HBVdb

Dataset for nucleotide sequence P of genotype C

[Download (right click)] [Alignment] [Repertoires]

2700 sequence(s)

>gnl|hbvcds|AB014360_P_P-C Feature FT:CDS AB014360_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01D01HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggcaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cggtgccagcagcgcctcctcctgcctccaccaatcggcagtccggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
caagtgtcctggccaaaattcgcagtccccaacctgcaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacggt
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtc
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactacctgtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaagccaccgtga
>gnl|hbvcds|AB014362_P_P-C Feature FT:CDS AB014362_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 03D03HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttaccgttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagtgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcacattgacaa
ccgtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggccccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattacccattttcttttatctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggttctttmccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaaagcctttatatgcatgtatacaacctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctatcggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaacctccgtga
>gnl|hbvcds|AB014363_P_P-C Feature FT:CDS AB014363_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 04D04HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttccg
aacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggtattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggccttta
cctgcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacacatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctaractcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagt
tcctgctcaaggaacctctatatttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaatttccttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaca
aaatcaagcaatgttttaggaaactgcctgtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcccgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggcc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagccggtctggggcgaaactgatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB014365_P_P-C Feature FT:CDS AB014365_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01D06HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgtcaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccctcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcatactcccatstctccacctttaaga
gacagtcatcctcaggccatacagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaccacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctaaactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggatcatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
tactttctcgccaacttataaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcttgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB014367_P_P-C Feature FT:CDS AB014367_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 08D08HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctctattcttctacggtacctgtctttaatcctgagtggcaaactccctcctttcct
aatattcatttacaggaggatattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggtattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagytacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtaaggggcctata
tttccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatccggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacgggaacatgcaggacctgcacgat
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcggaagctacctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgcccctttcacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggccttcctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tatgccaagtgtttgctgacgcaacccccactggatggggcttggccattggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB014369_P_P-C Feature FT:CDS AB014369_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10D10HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggacgc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccggaggcaaatcaggtgggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacag
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtgcggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacggagtctagactcgtggtggacttctctcaattttctaggggaagcacc
camgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttstggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcaatggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctacacccttaacttcatgggatatagaattggaagttggggtactttaccacaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgctccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatmtgaacctttaccccgttgcccggcaacggtccggtt
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgttctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcacagaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB014371_P_P-C Feature FT:CDS AB014371_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 12D12HCC). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggacgc
ataaggtgggaaactttactggcctttattcttctactgtacctgtcttcaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
gaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacacggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagtagcacctcctcctgcatccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatc
gcttgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctamttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttgccacaagaacatattgtactaa
aaatcaagcaatgttttagaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgtcaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcgaaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctgcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatgggcatggagaccaccgtga
>gnl|hbvcds|AB014372_P_P-C Feature FT:CDS AB014372_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 13D13HCC). Complete genome. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgccaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattctgtgggtcaccatattcttgggaacaagagctacagcaaacctcgaaaaggcatgg
ggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaac
aatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagg
gttcaccccgccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagctcctc
ctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcc
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
caattccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatc
ctcacaataccacagagtctaractcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaaactc
tacgattccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccct
taacttcatgggatatgtaattggcagttggggtactttaccacaggaacatattgtattaaaacttaagcaatgttttc
ggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttt
actcaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggccttcactttctcgccaactta
caaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctg
acgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagcagcttgttttgctcgcagccggtctggggcaaaacttatcgggactgacaactctgttgtcct
ctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtytacg
tcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttc
cggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB014374_P_P-C Feature FT:CDS AB014374_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 15D15HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacacagcgcttcattttgtgggtcaccatattcttgggaacaagagttacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatctactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaga
aactaaaacaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccttttacacaatgtggctatcctgctttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcacggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttggg
gctcctctgccgatccataccgcggaactcctagcggcttgttttgctcgcagccggtctggagcgaaacttattgggac
tgacaactccgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB014376_P_P-C Feature FT:CDS AB014376_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 17T02HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtctttca
aacctcgacgaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaagggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aamtcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcatctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB014377_P_P-C Feature FT:CDS AB014377_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18T03HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttaccgttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaacattaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaa
cagtgccagcggcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctcgatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggatactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtcatga
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcrgcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcgtgttttgctcgcagccggtctggggcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB014378_P_P-C Feature FT:CDS AB014378_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 19Y01HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccacctcacggaggtcttttggggcggagccctcaggctcaaggcatattgacaa
cagtgccagcggcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaactccaccacattccaccaagctctgttagatcccaaagtgaggggcctata
tcttcctgctggtggctccagttccggaacagaaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagaggctagactcgtggtggacttctctcaattttctaggggaagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtcggta
caacatcgtgagtccctttttacckctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggcagttggggtactttaccacaggaacatattgtccaaa
aactcaagcaatgttttcggaaattgcctgtaaatcgacctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttttgtgtaaacaatatctgcacctttaccccgttgcacggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcgggac
tgacaattctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgactctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB014379_P_P-C Feature FT:CDS AB014379_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 20Y02HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgcattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatyaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaaacacctctatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctaataagaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtt
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctggcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
agacaactctgttgttctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB014380_P_P-C Feature FT:CDS AB014380_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 21Y03HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttcca
aacctcgacgaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgcattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctaaaccccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatccgcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagtacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
trccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcaactctatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttatgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
ggacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB014381_P_P-C Feature FT:CDS AB014381_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 22Y04HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
catattcatttgcaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
cggaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcnggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctacaccccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
ggacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB014382_P_P-C Feature FT:CDS AB014382_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23Y05HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagact
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcatacgggccaggggtcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatattgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggarcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctgggtatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcgaaacacctctatatttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtcattggaagttggggtactttaccgcaagaccatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacctgatcggaac
ggacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB014383_P_P-C Feature FT:CDS AB014383_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 24Y06HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgcattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtaaggggcctcta
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcacagaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattatacaaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
agacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccattcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB014384_P_P-C Feature FT:CDS AB014384_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 25Y07HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttgcaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgagcatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggaccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgcattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggacgacagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctata
cttccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcgccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactygtggtggacttctctcaattttctaggggaagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaacwaccagcacgggaccatgcaagacctgcacrat
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtgattggaagttggggtactttaccgcaagaccatattgtactaa
aactcaagcaatgttttcgcaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcctgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtctggagcgaaactgatcggaac
ggacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtccttcgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB014385_P_P-C Feature FT:CDS AB014385_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26Y08HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttgcaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacacgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacacagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtattcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggtgcattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcact
caagtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccgacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcagaacacctctatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccytttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattatacaaa
aactcaagcaatgtttccgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
tgacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB014389_P_P-C Feature FT:CDS AB014389_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 30Y12HCC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggtgcattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgatagaccccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcytccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaccaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcaccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
ggacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccattccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB014391_P_P-C Feature FT:CDS AB014391_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 32Y14HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattattratagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgcattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctata
cttccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
aaagtgtcctggccgaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaaacaactctatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctrgctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgatggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaggtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaaagcctttatatgcatgtatacaatctaagcgggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtg
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctattggtcatcgccgcatgcgtggaacctttgtg
gctccgctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
agacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgtttgggtctctaccgtccc
ctccttcatctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB014392_P_P-C Feature FT:CDS AB014392_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 33Y15HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaagaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttytatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacgaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgagcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgcattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccaaagtaaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctaaactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaaacacctctatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattatactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tatgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
agacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB014393_P_P-C Feature FT:CDS AB014393_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 34Y16HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatatcccttggacgc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttgcaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctacccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcagagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaamtcaggtaggggc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgcattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatccagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccttgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcattttactagtgccattt
gttcagtggttcgtagggctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattatacaca
aactcaagcaatgtttycgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcttgtatacaatctaagcaggcttt
cactttctcgccaacgtacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
ggacaactctgttgttctctctcggaaatacacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB014394_P_P-C Feature FT:CDS AB014394_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 35Y17HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggacgc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatacttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggcaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaytggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaagggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
ttccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactccctcaacttcatgggatatgtaattggaagctggggtactttaccgcaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctwgcrgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtytacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB014396_P_P-C Feature FT:CDS AB014396_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 37Y19HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
cacattcatttgaaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacaagcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaacttcacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattaacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaagcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
gggtttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcraaactgatcggaac
ggacaactccgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB014399_P_P-C Feature FT:CDS AB014399_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 40Y22HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtaccccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccgtaccaaatatttgcccttggacaagggcattaaaccatattatc
ctgaacatacagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacckctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtgattggaagttggggtactttaccgcaagaccatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcgggac
agacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB026811_P_P-C Feature FT:CDS AB026811_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;97.Feb.). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacgcggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccggtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattatactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgcatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
agacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB026812_P_P-C Feature FT:CDS AB026812_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;98.May). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacgcggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccggtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattatactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgcatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
agacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB026813_P_P-C Feature FT:CDS AB026813_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;97.Sep.). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcagatcaggtaggagc
gggagcattcgggccagggttcaccccaccacgcggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccggtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattatactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgcatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
agacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB026814_P_P-C Feature FT:CDS AB026814_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Donor 3;98.May). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacgcggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccggtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattatactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgcatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
agacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB026815_P_P-C Feature FT:CDS AB026815_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 2:full). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataaggtgggaaactttactggcctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgtagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacacggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatggggtatgtaattggaagctggggtactttaccacaggaacatattgtactga
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcatttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgcaaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB031262_P_P-C Feature FT:CDS AB031262_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV VietA-3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcatttcct
cacattcatttgaaagaggatattattagcagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatacgctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtggctcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagaatctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacgtcaaccaccagcatgggaccatgcaagacctgcacaac
tcctgctctaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggagcatattgtacaca
aaatcaaacaatgttttcggaaacttcctattaatagacctattgattggaaagtatgtcaacgcattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttctcggcac
tgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccctcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB033550_P_P-C Feature FT:CDS AB033550_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NDR260). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacaactaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatacttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggccggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacca
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcacagaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacgga
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacactctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgcggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatccttcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB033551_P_P-C Feature FT:CDS AB033551_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK300). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggacccagca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaaccttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagaaccgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttatctttgggtatacatttaaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgacacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB033552_P_P-C Feature FT:CDS AB033552_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK494). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggacccagca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaaccttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttatctttgggtatacatttaaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgacacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB033553_P_P-C Feature FT:CDS AB033553_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK619). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggacccagca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgttagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacgaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttatctttgggtatacatttaaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgacacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB033556_P_P-C Feature FT:CDS AB033556_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AK66). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggacccagca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaaccttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttatctttgggtatacatttaaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgacacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB042282_P_P-C Feature FT:CDS AB042282_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattcttgcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggtcagggttcaccccgccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccgcctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaaaggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcgtaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB042283_P_P-C Feature FT:CDS AB042283_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattcttgcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccgccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccgcctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaaaggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctacgag
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB042284_P_P-C Feature FT:CDS AB042284_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaagaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaagttaattatgcctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccgtattatc
cggaacatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcagtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacctccactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctattcccttaatttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttg
ggctttgctgctccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgagtggaacctttgtg
gctcctctgccgatccatactgcggaactcgtagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcaaccaccgtga
>gnl|hbvcds|AB049610_P_P-C Feature FT:CDS AB049610_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV AN29). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttgcaggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatc
cggaacatacagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcatttggtccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaaactctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcatcgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgtcgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacc
cacgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgta
caacatcttgaggccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctattcccttaactttatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aactcaagcaatgttttcgcaaacttcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctg
ggctttgctgccccttttacacaatgtggttatcctgccttactgcctttgtatgcatgtatacaagctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtataaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtgtggagcaaaactcatcggaac
cgacaactgtgttgtcctctctcgaaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctgtacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB050018_P_P-C Feature FT:CDS AB050018_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtgcggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatataattggaagttggggtactttaccacaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtg
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB074047_P_P-C Feature FT:CDS AB074047_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th11). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtagcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
aacattcatttgaaagaggatattatcaacagatgtcaaaattttgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaagcttaccaaatatttgcccttagataagggcattaaaccttattatc
ctgaacatgcagttaatcattacttccaaacgaggcattatttacatactctgtggaagtctgggattttatataagaga
gaaactacacacagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcaccagttggacctggcg
ttcagagccaattcaaacaatccagattgggacttcaatcccaacaaggatcaatggccagcagcaaaccaggtaggagt
gggatcattcgggccaggattcactccaccacacggcagtcttttggggtggggccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgtggaattccagcacattccgccaagctctgctagatcccagagtgaggggcctatattt
tcctgctggtggctcaagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaaga
ctggggaccctgcaccgaacatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaagggaaatacccgc
gtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactac
cgaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcc
tgctcgaaacatctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccat
catcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacac
catcgtgaagccctttttaccgctgttaccaattttcttttatctttgggcatacatctaaaccctaataaaaccaaacg
ttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaat
tgaaacagtgttttcggaaacttcctgtaaacagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggc
tttgccgccccttttacacaatgtggttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctgt
gccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgact
cctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccga
caactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcggga
cgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgtttgggactctaccgtcccctt
cttcgtctgccgttccagccgactacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB074755_P_P-C Feature FT:CDS AB074755_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th44). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
aacattcatttgaaagaggatattatcaacagatgtcaacaatatgtgggtcctcttacggttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcataaaaccgtattatc
ctgaacatacagttaatcattacttccaaacgaggcattatttacatacgctgtggaaggctgggattttatataagaga
gaaactacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcg
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagt
gggagcattcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgtcaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctcaagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aattaaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctg
ggctttgccgccccttttacacaatgtggttacccagcattaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctcgcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB074756_P_P-C Feature FT:CDS AB074756_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th55). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaggaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttaccaaatatttacccctagataaaggcattaaaccttattatc
ctgaacatacagttaatcattacttccaaactagacactatttacatactctgtggaaggctggtattttatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcg
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggatcattcgggccagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctcaagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aattgaaacaatgttttcgaaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctg
ggctttgccgccccttttacacaatgtggttacccagcattaatgcctttatatgcatgtatacaagctaggcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcacagccggtctggagctaaacttatcggcac
cgacaactccgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacatcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB105173_P_P-C Feature FT:CDS AB105173_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hawaii 16). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtcttcaatcctgaatggcaaactccctcttttcca
cacattcatttaaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcatcaaaccttattatc
ctgaacatgtagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagt
gggatcattcgggccggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aaatcaaacaatgttttaggaaacttcctacaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggttttgccgctccctttacacaatgtggatacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB105174_P_P-C Feature FT:CDS AB105174_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hawaii 60). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtaggcccgcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccacctcacggaggtcttttggggcggagccctcaggctcaaggcatattgacaa
cagtgccagcggcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaactccaccacattccaccaagctctgttagatcccaaagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagcctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctactaaaactaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctataaatagacctattgactggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggctataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB106895_P_P-C Feature FT:CDS AB106895_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate pHB4-4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataagggcattaaaccttattatc
ctgaacacgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggacaggggcacttcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagcggaactccacaacattccaccaaactctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacggt
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtgtacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaacacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB111114_P_P-C Feature FT:CDS AB111114_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggcaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgagcatgcagttaatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacacagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttagacccagcg
ttcggagccaactcaaacaatccagattgggacttcaatcccaacaaggatcactggccggaagcaaatcaggtaggagc
gggagcattcgggccagggttcaccccacctcacggcggccttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctcctccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagaggctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctattaccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacacattgtacaaa
aactaaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaaggattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcggcctgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcgcaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtatgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB111119_P_P-C Feature FT:CDS AB111119_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggagcattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaaatccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcaatttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctattcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactaaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
gcctttgctgccccttttacgcaatgtggctatcctgctttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagcggcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB111120_P_P-C Feature FT:CDS AB111120_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggagcattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaaatccacaacattccaccaagctctgctagaccccagagtaaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattatactaa
aactcaagcaatgttttcgcaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
ggacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB111121_P_P-C Feature FT:CDS AB111121_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcctttcct
aacattcacttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctaccctaaccttactaaatatttgcccttggataaaggcattaaaccttattatc
ctaaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaaga
gaaactacacgcagcccttcattttgtgggtcaccatattcttgggaacaagaactacagcatgggagtttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctctggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaagggcctata
ttttcctgctggtggctccagttccggaacaataaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacgcaatgtggctatcctgccttaatgcctttatatgcatgtatacaatcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB111122_P_P-C Feature FT:CDS AB111122_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccttcctttcct
aacattcacttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctaccctaaccttactaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcgtcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggccaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaagggcctata
ttttcctgctggtggctccagttccggaacaataaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccacactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacgcaatgtggctatcctgccttaatgcctttatatgcatgtatacaatcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggcc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB111123_P_P-C Feature FT:CDS AB111123_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccttcctttcct
aacattcacttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctaccctaaccttactaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggccaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaagggcctata
ttttcctgctggtggctccagttccggaacaataaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacgcaatgtggctatcctgccttaatgcctttatatgcatgtatacaatcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB111124_P_P-C Feature FT:CDS AB111124_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaacctcaccaaatatttgcccttggacaaaggcattaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaaga
gacagtcatcctcaggccatacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatattgtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatttgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgattcatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB111125_P_P-C Feature FT:CDS AB111125_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaacctcaccaaatatttgcccttggacaaaggcattaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaaga
gacagtcatcctcaggccatacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatattgtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatttgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgattcatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB111946_P_P-C Feature FT:CDS AB111946_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT103). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
aacattcatttgaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagt
gggatcattcgggccagggttcactccaccacacggcggtcttttggggtggagccctctggctcagggcatattgacaa
ctgtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatctctccacctctaaga
gacagtcattctcaggcaatgcagtggaactcaagcacattccaccaagctctgctagatcccaaagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttcagactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggtcccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctggggggagcccc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcatgggaccatgcaagacctgcacgac
acctgctcaaggaacctctatgtttccctcttgttgctgtaccaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtgtacatttaaaccctactaaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcaccctaccacaagaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctcttaatagacctattgattggaaagtctgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaagcttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctgcttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB112063_P_P-C Feature FT:CDS AB112063_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT101). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgaatggaaaactccctcttttcct
aacattcatttgaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaagtgaccatgcctgccaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatacgctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtggctcaccatattcttgggaacaagagctacagcatgggaccttggtcttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggatcattcgggccagggttcaccccaccacacggcaatcttttggggtggagcccgcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctctacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccaaagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttcagactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgttctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcatgggaccatgcaagacctgcacgac
acctgctcaaggaacctctatgtttccctcttgttgctgtacacaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtgtacatttaaaccctactaaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcaccctaccacaagaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctcttaatagacctattgattggaaagtctgtcaacgaattgtggggcttctg
ggctttgccgctcccttcacacaatgtggttacccagcattaatgcctttgtctgcatgtatacaagctaaacgggcttt
cactttctcgccaacttacagggcctttctgtgtaaacaatatatgaacctttaccccgttgctcggcaacgcccaggtc
tttgccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaagcttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgggggcgtttgggactctaccgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB112065_P_P-C Feature FT:CDS AB112065_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT140). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgaatggaaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagctaacgaacaaaggagatt
aaaattgatcatgcctgctaggttctatcctaaccttaccaaatatttgcctttagatacaggcattaaaccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatacgctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtggctcaccatattcttgggaacaagagctacagcatgggaggttggacttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttccctatcaccagttggacccggca
ttcagagccaattcaaacaatccatattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggatcattcggaccagggttcaccccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagaaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgtggcccgtttgtcctctacttccaggaacatcaactaccatcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggacttctg
ggctttgccgctccctttactcaatgtggtaccccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaagtacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttgttcgtctgccgttccggccgaccacggggtgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgctttaccactgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB112066_P_P-C Feature FT:CDS AB112066_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY624). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccccatcttatcaacactcccggaaactactgttgttagacgacgaggcaggtcccctagaaagagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttaccaaatatttacccttagataaaggcattaaaccttattatc
ctgaacatacagttaatcattacttccaaactagacactatttacatactctgtggaaggctggtattttatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
accctcggaaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcg
ttcagagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggatcattcgggccagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtcaccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccatcacgggaccatgcaagacctgcacgaa
tcctgctcaaggaacctctatgtttccctcgtgctgctgtacaaaaccttcggacggaaatggcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaagccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtgattggaagttggggtaccttgccacaggaacatattgtacaaa
aattgaaacaatgttttcgaaaacttcctataaatagacctattgattggaaagtatgtcaacgcattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaagacctttcggtgtgagcaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctatctttacgcggtatccccgtctgtgcctgctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB112348_P_P-C Feature FT:CDS AB112348_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY656). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggccggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
tacattcatttgaaagaggatattattaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttaccaaatatttacccttagataaaggcattaaaccttattatc
cggaacatacagttaatcattacttccaaactagacactatttacatactctgtggaaggctggtattttatataagaga
gaaactacacgcagtgcctcattttgtggctcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcg
ttcagagcccattcaaacagtccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggagcattcgggccagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagaacccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgttctgtccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctctaggagactctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaca
aaattgaacaatgttttcggatacttcctattaatagacctattgattgggaagtatgtcaaagaattgttgggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaaccccccctggttggggcttggccatagaccagcagcgcatgcgtggaacccttgtg
gctcctctgccgatccatactgcggaactactagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccgaccgacctcggggcgcaccacgatttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB112408_P_P-C Feature FT:CDS AB112408_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY683). Non-functional genomic sequence. [Hepadnaviridae] (length=2523 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaacagatgtcaacaatttgtaggccctcttacggttaatgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatacaggtaatcattacttccaaactagacattatttacatactctgtggaaagctggtattttatataagaga
gaaactacacgaagtgcctcattttgtggaccaccatattcttgggaacaagagctacagcatgggaggtcggtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttctaggaaaccagttggacccagcg
gtcggagccaaggcaaacaatccagattgggacttcaaccccaacaaggagcaatggccagcggcaaaccaggtaggagt
gggatcattcgggccagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatatctccacctctaaga
gacagccatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggtcctgc
tggtggctcaagttccggaacagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactgggg
accctgcaccgaatatggagagcaccgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttg
acaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcc
tggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgt
gtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggt
atgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctct
aggcatctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatctt
gggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgg
ttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacacctt
gaatccctttttacctctattaccaattttctttcgtctttgggtatacatttaaacccgaataaaaccaaacgttgggg
ctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaac
aatgttttcggcaacttcctattaatagacctattgattgggaagtatgtcaaagaattgttgggcttctgggctttgcc
gctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctc
gccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaag
tgtttgctgacgcaaccccccctggttggggcttggccatagaccagcagcgcatgcgtggaacccttgtggctcctctg
ccgatccatactgcggaactactagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactc
tgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcct
ttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgt
ctgccgttccgaccgacctcggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgt
gcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB112471_P_P-C Feature FT:CDS AB112471_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TH123). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcataaaaccttattatc
ctgaacatgcagttaatcattacttccaaactagacactatttacatactctgtggaaggctgggattttatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccagcg
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggagcattcgggccagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
ccgtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatccgcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctcaagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctggacgaa
tcctgctcaaggaacctctatgtttccctcatgttggtggacaaaaccttgggacggaaaatgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgtgggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattggacaaa
aattgaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctg
ggctttgccgccccttttacacaatgtggttacccagcattaatgcctttatatgcatgtatacaagctaagcaggcttt
cacattctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgttctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB112472_P_P-C Feature FT:CDS AB112472_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TH124). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgctcctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaattccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtccctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatatcatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaagaagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaagctaggcattatttacatactctgtggaaggctggtatcttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccagcg
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggagcattcgggccagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
ccgtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatccgcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggactgta
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctactaaaactaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggttctttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgggggtacccagcattaatgcctttggatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgctcggcaacggccaggtc
tttgccaagtggttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttctcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctgcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgggggcacttcgctacacctctgcacgaggcatggagaccaccgtga
>gnl|hbvcds|AB113875_P_P-C Feature FT:CDS AB113875_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggcaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttgatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggttttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaagccagattgggacttcaaccccaacacggatcactggccggaggcgaatcaggtaggagc
gggagcattcggtccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtatctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctttta
ggctttgctgccccatttacacaatgtggctatcctgccttgatgcccttatatgcatgtatacaatcgaaccaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtc
tctgtcaagtgtttgctgacgcaacccccactggctggggcttggcaataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
tgacaactcagttgtcctctctcggaaatacacctcatttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB113876_P_P-C Feature FT:CDS AB113876_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggcaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttgatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggttttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaagccagattgggacttcaaccccaacacggatcactggccggaggcgaatcaggtaggagc
gggagcattcggtccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtatctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctttta
ggctttgctgccccatttacacaatgtggctatcctgccttgatgcccttatatgcatgtatacaatcgaaccaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtc
tctgtcaagtgtttgctgacgcaacccccactggctggggcttggcaataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
tgacaactcagttgtcctctctcggaaatacacctcatttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB113878_P_P-C Feature FT:CDS AB113878_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttactaaatatttgcccttggataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactgcacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaactcaggtaggagc
gggagcattcggaccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaattccacaacattccaccaggctctactagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaattaagaactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctaccttaaagcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtctgggactctatcgtccc
cttcttcatctgccattccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB113879_P_P-C Feature FT:CDS AB113879_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatc
ccgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagagtcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcccgtctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgccgggctttcccccactgtttggctttcagttatatggatgatatggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttgggggtactcccttaacttcatgggatatgtaattggaagttggggtacgttaccacaggaacatattgtactaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtctgtcaaagaattgtaggtcttttg
ggcttcgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttt
tactttttcgccaacttacaaggccttcttgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctggcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctttctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcagctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB115417_P_P-C Feature FT:CDS AB115417_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-O47). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaaccctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattatcaatagatgtcaacaatatgtaggacctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggaattaaaccgtattatc
ctgaatatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggatcctttcccgagcatcagttggaccccgcg
accggagccaacacaaacaatccagattgggacttcaaccccaacaaggatcaatggccggaggcaaaccaggaaggagg
gggagcattcgggccagggttcaccccaccacacggcggtctttcggggtggagccctcagactcagggcatactgacaa
cagcgccagcagcgcctcctcctgccaccaccaatcggcagacacgaagacagcccacgaccatctctccacctctaata
gacagtcatcctcaggccatgcagtggaactccacaactttccaccaagctctgctagaccccaaattgaggggcctgta
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagaatctagactcgtggtggacttctcacagttttctagggggaacacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttggtggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgat
tcctgctcaaagcacctctatgtttccctcttggtggtggacaaaaccttcggacggaaattgcacttgtattcccatcc
catcgtcctgggctttcgcaagaatcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggcttccccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acggtggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aacccaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttt
ctctttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccc
cttcttggtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB117758_P_P-C Feature FT:CDS AB117758_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CB10). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatatcatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattgataatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatacggttaatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcg
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggatcattcgggccagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctgtccacctgtaaga
gacagtcatactcaggccatgctgtggaactccgcaacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctcaagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aactgaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctg
ggctttgctgccccttttacacaatgtggttacccagcattaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctcgcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctgcgtctgccgttccgaccgaccacggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB176642_P_P-C Feature FT:CDS AB176642_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-115). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttagtatcccttggactc
ataaggtgggaaactttaccgggctttactcttctactgtacctgtctttaatcctgagtggcaaaccccctcctttcct
aacattcatttacgggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccnttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtgggagc
aggagcattcgggccagggttcgccccgccacacggcggtctgttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccgcctctgaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtaaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggyggcgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttytatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgct
caacatcttgagtccctttttacckctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaccatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttr
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcrgcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaacacttattgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggrtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctrcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB182589_P_P-C Feature FT:CDS AB182589_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CH:Mat-Ko). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaacctaaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcatttgggccagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactcctcaacattccaccaagctctgctagatcccagagtgaggggcctgta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaactctttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactctcttaacttcatgggatatgtgattggaagctggggtactttaccacaggaacatattgtattaa
aactcaaacaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttgatgcctttatatgcatgtatacaatctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccgtaggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195930_P_P-C Feature FT:CDS AB195930_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttactaaatatttgcccttggataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactgcacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaactcaggtaggagc
gggagcattcggaccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaattccacaacattccaccaggctctactagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcgtatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaattaagaactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtctgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgtacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195931_P_P-C Feature FT:CDS AB195931_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttactaaatatttgcccttggataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactgcacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaactcaggtaggagc
gggagcattcggaccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaattccacaacattccaccaggctctactagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaattaagaactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtataaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggcac
cgacaactctgttgtcctctcgcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtctgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccatctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgtacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195932_P_P-C Feature FT:CDS AB195932_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttactaaatatttgcccttggataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactgcacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaactcaggtaggagc
gggagcattcggaccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaattccacaacattccaccaggctctactagatcccagagtaaggggcctata
tcttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcattccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaattaagaactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtataaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggcac
cgacaactctgttgtcctctcgcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtctgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccatctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgtacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195936_P_P-C Feature FT:CDS AB195936_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggatcagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcgtcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagt
