HBVdb

Dataset for nucleotide sequence PreC of genotype C

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
ATGCAACTTTTTCACCTCTGCCTAATCATCTCaTGTTCATGTCCtACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCT
  t tt                          t         t c                                   
                                c                                               
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TTgGGGCATGGACATTGACCCgTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTC---TTTTTTGCCTTCTGACTTCT
  a aa         c   aaa                 a  cac       a       g        gg c  t  t 
                     c                    a                             g       
                     t                                                          

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TTCCTTCtATTCGaGATCTCCTCGACACCGCCTCtGCTCTgTATCGGGAGGCCTTAGAGTCTCCGGAACATTGTTCACCT
 c  gaacg    t  c  ta t        ta a  ct ac c  a  t                 g     ca tga 
       g     g  g              ag c     c                                       
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CACCATACAGCACTcAGGCAAGCTATTCTGTGTTGGGGTGAGTTGATGAATCTGGCCACCTGGGTGGGAAGTAATTTGGA
     c  c  ta a        cg cg a       t      a    gct a  a  t        tg     c    
                           t t                          t                       
                             c                                                  

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
AGAcCCAGCATCCAGGGAATTAGTAGTcaGCTATGTCAATGTTAATATGGGCCTAAAAaTCAGACAAcTAtTGTGGTTTC
c  t ag      c a  tgcga t  agat     t  ca    c      a g  gc t  g   a gc       c 
      t           c                                       t        t c          
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                   *    *    * *        * *     
ACATTTCCTGTCTTACTTTTGGAAGAGAAACTGTTCTtGAGTATTTGGTGTCTTTTGGAGTGTGGATTCGCACTCCTcCc
 t  c  t  c     c       accccgtg  c  a  a  cc    a  c  c  g        c  t  a  catt
                            t  c  g                                          gaa
                                  a                                            g

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   **                *                              *         *                 
GCTTACAGACCACCAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGT------TA------G------ACG
c a  t  g    a             c                g   g     a                       ta
  c                                                                            c
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                  *          *                                    *  *          
ACGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCTCAATCGCCGCGTCGCAGAAGATCTCAAT
 a  t     a  t                          c       a        a               a  a   
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *                                                                           
CTCGGGAATCTCAATGTTAG------------------------------------------------------------
      gcc ct       a                                                            
                                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
--------------------------------------------------------------------------------
                                                                                
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
--------------------------------------------------------------------------------
                                                                                
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
--------------------------------------------------------------------------------
                                                                                
                                                                                
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
--------------------------------------------------------------------------------
                                                                                
                                                                                
                                                                                

      1050      1060      1070 
....:....|....:....|....:....|.
                               
-------------------------------
                               
                               
                               
© 1998-2022Legal notice