c  a  c                                   c   gaa
                                  g                                            g

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   **                *                              *   *                       
GCTTACAGACCACCAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTA------GACG------ACGAGG
c a  t       a             c                g   gg    a           ta       a  t 
                                                t                               
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
            *          *                                    *  *              * 
CAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGG
    a                                     a        a               a  a         
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
AATCTCAATGTTAG------------------------------------------------------------------
gcc ct       a                                                                  
                                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
--------------------------------------------------------------------------------
                                                                                
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
--------------------------------------------------------------------------------
                                                                                
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
--------------------------------------------------------------------------------
                                                                                
                                                                                
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
--------------------------------------------------------------------------------
                                                                                
                                                                                
                                                                                

      1050      1060     
....:....|....:....|....:
                         
-------------------------
                         
                         
                         
© 1998-2020Legal notice