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaactcccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB195937_P_P-C Feature FT:CDS AB195937_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggatcagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcgtcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
tccttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccgaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagt
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaactcccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB195938_P_P-C Feature FT:CDS AB195938_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggatcagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcgtcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
tccttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccgaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagt
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaactcccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB195942_P_P-C Feature FT:CDS AB195942_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggagcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttctcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgactggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccttttacacaatgtggctatcccgccttgatgcctttatatgcatgtatacaatctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195943_P_P-C Feature FT:CDS AB195943_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaagactggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggagcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgactggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccttttacacaatgtggctatcccgccttgatgcctttatatgcatgtatacaatctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB195944_P_P-C Feature FT:CDS AB195944_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaagactggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggagcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgactggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccttttacacaatgtggctatcccgccttgatgcctttatatgcatgtatacaatctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB195945_P_P-C Feature FT:CDS AB195945_P_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattgatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttccttttgtgggtcaccatattcttgggaacaagagctacagcaaaccttgacaaggcatgg
ggacgaatctttctgttcccaatcctctgggattctttcccgagcaccagttggaccctgcgttcggagccaactcaaac
aatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagg
gttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctc
ctcctgcctccaccaatcgtcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggca
atgcagtggaactccaccacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccgtcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactccct
taacttcatgggctatgtaattggaagttggggaactttaccacaggaacatattgtactaaaaatcaaacaatgttttc
ggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggccttttgggctttgctgcccctttt
acacaatgtggctatcctgctctgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaactta
caaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctg
acgcaacccccactggatggggcttggctataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggactgacaactctgttgtcct
ctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacg
tcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttc
cggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgacgcatggagaccaccgtga
>gnl|hbvcds|AB195947_P_P-C Feature FT:CDS AB195947_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aatattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcactccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccaacagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctcctagatcccagagtgaggggcctata
tttccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttacctcaggaacatattgtacaaa
aactaaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
tgacaactctgttgtcctttctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195948_P_P-C Feature FT:CDS AB195948_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2508 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aatattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatacaaggcatggggacga
atctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattcaaacaatcca
gattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcac
tccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagcgcctcctcctg
cctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcag
tggaactccaccacattccaccaagctctcctagatcccagagtgaggggcctatatttccctgctggtggctccagttc
aggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaaca
tggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcaca
ataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgca
gtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgt
cctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtt
tccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagat
tcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcc
cccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacc
tctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaactt
catgggatatgtaattggaagttggggtactttacctcaggaacatattgtacaaaaactaaagcaatgttttcggaaac
tgcctgtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaa
tgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggc
ctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaa
cccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcg
gaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctttctcg
gaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgt
cggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccg
accacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacc
tctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195949_P_P-C Feature FT:CDS AB195949_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccggaggcgaagcaggtaggagc
gggagcattcggtccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttgatgcccttatatgcatgtatacaatcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtc
tctgtcaagtgtttgctgacgcaacccccactggatggggcttggcaataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactcagttgtcctctctcggaaatacacctcatttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtagcatggagaccaccgtga
>gnl|hbvcds|AB195952_P_P-C Feature FT:CDS AB195952_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcacccccccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggattggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaatttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tatgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaacacttatcggaac
cgacaactccgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttgctctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB195953_P_P-C Feature FT:CDS AB195953_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcacccccccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccactaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggattggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaatttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tatgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaacacttatcggaac
cgacaactccgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttgctctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195954_P_P-C Feature FT:CDS AB195954_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcacccccccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccactaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggattggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaatttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tatgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaacacttatcggaac
cgacaactccgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttgctctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB198076_P_P-C Feature FT:CDS AB198076_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcgtttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaacttaattatgcctgctaggttctatcctaaccttactaaatatttgcctttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatccaagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaactaa
gcgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggagcatattgtacaaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacattctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcacggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgag
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgatccgtcgcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB198077_P_P-C Feature FT:CDS AB198077_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggaactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctgttggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcgaaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB198078_P_P-C Feature FT:CDS AB198078_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcagactccctcttttcct
cacattcatttacaggaggacattattaatagatgtcaacaattcgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
tttggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgatggggatactcccttaacttcatgggatatgtaattggaagttggggtacattaccgcaggatcatattgtactaa
aaatcaagcaatgttttcaaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaagcctttctgtgtaaacaatatctgaccctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggctataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtctggagcgaagctgatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB198079_P_P-C Feature FT:CDS AB198079_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcartggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccacaagatcatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacgggcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactccgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB198080_P_P-C Feature FT:CDS AB198080_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagtgaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ccgaacatgcagttaatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacagcattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggaactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaataggcctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccattctgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgtttggggctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB198081_P_P-C Feature FT:CDS AB198081_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgacaatgcagttaatcattacttcaaaactaggcattatttacacactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctggtagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aaattaaacaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcgtgtatacactctaagcaggcttt
cactttctcaccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
tgacaactctgttgtcctctctcggaaatacacctcttttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB198082_P_P-C Feature FT:CDS AB198082_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctatctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgcctgcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacaataaaccctgttccgactactgcctctcccacatcgtcaatcttcttga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aaatcaagcaatgctttcgaaaactgcctgtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggcttcgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtc
tatgccaagtgtttgctgacgcaacccccactggatggggcttggccatcggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctggccgcttgtttcgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttggggctctatcgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB198083_P_P-C Feature FT:CDS AB198083_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttacaggaggacataattaatagatgtcaacaatatgtgggtcctcttacagtcaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcatactatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccactttccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgggacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aaatcaaacaatgtttccgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcgtgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctcacggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB202071_P_P-C Feature FT:CDS AB202071_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccatcacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaattaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcctt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaggccaccgtga
>gnl|hbvcds|AB202072_P_P-C Feature FT:CDS AB202072_P_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=2508 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggcccgaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccatcacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaactccacaacattccaccaagctctgctagatcctgctggtggctccagttc
cggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaaca
tggagagcacaacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgca
gtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgt
cctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtt
tccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaat
tcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcc
cccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacc
tctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactt
catgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaattaagcaatgttttcggaaac
tgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaa
tgtggctatcctgccttgatgcctttatatgcatgtatacaatctaaacaggccttcactttctcgccaacttacaaggc
ctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaa
cccccactggatggggcttggctataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcg
gaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcg
gaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgt
cggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccg
accacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacc
tctgcacgtcgcatggaggccaccgtga
>gnl|hbvcds|AB205123_P_P-C Feature FT:CDS AB205123_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CN578-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ccgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagagcatactgacaa
cagtgccagtaacacctcctcctgcctccgccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcggtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgccccacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggagttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacaccaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttcctagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttcacttcatgggatatgtaattggaagttggggaactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggtac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctataccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB205124_P_P-C Feature FT:CDS AB205124_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TJ3-1-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaaggactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgttcctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatccttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB205125_P_P-C Feature FT:CDS AB205125_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VH34-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttccactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatatagttaatcactacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagt
gggatcattcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaactccagcacattccaccaagctctgctagatcccagagtgcggggcctcta
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccactattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctattcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aaatcgagcaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaacctttatg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggggcaaaccttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB222714_P_P-C Feature FT:CDS AB222714_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UZNVC7). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattca
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtatcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttgtcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB222715_P_P-C Feature FT:CDS AB222715_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UZNVC7M). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagatkgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattca
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtatcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttgtcgggac
tgacaactctgttgtcctctctcggaaatacacctcccttcccatgctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB241110_P_P-C Feature FT:CDS AB241110_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhLC03). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacac
ataaggtgggaaactttactgggctttattcttctaatgtacctgtctttaaccctgagtggcaaactccctcttttcct
gatatacatttgcaggaggacatcattaatagatgtcaacaatttgtgggcccgcttactgtaaatgaaaaaaggagact
aaagttaattatgcctgctagattttttcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatatagttaatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattcttgccagaccatcagttggacccggct
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcttggcaggtaggagc
tggagcattcgggccagggttcaccccaccacacggcggccttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacatttcatcaagctctgctagatcccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaaaacctgcacgac
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatctgaaccctcacaaaaccaa
gcgttggggctactcccttaatttcatgggatatgtaattggaggttggggtaccttaccacaggatcatattgtactaa
aaatcaagcaatgttttcgaaaactccctgttaatcgaccgatagattggaaggtatgccaaagaattgtgggtcttctg
ggctttgctgccccttttacacaatgtggttatcctgcattactgcctttgtatgcatgtatacaagcgaagcaagcttt
cactttctcgccaacttacaaggcttttctgtgtaaacaatatttgaccctttaccccgttgctcggcaacggccaggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcaaaactcataggaac
cgacaactctgttgtcctctctcggaaatacacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgggggcgcttggggatctatcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB241111_P_P-C Feature FT:CDS AB241111_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhLC14). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacac
ataaggtgggaaactttactgggctttattcttctaatgtacctgtctttaaccctgagtggcaaactccctcttttcct
gatatacatttgcaggaggacattattaatagatgtcaacaatttgtgggcccgcttactgtaaatgaaaaaaggagact
aaagttaattatgcctgctagattttttcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatatagttaatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcca
aacctcgaaaaggcatggggacgaatctctctgttcccaatcctctgggattcttgccagaccatcagttggacccggct
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcttggcaggtaggagc
tggagcattcgggccagggttcaccccaccacacggcggccttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacatttcatcaagctctgctagatcccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgac
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttgaaccctcacaaaaccaa
gcgttggggctactcccttaatttcatgggatatgtaattggaagttggggtaccttaccacaggatcatattgtactaa
agatcaagcaatgttttcgaaaactccctgttaatcgaccgatagattggaaagtgtgccaaagaattgtgggtcttttg
ggctttgctgccccttttactcaatgtggttatcctgcattactgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcttttctgcgtaaacaatatttgaccctttaccccgttgcccggcaacggcccggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggcaatgggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcgaaactcataggaac
cgacaactctgttgtcctttctcggaaatacacctcgtttccatggctgctcggttgtgctgccaattggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgggggcgcttggggatctatcgtccc
cttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB246344_P_P-C Feature FT:CDS AB246344_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaacctcaccaaatatttgcccttggacaaaggcattaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaaga
gacagtcatcctcaggccatacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatattgtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatttgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB246345_P_P-C Feature FT:CDS AB246345_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagtgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagcccacaggcacagggcgtattgacaa
ccgtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcaatggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctatcggccatcgccgcatgcgtggaacctttgtg
gctccgctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB246346_P_P-C Feature FT:CDS AB246346_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcct
catatccatttgaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttctatcctaaagttaccaaatatttgcccttagataaaggcatcaaaccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggaccaatggccagcggcaaaccaggtaggagt
gggagcattcgggccagggttcactccaccacacggaaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatccgcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacttcaaccaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccactgtttccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggttttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB247916_P_P-C Feature FT:CDS AB247916_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatacggttaatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcg
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggatcattcgggccagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctcaagttccggaactgtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctcgactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctccttactcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aattgaaacaatgttttcggaaacttcctataaatagacctattgattggaaggtatgtcaaagaattgtgggtcttctg
ggctttgctgccccttttacacaatgtggttacccagcattaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
tgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacatcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccc
cttctgcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB288026_P_P-C Feature FT:CDS AB288026_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcanggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacgggggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagtctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccgaaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattggcagtccccaacctcaaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
aggttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccacaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcctcaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtt
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgtttgggaatttaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB298720_P_P-C Feature FT:CDS AB298720_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BAJT2006-1S). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgcaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
catattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaacctcactaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaaaggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaatcctaataaaactaa
acgttggggctactccctcaacttcatgggatatgtaattggaagttggggtactttaccacaggatcatattatacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctctgatgcctttatacgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcacggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctttctcgcaaatacacctccttcccatggctgctcggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaggccaccgtga
>gnl|hbvcds|AB298721_P_P-C Feature FT:CDS AB298721_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BAJT2006-1C). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgcaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
catattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaawtaattatgcctgctaggttctatcctaacctcactaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaaaggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaatcctaataaaactaa
acgttggggctactccctcaacttcatgggatatgtaattggaagttggggtactttaccacaggatcatattatacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctctgatgcctttatacgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcacggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctttctcgcaaatacacctccttcccatggctgctcggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaggccaccgtga
>gnl|hbvcds|AB299858_P_P-C Feature FT:CDS AB299858_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggaattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgtcaa
cagtgccagtagcccctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttatctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB300359_P_P-C Feature FT:CDS AB300359_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaactttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacccgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactga
aaattaagcaatgttttcgaaaactgcctgtaaataggcctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttgtatgcatgtatacaatccaagcaggcttt
cactttctcgcctacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcaccgaatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB300360_P_P-C Feature FT:CDS AB300360_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttgcaggaggacattatcaatagatgtcaacaatatgtgggccctcttacatgtaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtactatc
ctgaacatgcagttaatcattacttcaaaactaggcattacttacatactttgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccggaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggaagtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggtctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaaccttttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccttgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaggtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggatactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgttcaaa
aaatcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatacagcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactcagttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB300361_P_P-C Feature FT:CDS AB300361_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagaactcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcccgagtggcaaactccctcctttcct
aatattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aagattaattatgcctgctaggttctatcctaacctcaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagatcccagagtgagaggcctata
ttttcctgctggtggctccagttccggaacagtacaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggatcatattatacaaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctctgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctggcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctttctcgcaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB300362_P_P-C Feature FT:CDS AB300362_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttaaaagaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatncctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggaattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaagaacatattgtaatga
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaccaatatctgcacctgtaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcgtgttttgctcgcagccggtctggggcgaaccttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatccagcggacgacccgtctcggggccgcttgggcctctaccgtccc
ctacttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
gggccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB300363_P_P-C Feature FT:CDS AB300363_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient5). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
aacattcatttgaaagaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatacagttaatcattacttccaaacgaggcattatttacatactctgtggaaggctgggattttatataagaga
gaaactacacacagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcg
ttcggagccaattcaaacaatccagattgggacttcaaccccaaaaaggatcaatggccagcagcaaaccaggtaggagt
gggatcattcgggccagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gaaagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctcaagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aattgaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctg
ggctttgctgccccttttacacaatgtggttatccagcattaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB300365_P_P-C Feature FT:CDS AB300365_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient7). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctctgacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccaatagcacctcctcctgcatccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaggtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacactctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacagtatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB300368_P_P-C Feature FT:CDS AB300368_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient10). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgctagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggccggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatcttgctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgccattatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacatgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctcgcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaacgctgttgtcctctctcggaaatacacctccttcccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctttaccgtccc
cttcttcgcctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB300372_P_P-C Feature FT:CDS AB300372_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient14). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctctataagaga
gaaactacccgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcacggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggtggtcttttggggtgaagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacaatcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggcttccgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactga
aaattaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagccaagcaggcttt
cactttctcgccaacttacaaggccttactgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtt
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcgcaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcagctgccgttccgaccgaccacggggcgcacctctctttacgcggtctttttgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB300373_P_P-C Feature FT:CDS AB300373_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient15). Non-functional genomic sequence. [Hepadnaviridae] (length=2508 residues).
atgcccctgtcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattagttatgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcatcaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggcgccaactcaaacaatccagattgggacttcaacccaaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccgccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaactccacaacattccaccaagctcagctagatcctgctggtggctccaattc
cgaaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaaca
tggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcaca
ataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgca
gtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgt
cctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtt
tccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagat
tcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacc
tctattaccaattttcttttgtctttgggtatacatttgaaccctgataaaaccaaacgttggggctactcccttaactt
catgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaaacaatgttttcgaaaat
tgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaa
tgtggctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggc
ctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaa
cccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcg
gaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttattggaaccgacaactctgttgtcctctctcg
gaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgt
cggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcttctgccgttccggccg
accacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacc
tctgcacgtcgcatggaagccaccgtga
>gnl|hbvcds|AB362932_P_P-C Feature FT:CDS AB362932_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcctctactgtacctgtctttaatcctgagtggcaaactccctccttccct
aacattcatttacaggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacacagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccacctcacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtattacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactaaagcactgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttgatgcctttatatgcatgtatacactctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcggggaacctttgtg
gctcctctgccgatccataccgcagaactcctagcggcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB365451_P_P-C Feature FT:CDS AB365451_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BOL196). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaagaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtcttcaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
gaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgccttacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgactggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcttgtatacaatcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggcc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggtcatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367392_P_P-C Feature FT:CDS AB367392_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacattatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatcatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaaccattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagaga
gagactacacgaagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttagaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccacaacattccgccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagacttgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcaggtctttcccccactgtgtggctttcagttatgtggatgatgtggttttgggggcgaagtctgta
caacatcttgagtccctttttacctctattaccaattttctttcgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
agatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacccaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaaacaggcttt
cactttctcgccaacgtacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtactgccaactggatcctgcgag
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtatccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367394_P_P-C Feature FT:CDS AB367394_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 3/Adefovir-treated Pt. 8). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttcgggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggatactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccttttacacaatgtggctatcccgccttgatgcctttatatgcatgtatacaatctaaacaggcttt
cactttctcaccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagctaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367395_P_P-C Feature FT:CDS AB367395_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggacccagca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgtattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatatctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaaactctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcga
ggattggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatacgcatgtatacaagcaaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367396_P_P-C Feature FT:CDS AB367396_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 5). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggacccagca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtcggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcga
ggattggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcctgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367397_P_P-C Feature FT:CDS AB367397_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 6). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcattggaattccacaacattccaccaagctctgctagaccccagagtgcggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcacagaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaagaacatattatactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtgtgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtt
attgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgttctttcccggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367398_P_P-C Feature FT:CDS AB367398_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 7/Adefovir-treated Pt. 20). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacca
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgattactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctactaaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgcacgcagccggtctggtgcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367399_P_P-C Feature FT:CDS AB367399_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 8/Adefovir-treated Pt. 29). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
cggaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggcaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcagagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcacagaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttgctctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367401_P_P-C Feature FT:CDS AB367401_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 10/Adefovir-treated Pt. 9). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataagggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatgttgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaactccacaacattccacaaagctatgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaattggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttttcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB367402_P_P-C Feature FT:CDS AB367402_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 11). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcccaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaatatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaagggcctata
cttccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaacctacggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagttcactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
aagatggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacagtgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcacaacttattgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgcctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367403_P_P-C Feature FT:CDS AB367403_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 12/Adefovir-treated Pt. 17). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagatt
aaaattaattatgcctgctaggttttatcccaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaaaacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
aagatggggatactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacagtgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctttctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgcctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367404_P_P-C Feature FT:CDS AB367404_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 13/Adefovir-treated Pt. 22). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcccgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggatcagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcgacagtcagggagacagcctactcccatttctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acggtggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgtcgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB367406_P_P-C Feature FT:CDS AB367406_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 15/Adefovir-treated Pt. 7). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttaaaggaggacattattaatagatgtcaacaatttgtgggcccccttacagttaatgaaaaaaggagatt
aaaattaattatgcctgccaggttctatcctaaccttaccaaatacttgcccttggataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggatcagggctcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccagactctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccgggacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacttgcaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccagggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcgtgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtcattggaagttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367407_P_P-C Feature FT:CDS AB367407_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 16/Adefovir-treated Pt. 11). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttaccaaatatttgcccttggacaaaggcatcaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacccgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgttggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactga
aaattaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacagtgtggttatcctgccttaatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacgatcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB367410_P_P-C Feature FT:CDS AB367410_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 19/Adefovir-treated Pt. 19). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctctattcttcttctgtacctatttttaatcctgagtggcaaactccctcttttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcatcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggattggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtggctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggagcatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaaggattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttacccagttgcccggcaacgggcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctggcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
tgacaactcagttgtcctctctcgaaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgag
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgaacctctctttacgcggcctccccgtctgtgccttgtcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB367411_P_P-C Feature FT:CDS AB367411_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 20). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgcacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagaaagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggttttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggctatgtaattggaagttggggaactttaccacaggaacatattgtactaa
aactcaaacaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttgatgcctttatatgcatgtatacaagccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaac
tgacaattcggttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367412_P_P-C Feature FT:CDS AB367412_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 21). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctaccgtacctgtctttaatcctgagtggcaaactccctccttccct
aacattcatttacaggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacacagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccaacagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gaaagtcatcctcaggccatgcagtggaactccacaacattccaccaagctttgctagatcccagagtgaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggttttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactaaaggaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttgatgcctttatatgcctgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagcggcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgctttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367414_P_P-C Feature FT:CDS AB367414_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 23/Adefovir-treated Pt. 3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttaccaaatatttgcccttggacaaaggcattaaaacatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacccgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttatgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactga
aaattaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacagtgtggctatcctgccttaatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacgatcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367416_P_P-C Feature FT:CDS AB367416_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 25). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggaattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggatccagca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcacatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacta
cagtgccagcagcgccacctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccaaagtgaggggcctata
ttttcctgctggtggctccagttccggtacagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcga
ggattggggaccctgcgccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagaggctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtggctgcggcgttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtgtggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
gcgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtggcacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367417_P_P-C Feature FT:CDS AB367417_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 26). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcctttcct
cacattcatttacgggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagcagcacctcctcctgcctccgccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactcaacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcgccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tacaaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaatttccttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aactcaagcaatgttttagaaaattgcctgtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367418_P_P-C Feature FT:CDS AB367418_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 27/Adefovir-treated Pt. 21). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aagattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagtgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacatttcaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaacatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatttggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggcc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcgggac
tgacaactcggttgtcctctctcggaaatacacctcattcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367420_P_P-C Feature FT:CDS AB367420_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 29). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttaatatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctacccttaccaaatatttgcccttggataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaatctacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattcttccccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggatcagggttcaccccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcggggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacatttcaccaggctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagtacc
aaagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttttacctctattaccaattttctgtcttctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgaagcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaatttacaaggcctttctgcgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367421_P_P-C Feature FT:CDS AB367421_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 30). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatggtagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aatattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagatt
gaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcgttctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtctccca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaagggtcactggccagaggcaaatcaggcaggagc
gggagcattcgggccagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagagcacattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggacttccacaacattccaccaagcactgctagatcccggagtgaggggcctgta
ttatcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcccgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatagatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctttcatctttgggtatacatttgaaccctaataaaaccaa
acggtggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactaaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcgtaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367422_P_P-C Feature FT:CDS AB367422_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 31/Adefovir-treated Pt. 12). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccatcacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaaaatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctagtaaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaattaagcaatgttttcggaagctgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttactcaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcctt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggccaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgagtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB367423_P_P-C Feature FT:CDS AB367423_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 32/Adefovir-treated Pt. 28). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttacaggaggacattatcgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagact
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttgggatggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggggtctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtggggctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggcagttggggtactttaccgcaggaacatattgtacaaa
aaatcaaacaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcttttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactcagttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367424_P_P-C Feature FT:CDS AB367424_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 33). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggacccagca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcga
ggattggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactga
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagcgaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacgatcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaccttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367427_P_P-C Feature FT:CDS AB367427_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 36/Adefovir-treated Pt. 18). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaaccccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cggtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctgta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaatcaa
acgttggggttacacccttaacttcatgggttatagaattggaagttggggaactttaccacaagaacatattgtactaa
aaatcaaacaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttgatgcctttatatgcgtgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacctcatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcgtttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367430_P_P-C Feature FT:CDS AB367430_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 39/Adefovir-treated Pt. 5). Non-functional genomic sequence. [Hepadnaviridae] (length=2520 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatacagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggacttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcccctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattggcaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagccatcctcaggccacgaagtggaactccaccacattccaccaaactcggctaaatcccatagtgacccctgctgg
tggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggacc
ctgcacggaacatggagagcacaacatcaggattcctagtacccctgctcgtgttacaggcggggtttttcttgttgaca
agaatcctcacaataccgcagagtctagactcgaggtggacttctctcaattttctagggggagcacccacgtgtcctgg
ccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtc
tgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatg
ttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaagg
aacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctggg
ctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttc
gtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgag
tccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggcta
ctcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaagcaat
gttttcggaaactgcctgtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttgggctttgctgcc
ccttttacacagtgtggctatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggctttcactttttcgcc
aacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtccggtctctgccaagtgt
ttgctgacgcaacccccactggctggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccg
atccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcaaaacttatcgggactgacaactctgt
tgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttg
tctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctg
ccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgca
cttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367431_P_P-C Feature FT:CDS AB367431_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 40). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaagcttaccaaatatttgcccttagacaagggcattaaaccttattatc
cggaacatgcagttaatcattacttcaaaactagacattatttacatactctgtggaaggctggtattctatataagaga
gaaactacacacagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggacttcca
cacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagcagcgcctcctcctgccaccaccaatcggcagtcaggaagacagcccactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gttggatgtgtctgcggcgttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
ccgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcgaaaacttcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaac
tgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB367432_P_P-C Feature FT:CDS AB367432_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 41). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctatctttaatcctgattggcaaactccctcctttcct
aacattcatttacaggaggacattatagatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaacttaccaaatatttgcccttggataaaggtattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattttatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcaacaaggcatggggacgaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtgggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgctaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgaggccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacactctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggcaattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcgtgttttgctcgcagccggtctggagcgacacttatcggaac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgag
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctacgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB367434_P_P-C Feature FT:CDS AB367434_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 43/Adefovir-treated Pt. 26). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcatgtctcctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgc
ataaggtgggaaactttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcgtttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttacagcacca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggactctgtaccgaacatggagaacacagcatccggatccctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccgaaattcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctgggtatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccgaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttatctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtg
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcgaaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367435_P_P-C Feature FT:CDS AB367435_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 44/Adefovir-treated Pt. 23). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctacggtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactatgcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttcgacttcca
aacctcgacacggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtcgagccctcaggcgcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctcaga
gacagtcatcctcaggccacgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctacc
tgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactg
gggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgcgtg
tcctggccaaaattcgcagtccccaacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgatgga
tgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaa
ggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgc
tcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcat
cctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgcagggctttcccccactgtgtggctttcagttatattgatgatgtggtattgggggccaagactgtacaacat
cttgagtccctttttacctctattaccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaaacgttg
gggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaatca
agcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacactctaggcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggccaggtctctgcc
aagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaa
ctctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgt
cctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctt
catctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccg
tgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367803_P_P-C Feature FT:CDS AB367803_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 13). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaatgtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggaattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggatccagca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcacatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacta
cagtgccagcagcgccacctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccaaagtgaggggcctata
ttttcctgctggtggctccagttccggtacagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcga
ggattggggaccctgcgccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagaggctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtggctgcggcgttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtgtggctttcagttatattgatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttttacctctattacccattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
gcgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagcgaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtggcgcctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB367804_P_P-C Feature FT:CDS AB367804_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 6). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctatctttaatcctgattggcaaactccctcctttcct
aacattcatttacaggaggacattatagatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaacttaccaaatatttgcccttggataaaggtattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattttatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcatcaaggcatggggacgaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtgggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgaggccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacactctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggcaattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcgtgttttgctcgcagccggtctggagcgacacttatcggaac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgag
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctacgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB426467_P_P-C Feature FT:CDS AB426467_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggaattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgtcaa
cagtgccagtagcccctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttacctctattaccaattttcttttatctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB471848_P_P-C Feature FT:CDS AB471848_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-F). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgcgggtctgttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactcttccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB471849_P_P-C Feature FT:CDS AB471849_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-C2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgcgggtctgttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactcttccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB471850_P_P-C Feature FT:CDS AB471850_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-C1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgcgggtctgttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactcttccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB471851_P_P-C Feature FT:CDS AB471851_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2NK-F). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcctttcct
aatatacatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactta
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtctggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccatgggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcgaaactgatcgggac
tgacaactctgttgtcctctctcgcaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB471852_P_P-C Feature FT:CDS AB471852_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2S-C2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcctttcct
aatatacatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtcattggaagttggggtactttaccacaggaacatattgtactta
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtctggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccatgggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcgaaactgatcgggac
tgacaactctgttgtcctctctcgcaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB471853_P_P-C Feature FT:CDS AB471853_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2S-C3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcctttcct
aatatacatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtcattggaagttggggtactttaccacaggaacatattgtactta
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtctggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccatgggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcgaaactgatcgggac
tgacaactctgttgtcctctctcgcaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB485808_P_P-C Feature FT:CDS AB485808_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-IT). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcccctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcggcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatctcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattatattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccataggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctcgcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgactctgccgttccaaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB485809_P_P-C Feature FT:CDS AB485809_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FEP1). Non-functional genomic sequence. [Hepadnaviridae] (length=2511 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctctgacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaacttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacaagcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaggagctacagcatgggaggttcgtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcatttggtccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatgttgacga
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaactccaaagctctgctagatcccaaagtgaggggcctatattttcctgctgg
tggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggacc
ctgcaccgaacatggagagcacaacatcaggattcctaggacccctgcccgtgttacaggaggggtttttctcgttgaca
agaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctgg
ccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtc
tgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatg
ttgcccgtttgtcctctacttccaggaaacaacacggaaccatgcaaaacctgcacgactcctgctcaaggaacctctat
gacaccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaa
gattcccatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctt
tcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcccttttt
acctctataaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaa
cttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaaattaagcaatgttttcgaa
aattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttaca
caatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaa
ggcctttctgtatgcacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacg
caacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatact
gcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactccgttgtcctctc
tcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
cgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgg
ccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttc
acctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB485810_P_P-C Feature FT:CDS AB485810_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FEP2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctctgacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaacttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatacagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatcccctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcatttggtccggggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcggtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaa
aaattaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtatgcacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactccgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
gggccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB493839_P_P-C Feature FT:CDS AB493839_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 08UC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatccggagtggcaaactccttcttttcct
gacattcatttacaggaggatataatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaagcggagatt
aaaattaattatgcctgctaggttctatccaaacctcaccaaatacttaccgttagacaaaggtattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaacgaggcattatttacatacgctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaaaccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttctggggtggagccctcaggctcagggcatattgacaa
cagtgccagctgcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccactttccaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccggaacagtaaaccctgttctgactattgcctctcccatatcgtcaatcttctcgt
ggactggggaccctgcaccgaacatggagagcacaacatccggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaacgaccaccacaggaccttgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaa
acgatggggctattcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtactga
aaatcaagcattgttttcgaaaacttccggtaaaccggcctattgattggaaagtgtgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtgggtatcctgccttaatgccgttgtatgcatgtatatcagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatttgcacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctttaggccatcagcgcatgcgtggaacctttgtg
gctcctttgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatactgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgcttgggggtctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB493844_P_P-C Feature FT:CDS AB493844_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 43UC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
gacattcatttgaaggaggacattattaataggtgtcaacaatatgtgggccctcttacagttaatgaaaagcggagatt
aaaattaattatgcctgcccggttctatcctaaccttaccaagtacttgcccttagataaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacccgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaa
aacctcggaaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaaaccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccacctcacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacgttccaccaagctctgctagatcccagagtgaggggccttta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatccggattcctaggacccctgctcgtgttacaggcggtgttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
catgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacggggccttgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctata
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaactaa
acggtggggatactcccttcacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtactta
aaatcaagcagtgttttcgaaaacttcctgtaaatagacctattgattggaaggtgtgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtgggtatcctgccttaatgcctttgtatgcatgtatccaagctaagcaggcttt
cacgttctcgccaacttacaaggcctttctgtgtcaacaatatttgcacctttaccccgttgcccggcaacggtccggtc
tatgccaagtgtttgctgacgcaacccccactggctggggcttggccttaggccatcagcgcatgcgtggaacctttgtg
gctcctttgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggcac
cgacaactcagtggtcctatctcggaaatacacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccc
cttcttcgtctgccgttccggccaactacggggcgcacctctctttacgcggtctccccgtctgtgccttttcatctgcc
gacccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB640730_P_P-C Feature FT:CDS AB640730_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ehime-EPCH-HBV-C1-HN). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcct
aacatccatttacaggaggacattcttaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttttgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctattcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtcaatagacctattgattggaaaatatgtcaaagaattgtggggcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttgatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccaccggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctacgtctgccgttccggccgaccacggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB642095_P_P-C Feature FT:CDS AB642095_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2000-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttaatatcccttggactc
ataaggtgggaaactttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattrttaatagatgtcaacaatatgtgggccctcttacagttaatgaaaamaggagatt
aaaattaattatgcctgctaggttctatcctaacsttaccaaatatttgcccttggataaaggcatcaaaccttattacc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccckgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccgccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagckcctcctcctgcctccaccaatcggcagtcaggaagacakcctactcccatctctccgcctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
tttccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aacttaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgcwgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactccgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB642097_P_P-C Feature FT:CDS AB642097_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2003-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgttagtatcccttggactc
ataaggtgggaaactttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaagaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaacttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcctaactaggcattatttacatactctgtggaaggctggyattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcanggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctcwaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtat
ttcttgttgacaagaatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtktggctttcagttatatggatgatgtggtattggggrcaargtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagctggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactacctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggcctttta
ggctttgctgccccgtttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaarcaggcttt
cactttctcgccaacgtacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggmacctttgtg
gctcctctgccgatccatactgcggaactcttagcagcttgttttgctcgcagccggtctggagcaaaactgatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB642099_P_P-C Feature FT:CDS AB642099_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2005-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactttgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatctcctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctcgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcggaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB642100_P_P-C Feature FT:CDS AB642100_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2006-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggatcagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggcaatgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaattttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaatcaaacaatgttttcgcaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctcgcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcgaccaccgtga
>gnl|hbvcds|AB670237_P_P-C Feature FT:CDS AB670237_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aatattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaatyatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagctgcgcctcctcctgcctccaccaatcggcagtcaggaagacagcccactccyatctmtccacctctaaga
gacagtcatcctcaggccatgcagtggaattcaacaacattccaccaagctctgctagatcccagagtgagaggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttctggttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactyaccaacctcttgtcctccaacttgwcctggctatc
gctggatgtgtctgcrgcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgac
tcctgctcaarrcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcmtgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttctgwtgtctttgggtatacatttgaatcctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggatcatattatacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctgttg
ggctttgctgccccttttacacaatgtggctatcctgctctgatgcctttatatgcatgtatacactctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggmtggggcttggccataggccatcrgcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctgtctcgcaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670238_P_P-C Feature FT:CDS AB670238_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattratagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aagattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattagggccagggttcaccccaccacacggcggtcttttggggtggagccctcagrctcagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcacagaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccctaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccgaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggcccatgcaaggcctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aactcaaacaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacagtgtggctatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaagcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcaaaacttatcgggac
tgacaactctgttgtcctytctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttctacatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670239_P_P-C Feature FT:CDS AB670239_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggatcagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgaagtggaagtccacaacattccaccaggctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacactctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgcggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcaacacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670240_P_P-C Feature FT:CDS AB670240_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggatcagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgaagtggaagtccacaacattccaccaggctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctgttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacactctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgcggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcaacacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670241_P_P-C Feature FT:CDS AB670241_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.5). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattatcgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcatttgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacacagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcytgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgyagggctttcccccactgtttggctttcagttatatggatgatrtggtattgggggcmaagtctgta
caacatcttgagtccctttwtacctctattaccaattttcttttgtctttgggtatacatttgaaycctaataaaaccaa
acgktggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacrsa
aamtcaagcaatgttttcgraaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcckttatatgcatgtatacamtctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgcggaacctttgtg
gcttctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670242_P_P-C Feature FT:CDS AB670242_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.6). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccacgtcgcagaagaactcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactygtggtggacttctctcaattttctagggggagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaayttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
ccctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggytactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccatttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctkcc
ggrccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670243_P_P-C Feature FT:CDS AB670243_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.7). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaagttaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtaggtcttcca
aacctcgacaaggcatggggacgaatctctctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattga
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcatctaccgtccc
cttcttcgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670247_P_P-C Feature FT:CDS AB670247_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.11). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggccggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacactctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgcggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670249_P_P-C Feature FT:CDS AB670249_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.13). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaayttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgay
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtg
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcntctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670251_P_P-C Feature FT:CDS AB670251_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.15). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacatccatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccctattatc
ctgaacatatagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggaattctctataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtatacca
aacctcgacaaggcatggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcgggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatccaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggcc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaacttctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtcccggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670252_P_P-C Feature FT:CDS AB670252_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.16). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagggaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttacccttggataaaggcattaaaccttattatc
ccgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactgtccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacamggcggtsttttggggtggagccytcaggctcagggcayattgwcaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtsaggaagacagcctactsccatstctccacctctaasa
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgttgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggccaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670253_P_P-C Feature FT:CDS AB670253_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.17). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggacgc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttaaaggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctacccttaccaaatatttgcccttggataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacca
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaggctctgctagatcccaaagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggttt
ttcttgttgacaagaatcctcacaatactaaagaatctagactcgtggtggacttctctcagttttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcattttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaccatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctttcgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670254_P_P-C Feature FT:CDS AB670254_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.18). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttacccttggataaaggcattaaaccttattatc
ccgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacwa
cagtgccatcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtgattcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctcgattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670256_P_P-C Feature FT:CDS AB670256_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.20). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcgtgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacca
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgatggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaaacaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaattcctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctrcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670258_P_P-C Feature FT:CDS AB670258_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.22). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaagacattatcaatagatgtcaacaatatgtaggccctcttacagctaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaagtatttgcccttagacaaaggcataaaacctcattatc
cggaacatgcagttaatcattacttcaaaactagacactatttacatactctgtggaaggctggtattctatataagaga
gaaactacacgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaatcccaacaaggatcaatggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatgctgacaa
cagtgccagcagcgcctcctcctgccaccaccaatcggcagtcaagaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaaactctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtggctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacggt
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaaacaatgttttcgaaaacttcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtctggagcgcaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670259_P_P-C Feature FT:CDS AB670259_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.23). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttcwactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaataggtgtcagcaatatgtgggccctcttactgttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaagtatttgcccctggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcawacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcasgtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatactgacta
cwgtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcaccgsatctccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccttgcacagaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacc
caagtgtcttggccaaagttcgcagtccccaacctgcaatcactcaccaacctcttgtcctccgacttgtcctggctatc
gctggatgtgtctgcggcgttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaactaa
acgttggggctactcccttaacttcatgggatatgtcattggaagttggggtactctaccacaggaacatattgtactaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccatttacacaatgtggttatcctgccttgatgcctttatatgcatgtattcaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcacggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctctttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtccagtcggcgctgaatcccgcggacgacccgtctcggggccgtttgaacatctaccgtccc
cttctgcgtctgcccttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670260_P_P-C Feature FT:CDS AB670260_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.24). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagatgtcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccatgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcaatggttcgcagggctttcccccactgtttggctttcaggtatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacgga
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccttttacacaatgtgggtatcccgccttgatgcctttatatgcatgtatacaatctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagctaaacttatcgggac
tgacaactctgttgttctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670261_P_P-C Feature FT:CDS AB670261_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.25). Complete genome. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctacggtacctgtctttaatcctgattggcaaactccctcctttcct
catattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattacc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacatcaaacctcgacaaggcatgg
ggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaac
aatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggccagg
gttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgaccacagtgccagcagcgcctc
ctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcc
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcaccaatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcact
taacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtgcaaaaaatcaagcaatgtttta
gaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgcccctttt
acacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaactta
caaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctg
acgcaacccccactggatggggcttggctattggacattgccgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagcagcttgttttgctcgcagcaggtctggagcaaaacttatcggaactgacaactctgttgtcct
ctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacg
tcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttc
cgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670262_P_P-C Feature FT:CDS AB670262_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.26). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactcccaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaacctcaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtgggaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaatcccaacaaggatcactggccggaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacaatgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagaaagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactcaacaacattccaccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcaaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggatttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcctgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaatcttatcggaac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtactgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670263_P_P-C Feature FT:CDS AB670263_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.27). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattgatmgatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccatcacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcatctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgcctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatattcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccatgggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcatctaccgtccc
cttctacrtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670264_P_P-C Feature FT:CDS AB670264_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.28). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgcgggccctcttacagctaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttcaaaaccaggcattatttacatactttgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagcggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcactaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttatctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaacttcatgggatatgtaattggcagttggggtactctaccgcaggaacatattgtacaaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactccgttgtcctctctcggaaatacacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccc
cttctacgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670265_P_P-C Feature FT:CDS AB670265_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.29). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaactgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattgatagatgtcaaaaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctaccctaaccttaccaaatatttgcccttggataaaggcattaagccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgaagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccgaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccgaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagctggggcactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcgaaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
ctccttcgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670266_P_P-C Feature FT:CDS AB670266_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.30). Complete genome. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatgg
ggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaac
aatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagg
gttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctc
ctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcc
atgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctatatyttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccct
taacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaactcaagcaatgttttc
ggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttt
acacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaactta
caaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctg
acgcaacccccactggatggggcttggccataggccatcggcgcgtgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcct
ctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacg
tcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctcttccgtccccttcttcatctgccgttc
cggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670267_P_P-C Feature FT:CDS AB670267_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.31). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacacagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggtccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctccgggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcgccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcargacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgcggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatccttcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670268_P_P-C Feature FT:CDS AB670268_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.32). Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcmacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttaatatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccacacttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacccgcagcgcatcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcggaccagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagacaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccatcaagctctgctagaccccagagtgagtgctggtgg
ctccagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctg
caccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaccacccgcgtgtcgtggcca
aaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttg
cccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaac
ctctatgtttccctcttgttgttgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctt
tcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgta
gggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtccaacatcttgagtcc
ctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccagacgttggggctactc
ccttaacttcatgggatatgtaattggaagttggggtactttaccacaagaacatattgtactgaaaattaagcaatgtt
ttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgcccct
tttacacaatgtggctatcctgccttgaagcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaac
ttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttg
ctgacgcaacccccactggatggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagcagcttgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgt
cctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtct
acgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccg
ttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670269_P_P-C Feature FT:CDS AB670269_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.33). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcct
cacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctctcacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacacgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacccgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagccatcctcaggccatgcaatggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttwtacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactga
aaattaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
tgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670270_P_P-C Feature FT:CDS AB670270_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.34). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggtcctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataagggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggaccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctata
tgttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctattaccaattttcttatgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgccaggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgtttgggactctatcgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670272_P_P-C Feature FT:CDS AB670272_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.36). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaactgttagtattccttggactc
ataaggtgggaaactttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttaaaggaggacattattgatatatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaacttaccaaatatttgcccttggataaaggaattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gagactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcacagaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatcgatgatgtggttttgggggccaagactgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactacctgtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctg
ggctttgctgccccttttacacaatgtggttatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggcaataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670273_P_P-C Feature FT:CDS AB670273_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.37). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaactttaccaaatatttgcccttggataaaggcattaaaccgtattatc
ctgacaatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattttatataagaga
gaaactacacggagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcatttggaccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatgttgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgaagtggaactccacaacattccaccaggttctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaay
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaccatattgtacaaa
aaattaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatacatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670274_P_P-C Feature FT:CDS AB670274_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactrttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcmgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgttartatcccttggactc
ataaggtgggaaactttactggrctttattcttctactgtacctgtctttaatccggagtggcaaactccctcttttcct
aatattcatttacaggaggacattcttgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactagacattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacacagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattaacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtcagcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatatggtattgggggcaaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgktggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacwma
aaatcaagcaatgttttcgraaaytgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcckttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagccggtctggrgcaaamcttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670275_P_P-C Feature FT:CDS AB670275_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtrggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgagaggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcacyaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttttctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtccggcc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccatcggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccttcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670276_P_P-C Feature FT:CDS AB670276_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattactagatgtcaacaatatgtgggtcctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggtattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaa
ccgtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggmagttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgacaactgcctgtaaatagacctatcgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatccaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggcc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaacttctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670277_P_P-C Feature FT:CDS AB670277_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacaactaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatacttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacca
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaccctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattga
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgccaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatccactctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcrgcgcatgcgcggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcctctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670278_P_P-C Feature FT:CDS AB670278_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.5). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaacattaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaatatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagcgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccacaacattcctccaaactctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
tccttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttaggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccayactgcggaactcctagcagcttgttttgctcgcagctggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgatgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaraccaccgtga
>gnl|hbvcds|AB670279_P_P-C Feature FT:CDS AB670279_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.6). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aatattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aagattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggagatcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagctgcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctacgcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgagaggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgac
tgctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaggccctttttacctctattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaa
acgttggggctactcccttaacttcatgggatacgtaattggaagttggggtactttaccacaggatcatattatacaaa
aactcaagcaatgttttcggaaactccctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctctgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccmacttamaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgcggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatccttcgcg
ggacgtcatttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaycgtccc
cttcttcrtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670281_P_P-C Feature FT:CDS AB670281_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.8). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttsgtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggagcagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagt
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtatmaacaatatctgcacctttaccccgttgccaggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttataggcac
cgacaactccgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670282_P_P-C Feature FT:CDS AB670282_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.9). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacccgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tactgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactga
aaattaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcaccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgattcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670283_P_P-C Feature FT:CDS AB670283_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.10). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggccggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670285_P_P-C Feature FT:CDS AB670285_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.12). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttytatccaaaccttaccaaatatttgcccttggataaaggtattaaaccttattatc
ctgaacatgtagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacccgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcgccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgstgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaactttatgggatatgtaattggaagttggggtacgttaccacaggaacatattgtacaaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgtcaacttacaaggcctttttgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggagctcctagcagcttgttttgctcgcagccggtctggagcaacccttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670287_P_P-C Feature FT:CDS AB670287_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.14). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatacagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcggaaactacctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctcttg
ggctttgccgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctctcccatttacaaggcctttctgtgtaaacaatatctgtacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctggcagcttgttttgctcgcagccggtctggagcgaaactcattgggac
tgacaactctgttgtcctctctcggaaatacacctctttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtccc
cttctgcgtctaccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670288_P_P-C Feature FT:CDS AB670288_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.15). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtataccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
tttccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aastcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcgcaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670289_P_P-C Feature FT:CDS AB670289_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.16). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattactagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggtattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaa
ccgtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccasyaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaagantcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgacaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatccaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaacttctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670290_P_P-C Feature FT:CDS AB670290_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.17). Complete genome. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggagaaaggcattaaaacttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcaccaaacctcgacaaggca
tggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactca
aacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggcc
agggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgc
ttcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcag
gccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattatcctgctggtgg
ctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctg
caccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggcca
aaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactaccaaggtatgttg
cccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaac
ctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctt
tcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgca
gggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcc
ctttatacctccattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggctactc
ccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaactcaagcaatgtt
ttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccc
tttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaac
ttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttg
ctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgt
cctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtct
acgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccg
ttccggccgaccacggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670291_P_P-C Feature FT:CDS AB670291_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.18). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aatattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagaggctagactcgtggttgacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtctgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattacccattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccgacaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670292_P_P-C Feature FT:CDS AB670292_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.19). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctaccgtgcctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccctattatc
ctgaacatacagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aactaaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttttgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggtatccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagacccccgtga
>gnl|hbvcds|AB670294_P_P-C Feature FT:CDS AB670294_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.21). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatccaaaccttaccaaatatttgcccttggataaaggtattaaaccttattatc
ctgaacatgtagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacccgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcccctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacgga
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctcttg
ggctttgccgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctctcccatttacaaggcctttctgtgtaaacaatatctgtacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctggcagcttgttttgctcgcagccggtctggagcgaaactcattgggac
tgacaactctgttgtcctctctcggaaatacacctctttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtccc
cttctgcgtctaccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670295_P_P-C Feature FT:CDS AB670295_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.22). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttgcaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaacttaccaaatatttgcccttggataaaggcattaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctcaga
gacagtcatcctctggccgtgtgttggaacaccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagtacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctrttaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactacctgtaaatagacctattgattggaaagtatgtcaacgcattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctggcagcttgttttgctcgcagccggtctggagcaaaactgatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670297_P_P-C Feature FT:CDS AB670297_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.24). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaatatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccckgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggtccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctccgggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgccttacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctattcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggagcatattgtacaaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtac
tgacaactccgttgtcctctctcggaaatatacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670298_P_P-C Feature FT:CDS AB670298_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.25). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
atagggtgggaaactttactgggctttattcttctactgtccctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattcttccccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaatcccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactcgacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgcgttacaggcgggattt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgaa
tcctgccaacggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggttttgggggcgaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggcatacatttgaaccctaataaaaccaa
acgttggggctacacccttaacttcatgggatatgaaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacambctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctcgcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtactctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcatctatcgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtagaatggagaccaccgtga
>gnl|hbvcds|AB670300_P_P-C Feature FT:CDS AB670300_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.27). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattgatagatgtcaaaactatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaagccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccgaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccgaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtcttaa
aactcaagcaatgttttcggaaattgcctgtcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtctggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcctgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgcctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670301_P_P-C Feature FT:CDS AB670301_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.28). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gcttgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcgtgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctcttccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670302_P_P-C Feature FT:CDS AB670302_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.29). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aatattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacacagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtaaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acggtggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactaaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgccgttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactccgttgtcctctctcgtaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670304_P_P-C Feature FT:CDS AB670304_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.31). Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaaattaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacccgcagcgcatcattttgtgggtcaccatattcttgggaacgagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaactccacaacattccaccaagctctgctagaccccagagtgagtgctggtgg
ctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctg
caccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaa
atcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggcca
aaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttg
cccgtttgtcctctacttccaggaacatcractaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaac
ctctatgtttccctcttgttgttgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctt
tcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgta
gggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcc
ctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactc
ccttaacttcatgggatatgtaattggaagttggggtactttaccacaagaacatattgtactgaaaattaagcaatgtt
ttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgcccct
tttacacaatgtggctatccggccttaaagcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaac
ttacaaggcctttctgtgtaaacaatatctaaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttg
ctgacgcaacccccactggatggggcttggctcttggccatcggcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgt
cctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtat
acgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccg
ttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670305_P_P-C Feature FT:CDS AB670305_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.32). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatccaaaccttaccaaatatttgcccttggataaaggtattaaaccttattatc
ctgaacatgtagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacccgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcgccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaactttatgggatatgtaattggaagttggggtacgttaccacaggaacatattgtacaaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgtcaacttacaaggcctttttgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggagctcctagcagcttgttttgctcgcagccggtctggagcaacccttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccntctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670306_P_P-C Feature FT:CDS AB670306_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.33). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactrttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttaatatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatccggagtggcaaactccctcttttcct
aatattcatttacaggaggacattcttgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttytatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gcaggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacccaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtccggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670307_P_P-C Feature FT:CDS AB670307_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.34). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacccgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctagacaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgtctcacccacatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactga
aaattaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacatcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670309_P_P-C Feature FT:CDS AB670309_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.36). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaacaccctcctttcct
aacattcatttacaggaagacattattgatagatgtcaacaatacgtgggccctcttacagttaatgaaaaaaggagatt
aagattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtattttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaaccggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacatttcaccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcactgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctactgccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtgattcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgca
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggcttcgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcttagcagcttgttttgctcgcagccggtctggagcgaaactcatcgggac
tgacaactcggttgtcctctctcggaaatacacctcattcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB670310_P_P-C Feature FT:CDS AB670310_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.37). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaacttgtattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattctgctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgaagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatcctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcggaaactacctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcgaaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB670311_P_P-C Feature FT:CDS AB670311_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.38). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
caaattcatttacaggaggacattattaatagatgtcaacaatacgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctcttctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttgcctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccacaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtaggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgcatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgtcgtcctctctcggaaatacaccgcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
ctccttcagctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB675674_P_P-C Feature FT:CDS AB675674_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A33). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacac
ataaggtgggaaactttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagatt
aaaattaataatgcctgctaggttttaccctaactttaccaaatacttgccattagataaaggcattaaaccttattatc
ctgaacatgtagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattttatataagaga
gaaactacacgcagcgcctcattttgcggttcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagc
gggagcattcgggccggggttcaccccaccacacggcagtcttttggggtggggccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactcaacaactttccaccaagctctgctagatcccagagtaaggggccttta
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcaacaactaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaccctctatgtttccctcttgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccacttttcttttgtctttgggtatacatttaaatcccaataaaacaaa
gcgttggggctattcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtactaa
aaatcaaacaatgttttcgaaaacttcctgtaaataggcctattgattggaaagtctgtcaaagaattgtgggtctgttg
ggctttgctgccccatttacacaatgtggttatcctgccttaatgcctttgtatgcatgtatacaatctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtac
tgacaactccgttgtcctctctcggaaatacacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttggggctctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB675675_P_P-C Feature FT:CDS AB675675_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A34). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacac
ataaggtgggaaactttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagatt
aaaattaataatgcctgctaggttttaccctaactttaccaaatacttgccattagataaaggcattaaaccttattatc
ctgaacatgtagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattttatataagaga
gaaactacacgcagcgcctcattttgcggttcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagc
gggagcattcgggccggggttcaccccaccacacggcagtcttttggggtggggccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactcaacaactttccaccaagctctgctagatcccagagtaaggggccttta
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcaacaactaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaccctctatgtttccctcttgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctgttaccacttttcttttgtctttgggtatacatttaaatcccaataaaacaaa
gcgttggggctattcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtactaa
aaatcaaacaatgttttcgaaaacttcctgtaaataggcctattgattggaaagtctgtcaaagaattgtgggtctgttg
ggctttgctgccccatttacacaatgtggttatcctgccttaatgcctttgtatgcatgtatacaatctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtac
tgacaactccgttgtcctctctcggaaatacacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttggggctctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB675677_P_P-C Feature FT:CDS AB675677_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A39). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctcttctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaca
aaatcaaacaagcttttcgaaaattgcctgtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaatctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccattggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgtcgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtccc
cttcttcacctgccgttccggccgaccacggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB697490_P_P-C Feature FT:CDS AB697490_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No5). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttaccgttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaa
cagtgccagcggcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaaactctgctcgatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acggtggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtaatga
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcgtgttttgctcgcagccggtctggggcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB697494_P_P-C Feature FT:CDS AB697494_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No9). Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcctttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcaccaaaccttgacaaggca
tggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactca
aacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggcc
agggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgaaaacagtgccagcagcgc
ctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcag
gccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtaaagggcctatattttcctgctggtgg
ctccagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggggaccttg
caccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggcca
aaatttgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttg
cccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaac
ctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctt
tcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgca
gggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcc
ctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactc
ccttaacttcatgggatatgtaattggcagttggggtactttaccacaggaacatattatacaaaaacttaagcaatgtt
ttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccct
tttacacaatgtggctatcctgccttgatgcctttgtatgcatgtatacaagcgaagcaggctttcactttctcgccaac
ttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttg
ctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaaccttcgtggctcctctgccgatc
catactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgt
cctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtct
acgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccg
ttccggccgaccacggggcgtacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB697500_P_P-C Feature FT:CDS AB697500_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No17). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcagcaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttacctttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcatttgggccagggttcaccccacctcacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggcagttggggtactttaccacaggaacatattatacaaa
aacttaagcaatgttttcggaaattgcctgtaaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcacggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacctcatcgggac
tgacaattctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB697502_P_P-C Feature FT:CDS AB697502_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No20). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaacgaggtaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctaccgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttaaaggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttaccaaatatttgcccttggacaaaggcatcaaaccatattatc
ctgaacatgtagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatatcagaga
gaaacttcccgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgtkgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaaccttttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taycaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtgtggctttcagttatatggatgatgtggtkatkggggccaagactgta
caccatcttgastccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactga
aaattaagcaatgttttcgaaagctgcctgtaaataggcctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggwtggggcttggctattggccatcgccgcgagcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtctggagcgaacmttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgcc
ggaccgtgtgcacttcgcttcacctctgtacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB697510_P_P-C Feature FT:CDS AB697510_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No33). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttcttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctaggggatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcacatcaggtagaagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatgttgacat
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggcagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccatcaaactctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaatagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaaa
aactcaaacaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgccaacgaattgtgggtctttta
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtattcaatctaagcaggcttt
cactttctcgccaacttacaaggcctttttgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcctgttttgctcgcagctggtctggagcgaaacttatcggaac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcy
gggccgtgtgcacttcgcttcacctctgcacgtcgaatggcgaccaccgtga
>gnl|hbvcds|AB900099_P_P-C Feature FT:CDS AB900099_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtgaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggtattaaaccctattatc
ctgaacaggcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcaggcattctatataagaga
gaaactacacgcagtgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccckgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaa
ccgtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaagggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagtacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcactaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggatactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctatcggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcagacgacccgtctcggggccgtttgggactcttccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB900109_P_P-C Feature FT:CDS AB900109_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccatcctttcct
cacattcatttgcaggaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgccagattctatcctaaccttaccaaatatttgcccttagacaagggcattaaaccttattatc
cggaacatgcaattaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggtattctatataagaga
gaaactacacgcagcgcctcattytgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
cacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaccaaggatcaatggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcagactcaaggcatactgacaa
cagtgccagcagcacctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaaytccacaacattccaccaagctctgctagatcccagagtgaggggcctgta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
cgcgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gttggatgtgtctgcggcgttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttayaccgctattaccaattttcttttgtctctgggtatacatttgaaccctaataaaaccaa
acgttggggttattcccttaactttatggggtatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aactcaaacaatgttttcgaaaacttcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcccgccttaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcatctatcgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB900113_P_P-C Feature FT:CDS AB900113_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgcttttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggatattatcaatagatgtcaacaatatgtaggccctcttacagctaatgaaaaaaggagatt
aaaattaattatgcctgctagattctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatc
cggaacatgtagttaatcattacttcaaaactaggcattatttacatactctgtggaaagctggtattttatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacttcca
cacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggca
ttcggagccaactcacacaatccagattgggacttcaacccaaccaaggatcaatggccagaggcacatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaa
cagtgccaacagcacctcctcctgccacaaccaatcggcagtcaggaagacagcccactcccatctctccacctctacga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacggagtctagactcgtggtggacttctctcagttttctagggggagcacc
cacgtgtcctggccaaaattcgcagtgcccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcattttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaacgaccagtacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggttattcccttaactttatgggatatgtcattggaagttggggtactttaccacaagaacatattgtactaa
aaatcaaacaatgttttcgaaaacttcctgtaaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttg
ggctttgctgcaccttttacacaatgtggctatcccgccttaatgcctttgtatgcctgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttctg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccc
cttctacatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB900115_P_P-C Feature FT:CDS AB900115_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattgatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaacatgaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcgatcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccatcaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactcaaacaatgctttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccgtttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacagtctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccacgggctggggcttggcaataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcgcaaatacacctccttcccatggctgctcggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgatgaatcccgcggacgacccgtcgcggggccgtttgggcctctatcgtccc
cttcttcagctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB900116_P_P-C Feature FT:CDS AB900116_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatc
ctgaaaatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcggatcagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaagaccatattgttcaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttt
cattttctcgccaacttacaaggcctttctgtgtaaacaatatctaaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttttcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB931170_P_P-C Feature FT:CDS AB931170_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2P_HB11-0921). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcct
cacattcatttgaaggaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaacaaggagatt
aaaattaattatgcctgccagattctatcctaaacttaccaaatatttgcccttagacaaaggcattaaaccttattatc
cggaacatgtagttaatcattacttcaaaactaggcactatttacatactctgtggaaggctggtattctatataagaga
gaaactacacgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcctggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaccaaggatcaatggccagaggcaaatcaggtaggagt
gggagcattcggtccagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcaaactgacat
caatgccagcagcacctcctcctgccaccaccaatcggcagttaggaagacggcctactcccatcactccacctctaaga
gacagtcatcctcaggccatgcagtggaactcctcaacattccaccaagctctgctagatcccagagtgaggggcctgta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggac
tggaaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgat
tcctgctcaagggacctctatgtttccctcttgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggttattcccttcactttatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactcaaacaatgttttcgaaaacttcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcccgccttaaagcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttctg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaacactcatcggcac
cgacaactcggttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtccc
cttctacatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB931171_P_P-C Feature FT:CDS AB931171_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2S_HB11-0922). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcct
cacattcatttgaaggaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaacaaggagatt
aaaattaattatgcctgccagattctatcctaaacttaccaaatatttgcccttagacaaaggcattaaaccttattatc
cggaacatgtagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagaga
gaaactacacgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcctggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaccaaggatcaatggccagaggcaaatcaggtaggagt
gggagcattcggtccagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcaaactgacat
caatgccagcagcacctcctcctgccaccaccaatcggcagtcaggaagacggcctactcccatcactccacctctaaga
gacagtcatcctcaggccatgcagtggaactcctcaacattccaccaagctctgctagatcccagagtgaggggcctgta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgtcaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgat
tcctgctcaagggacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggttattcccttcactttatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactcaaacaatgttttcgaaaacttcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcccgccttaaagcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttctg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaac
cgacaactcggttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtccc
cttctacatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB971714_P_P-C Feature FT:CDS AB971714_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB11-1026). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcccgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacggttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttactaaatatttgccattagacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatcctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaggacctgcacgac
tcttgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattacccattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aaatcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttattggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtccgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB971715_P_P-C Feature FT:CDS AB971715_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB11-1027). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcccgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacggttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttactaaatatttgccattagacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatcctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaggacctgcacgac
tcttgttcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattacccattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aaatcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttattggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtccgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF068756_P_P-C Feature FT:CDS AF068756_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggacattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaacctcaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatacggttaatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcg
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggatcattcgggccagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatccacaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctcaagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctattcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaaa
aattgaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctg
ggctttgctgccccttttacacaatgtggttacccagcattaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggctataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccttcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF182802_P_P-C Feature FT:CDS AF182802_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacaaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttaccaaatacttgcctttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacacagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccaggggtcaccccaccacacggcggtcttttggggcggagccctcaggctcagggcacattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctcaga
gacagtcatcctcaggccatgcagtggaactctacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatgcagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggttt
tccttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tacaaaggtatgttgcccgtttgtcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcccgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcaatccgtttctcctggctcagtttactagttccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaatttcctgttgtctttgggcatacatttgaaccctaacaaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacacattgtactaa
aaattaagcactgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccctaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacagggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctttctctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF182803_P_P-C Feature FT:CDS AF182803_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacacagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccaggggtcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcgtcttcttgttggttcttctggac
taccgaggtatgttgcccgtttgtcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcaatccgtttctcctggctcagtttactagtgccattt
gttcagtgggtcgtaaggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaatttcctgttgtctttgggcatacatttgaaccctaacaaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacacattgtactaa
aaattaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgcagccccttttacacaatgtggctatcctgccctaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctctctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgtcaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtggtgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctttctctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF182804_P_P-C Feature FT:CDS AF182804_P_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcccaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacacagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccaggggtcaccccaccacacggcggccttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcagggtgacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcaatggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattctctagggggagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaatttcctgttgtctttgggcatacatttgaaccctaacaaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacacattgtactca
aaattaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccctaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctgtctctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF223954_P_P-C Feature FT:CDS AF223954_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatccggactggaaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggatctttcggaccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgttagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctattaccaattttcttttgtctttgggtatacatttaaatcctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctg
ggctttgccgctccctttacacaatgtggatacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF223955_P_P-C Feature FT:CDS AF223955_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcct
cacattcatttaaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaa
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagctgcaaatcaggtaggagt
gggatcattcgggccggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtcattggaagttggggtaccttgccacaggaacatattgtacaaa
aaatcaaacaatgttttagaaaactgcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggttttgccgctccctttacacaatgtggatacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggac
cgacaactctgtcgtcctctctcggaaatacacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF223956_P_P-C Feature FT:CDS AF223956_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea3). Complete genome. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcct
cacattcatttaaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttctatcccaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatgg
ggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattcaaac
aatccagattgggacttcaaccccaacaaggatcaatggccagctgcaaatcaggtaggagtgggatcattcgggccggg
gttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctc
ctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcc
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactccct
taactttatgggatatgtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgtttta
gaaaactgcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctcccttt
acacaatgtggatacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaactta
caaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctg
acgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggaccgacaactctgtcgtcct
ctctcggaaatacacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacg
tcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttc
cggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF223957_P_P-C Feature FT:CDS AF223957_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctcactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattggttatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagt
gggatcattcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaatcctaccaaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctgttaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagctaaccttctcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF223958_P_P-C Feature FT:CDS AF223958_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea5). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattattaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcagtggccagcggcacatcaggtaggagt
gggatccttcgggccagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcactgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctctgggtatacatttaaaccctactaaaactaa
acgttggggctactcccttcacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaattaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttctcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF223959_P_P-C Feature FT:CDS AF223959_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea6). Complete genome. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcct
cacattcatttaaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatgg
ggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattcaaac
aatccagattgggacttcaaccccaacaaggatcaatggccagctgcaaatcaggtaggagtgggatcattcgggccggg
gttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctc
ctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcc
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactccct
taactttatgggatatgtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgtttta
gaaaactgcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctcccttt
acacaatgtggatacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaactta
caaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctg
acgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggaccgacaactctgtcgtcct
ctctcggaaatacacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacg
tcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttc
cggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF223960_P_P-C Feature FT:CDS AF223960_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea7). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggsaatctcaatgttagtataccttggactc
ataaggtgggaaactttactgggctttattcttctactgcacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatatcatcaatagatgtcaacaatatgtaggccctcttaccgttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcacaccaggtaggagt
gggatctttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
cgttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtgtgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctactaaaactaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggttccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttctcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF223961_P_P-C Feature FT:CDS AF223961_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea8). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaaccctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattattaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctgctaaaactaa
acgttggggctactcccttcacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcgcaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF241410_P_P-C Feature FT:CDS AF241410_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 3270). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaattctgagtggcaaactccctcttttcct
gatatacatttacaggaggacattattaatagatgtcaacaatttgtgggccctcttaatgtaaatgaaaaaagaagatt
aaaattagttatgcctgctagattttttcctaaccttaccaaatatttacccttagataaaggtattaaaccttattatc
ctgaacatatagttaatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcaa
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgct
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcaactcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacatttcatcaagctctgctagatcccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgtaccgaaaatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctaattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgac
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccttttttacctctgttaccaattttcttctgtctttgggtatacatttgaaccctcataaaaccaa
gcgttggggctactccctaaacttcatgggatatgtaattgggagttggggtaccttaccacaggaacatattgtactga
agatcaagaagtgttttcgaaaacttcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttattacctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgccaggcaacggtcaggtc
tctgccaagtgtttgctgatgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaac
cgacaactctgttgtcctctctcgcaaatacacctcgtttccatggctgctcggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF241411_P_P-C Feature FT:CDS AF241411_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8290). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcttctactgttcctgtctttaatcctgagtggcaaactccctcttttcct
gatatacatttgcaggaggacatcattaatagatgtcaacaatttgtgggccctcttaatgtaaatgaaaaaaggagatt
aaagttaattatgcctgctagattttttcctaaccttaccaaatatttgcccttagataaaggtattaaaccttattatc
ctgaacatatagttaatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgggggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcaa
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgct
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
ccgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacatttcatcaagctctgctagatcccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgtaccgaaaatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctaattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgac
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacmtctwgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
gcgttggggctactccctaaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtactaa
aaatcaagcagtgttttcgaaaacttcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttactccctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggtcatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcctgttttgctcgcagccggtctggagcaaaactcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcatttccatggctgctcggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgcttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF286594_P_P-C Feature FT:CDS AF286594_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagacggaatcaaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttctgtctttgggtatacatttaaaccctaataaaaccaa
gcgttggggctactcccttaacttcatgggatatgtaattggaagctggggtactttaccacaggaacatattgtactaa
agctcaaggaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttt
cactttttcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcgtgttttgctcgcagcaggtctggagcaacacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF363961_P_P-C Feature FT:CDS AF363961_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctacggtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccctcggacaaaggcattaaaccctattatc
cggaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcacatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtggcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggcttccgcaagattcctatgggagttggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcctgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcgcaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF384371_P_P-C Feature FT:CDS AF384371_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G376-7). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaagaaggagatt
aaaattaattatgcctgctagattttatcctaacattaccaaatatttgcccttggacaaaggcattaaaccctattatc
ctgaacatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cggtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctatcaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtg
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcttctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF411408_P_P-C Feature FT:CDS AF411408_P_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcagatcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcaaggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaacaaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttagaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcacggcaacgttcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
tgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggcccaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AF411410_P_P-C Feature FT:CDS AF411410_P_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=2505 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggcgggcattttatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaacccagattgggacttcaaccccaacaaggctcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcttattgacac
cagtgccagtgccacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctacctgctggtggctccagttccgg
aacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatgg
agaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaata
ccacagagtctagactcgtggtggacttctctcaattttctaaggggagcacccaagtgtcctggccaaaattcgcagtc
cccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatca
tattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcct
ctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttcc
ctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccaccaccctgggctttcgcaagattcc
tatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttccccc
actgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctct
attaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcat
gggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgcaaactgc
ctgtcaatagacctatcgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgt
ggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaagacctt
tctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccc
ccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaa
ctcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaa
atacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcgg
cgctgaatcccgcggacgacccgtcgcggggccgtttggggctctaccgtccccttcttcgtctgccgttccacccgacc
acggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctct
gcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AF411411_P_P-C Feature FT:CDS AF411411_P_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcagatcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcaaggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaacaaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttagaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcacggcaacgttcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
tgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggcccaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AF411412_P_P-C Feature FT:CDS AF411412_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaattccctcctttcct
aatattcatttacaggaggacattatcaatagatgcgaacaatatgtgggccctcttacagtgaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggtattaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattcttccccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcatttgggccagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcaaggcatattgacaa
cagtgccagtagcaccacctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccacaacattccaccaagctctgttagaccccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatccttcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactttcccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF458664_P_P-C Feature FT:CDS AF458664_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C84). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccgggaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggataaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtcaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacttccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagccggtctggagcgaaacttgtcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF458665_P_P-C Feature FT:CDS AF458665_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C733). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgactttaatcctgagtggcaaactccctcctttcct
cacattcatttaaaggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttgatcattacttcaaaacctggcattatttacatactctgtggaaggctggcattctatataagaga
ggaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggccggtcttcca
aacctcgacaaggcatggggacagatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcatattgtcaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gaaagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacaacaggattcctaggacccctgctcgtgttacaggcggggttt
tccttgttgacaagaatcctcacaatacctcagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggtgttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggatgttggggtactttacctcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactacctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggcaattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaaattatcgggac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
gaacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF461357_P_P-C Feature FT:CDS AF461357_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH5). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatccagagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccatgtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaa
aacttaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaagtacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF461358_P_P-C Feature FT:CDS AF461358_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH8). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttccg
cacactcatttacaagaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaaaaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcgcgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttttcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccacaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgctaggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggacatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgcctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF461359_P_P-C Feature FT:CDS AF461359_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate c16). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttccg
cacactcatttacaagaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaaaaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcgcgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaatttcatgggatatgtaattggaagttggggtactttaccacaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgaggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggacatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF461363_P_P-C Feature FT:CDS AF461363_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C8). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatccagagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccatgtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaa
aacttaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaagtacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF473543_P_P-C Feature FT:CDS AF473543_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2e). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcccgactggcaaactccctcttttcct
cacattcatttgaaagaggatattattaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgataatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggactccaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacgggaccctgcaagacctgcacaat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaca
aaatcaaacactgttttcgaaaacttcctataaatcgacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgcggctcccttcacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctaaacctttaccccgttgctaggcaacggccaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacattctcggcac
cgacaactctgttgtcctttctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AF533983_P_P-C Feature FT:CDS AF533983_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgtagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaagtatttgcccttggataaaggcattaaaccttattatc
ctgaacatgtagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctgggattctatataagaga
gagactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcatactgacaa
cagtgccagtggcacctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatctcttcacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactgggggccctgccccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacagtaccacagagtctagactcgcggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggacgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aacttaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccctgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcgtgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaagtacacttcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AJ748098_P_P-C Feature FT:CDS AJ748098_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient Z1). Complete genome. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggctaactccctcttttcct
aacattcatttgaaagaggatattatcaatagatgtcaacaatatgtgggccccctcacagttaacgaaaaaaggagatt
aaaattgatattgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatgg
ggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggaccctgcattcagagccaattcaaac
aatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggccagg
gttcactccaccacacggcaatcttctggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctc
ctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcc
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcacctcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctgctaaaaccaaacgttggggctactccct
tcacttcatgggatatgtaattggaagttggggtacattaccacaggaacatattgtacacaaaatcaaacaatgttttc
ggaaacttcctataaatagacctattgattggaaagtatgtcaacgaatcgtggggcttctgggcttcgccgctcccttt
acacaatgtggttacccagcattaatgcctttgtatgcatgtatacaggctaagcaggctttcactttctcgccaactta
caaggcctttctgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctg
acgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacattctcggcaccgacaactctgtggtcct
ctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacg
tcccgtcagcgctgaatcccgcggacgacccgtcgcggggccgtttgggactctaccgtccccttcttcgtctgccgttc
cggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011097_P_P-C Feature FT:CDS AP011097_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgcacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccgtacaaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactacccgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaacccttctaaaactaa
acgttggggctactcccttaatttcatgggatatgtcattggaagttggggtaccttaccacaggaacatattgtacaca
aaattaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcaccaacttacaaggcctttctgtataaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttctcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccctcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
gggccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AP011098_P_P-C Feature FT:CDS AP011098_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcacagaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacgga
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011099_P_P-C Feature FT:CDS AP011099_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacac
ataaggtgggaaactttactgggctttattcttctaatgtacctgtctttaaccctgagtggcaaactccctcttttcct
gatatacatttgcaggaggacattattaatagatgtcaacaatttgtgggcccgcttactgtaaacgaaaaaaggagact
aaagttaattatgcctgctagattttttcctaaccttaccaaatatttgcccttagataaaggcattaaaccctattatc
ctgaacatatagttaatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattcttgccagaccatcagttggacccggct
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcttggcaggtaggagc
tggagcattcgggccagggttcaccccaccacacggcggccttttggggtggagcccgcaggctcagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacatttcatcaagctctgctagatcccagagtaagaggcctata
cttccctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgac
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttaaacccgcacaaaaccaa
gcgttggggctactcccttaatttcatgggatatgtaattggaagttggggtaccttaccacaggatcatattgtactaa
aaatcaagcaatgttttcgaaaactccctgttaatcgaccgatagattggaaagtatgccaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgcattactgcctttgtatgcatgtatacaggctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatttgaccctttaccccgttgcccggcaacggcctggtc
tatgccaagtatttgctgacgcaacccccactggttggggcttggccatgggccatcggcgcctgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcaaaactcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcgggggcgcttggggatctatcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011100_P_P-C Feature FT:CDS AP011100_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacac
ataaggtgggaaactttactgggctttattcttctaatgtacctgtctttaaccctgattggcaaactccctcttttcct
gatatacatttgcaggaggacattattgatagatgtcaacaatttgtgggcccgcttactgtaaatgaaaaaaggagatt
aaagttaattatgcctgctagattttttcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatatagttaatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattcttgccagaccatcagttggacccggct
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcttggcaggtaggagc
tggagcattcgggccagggttcaccccaccacacggcggccttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacatttcatcaagctctgctagatcccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgac
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtgtacatttgaaccctcacaaaaccaa
gcgttggggctactcccttaatttcatgggatatgtaattggaagttggggtaccttaccacaggaccatattatactaa
aaatcaagcactgttttcgaaaactccctgttaatcgaccgatagattggaaagtatgccaaagaattgtgggtcttttg
ggctttgctgccccttttacgcaatgtggttatcctgcattactgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgtcaacttacaagacttttctgtgtaaacaatatctgaccctttaccccgttgcccggcaacggccaggtc
tatgccaagtatttgctgacgcaacccccactggttggggcttggccatgggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcaaacctcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggtcgcttggggatctatcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011101_P_P-C Feature FT:CDS AP011101_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacac
ataaggtgggaaactttactgggctttattcttctaatgtacctgtttttaaccctgattggcaaactccctcctttcct
gatatacatttgcaggaggacattattaatagatgtcaacaatttgtgggcccgcttactgtaaatgaaaaaagaagatt
aaagttaattatgcctgctagattttttcctaaccttaccaaatatttgcccttagataaaggcattaaaccctattatc
ctgaacatacagttaatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattcttgccagaccatcagttggacccggct
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcttggcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggccttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacatttcatcaagctctgctagatcccagagtaaggggcctata
ttttcctgctggtggctccagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaattctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgac
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaacccgcacaaaaccaa
gcgttggggctactcccttaatttcatgggatatgtaattggaagttggggtaccttaccacaggatcatattatactaa
aaatcaagcaatgttttcgaaaactccctgtcaatcgaccgatagattggaaagtatgccaacgaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgcattgctgcctttgtatgcatgtatacaagctaagcaggcatt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatttgaccctttaccccgttgcccggcaacggccaggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcaaaactcatcggaac
cgacaactctgttgtcctctcccggaaatacacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatccagcggacgacccgtctcgggggcgcttggggatctatcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011106_P_P-C Feature FT:CDS AP011106_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcctttcct
gacatacacttgcgggaggacattatcaacagatgtcaacaatatgtaggccctcttacagtcaatgagaaaagaagatt
atccttaattatgccggctaggttttatcctaatataaccaaatatttgcccttagataaaggcattaaaccttattatc
ctaaccatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgaacatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagt
gggagcgttcgggccagggttcaccccaccacacggaagtcttttggggtggagccctcaggctcagggcatattgacac
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacactcatcctcaggccatgcagtggaactccacaacattccaccaaactctgctagatcccagagtcaggggcctcta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
gcgatggggctattcccttaacttcatgggatatgtaattggaagttggggtaccttaccgcaagatcatattgtagaaa
agatcaagcattgttttcgcaaacttcctgttaatagacctattgattggaaggtatgtcaacgcattgtgggtcttttg
ggctttgctgccccttttacacagtgtgggtatccagccttaatgcctttgtatgcatgtattcaatctaagcaggcttt
cactttctcgcccacttacaaggcctttctacgcacacaatatctgaacctttaccccgttgcccggcaacggcctggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctataggccatcagcgcatgcgtggcacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaac
cgacaactcggttgtcctctctcggaaatacacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011107_P_P-C Feature FT:CDS AP011107_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcctttcct
gacatacatttgcgggaggacattatcaacagatgtcaacgatatgtaggccctcttacagtcaatgagaaaagaagatt
atccttaattatgccggctaggttttatcctaatataaccaaatatttgcccttagataatggcattaaaccttattatc
ctaaccatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgaacatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagt
gggagcgttcgggccagggttcaccccaccacacggaagtcttttggggtggagccctcaggctcagggcatattgacac
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacactcatcctcaggccatgcagtggaactccacaacatttcaccaggctctgctggatcccagagtgaggggcctcta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
gcgatggggctattcccttaacttcatgggatatgtaattgggagttggggtaccttaccgcaagatcatattgtaggaa
agatcaagcattgttttcgaaaactgcctgttaatagacctattgattggaaggtatgtcaacgcattgtgggtcttttg
ggctttgctgccccttttacacagtgtgggtatccagccttaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctaagccaacaatatctgaacctttaccccgttgcccggcaacggcctggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagcaggtctggagcgaaactcatcggcac
cgacaactctgttgtcctctcacggaaatacacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY057947_P_P-C Feature FT:CDS AY057947_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Tibet705). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
acaaggtgggaaactttactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcct
cacattcatttacaggaggacattattactagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctagattctatcctaaccttaccaaatatttgcccttggacaaaggcataaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcaccatttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagt
gggagcattcgggccagggctcacccctccacatggcggtattttggggtggagccctcaggctcagggcatattgacca
cagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaaccttccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacgtgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcacttaacttcatgggatatgtaattggaagttggggtactttaccgcaagatcatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggrcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgtcgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggcaaccaccgtga
>gnl|hbvcds|AY066028_P_P-C Feature FT:CDS AY066028_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaataatgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggacagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcaaggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccacgtcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaacaaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttagaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcacggcaacgttcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
tgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggactttaccgtccc
cttcttcatctgccgttccggcccaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY167090_P_P-C Feature FT:CDS AY167090_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgccaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatattctgtggaaggctggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcgtcca
cacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactaaaacaatccagattgggacttcaaccccaacaaggatcaatggccacaggcacatcatgttggagc
gggagcattttggccagggttcaccccaccacacggcggtcttttggggtggagccctcatgctcagggcatattgacaa
cagcgccagtagtacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctgtccacctctaaga
gacagccatcctcatgccatgcagtggaactccacaacattgcaccaagctctgctagaccccagagtgagggggctata
cttccctgctggtggctccagctccggaacagtaaaccctgttccgactattgtctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctatttccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acggtggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaa
aactcaagcaatgttttcgaaaactgcctgtaaataggcctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacgtacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacatttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgtcgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY167091_P_P-C Feature FT:CDS AY167091_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ic). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagaggacgaagcagggcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttactgggctttattcctctactatccctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagact
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttactatc
cggaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcacactgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggtctgta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaactttatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcgaaaacttcctgtaaataggcctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtctaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacttttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcattggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtcccgcggccgtttgggcctctatcgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY167096_P_P-C Feature FT:CDS AY167096_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IIIa). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaattccgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaaaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactca
aactcaagcaatgttttcgcaaattgcctgtaaataracctattgattggaaagtatgtcaaaaaattgtgggtcttttg
ggctttgctgccccttttacacaatgtgggtatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataagacctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcgggtgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY167099_P_P-C Feature FT:CDS AY167099_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IVb). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattgtcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcatcaagccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcnacaaggcatggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggatcattcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctcta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctaaactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaaatgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactctcttaacttcatgggatatataattggcagttggggcaccttgccacaggaacatattgtacaaa
aaatcaagcaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcagcggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcgtgttttgctcgcagcaggtctggagcaaacctcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY206376_P_P-C Feature FT:CDS AY206376_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagatt
aaaattaataatgcctgctaggttctttcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatc
ctgaacatacagttaatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaagcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatgttgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctcaccacctctaaga
gacagtcatcctcaggccctgaagtggaactccacaactttccaccaagctctgctagatcccaaagtgaggggccttta
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaaggcctgcacgac
tcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtctggcttttagttatatggatgatgtggtattgggggcgaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccccaataaaacaaa
gcgttggggctactcccttaacttcatgggctatgtaattggaagttggggtaccttaccacaggaacatattgtcctaa
aaatcaaacaatgttttcgaaaacttcctgtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttgtatgcctgtatacaatctaagcaggcttt
tactttctcgccaacatacaaggcctttctctgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccgtaggccaccagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggtac
ggacaactccgttgtcctctcgcggaaatacacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttggggctctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY206379_P_P-C Feature FT:CDS AY206379_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagatt
aaaattaataatgcctgctaggttctttcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatc
ctgaacatacagttaatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaagcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatgttgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctcaccacctctaaga
gacagtcatcctcaggccctgaagtggaactccacaactttccaccaagctctgctagatcccaaagtgaggggccttta
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaaggcctgcacgac
tcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtctggcttttagttatatggatgatgtggtattgggggcgaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccccaataaaacaaa
gcgttggggctactcccttaacttcatgggctatgtaattggaagttggggtaccttaccacaggaacatattgtcctaa
aaatcaaacaatgttttcgaaaacttcctgtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttgtatgcctgtatacaatctaagcaggcttt
tactttctcgccaacatacaaggcctttctctgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccgtaggccaccagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggtac
ggacaactccgttgtcctctcgcggaaatacacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttggggctctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY206381_P_P-C Feature FT:CDS AY206381_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcacagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggacgc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcct
cacattcatttaaaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcca
aacctcgacaaggcatggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatttctccacctctaaga
gaaagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacggagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataagaccaa
acgttggggctattcccttaatttcatgggatatgtaattggaagctggggtactttaccgcaagaacatattgtactaa
aaatcatgcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtctgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttaatgcctttatatgcatgtatacagtctaagcaggcttt
cactttcccgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggcaattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY206382_P_P-C Feature FT:CDS AY206382_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaagaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtactatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattcttccccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacgcggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttcttctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaactttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggcttcgctgccccttttacacaatgtggctatcccgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggagcttggccattggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY206384_P_P-C Feature FT:CDS AY206384_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaagttaattatgcctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacgcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatggaagtgtgcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaa
acgttggggctattcccttaatttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccc
cttcttcatctaccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY206386_P_P-C Feature FT:CDS AY206386_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggagtctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgcaaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatc
cggaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggtattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaa
cagtgccagcagcgcctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcagaccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgta
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtanggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttaccgctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaactaa
acgttggggctactctctcaactttatgggatatgtgattggcagttggggcactttaccacaggatcatattgtactta
aaatcaaacaatgttttcgaaaacttcctgtaaatcgtcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatccggcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatctcaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatacggcggaactcctagccgcttgttttgctcgctgccggtcgggagcaaaactcatcggaac
cgacaactctgttgtcctttctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctctcgtccc
cttctgcatctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY206388_P_P-C Feature FT:CDS AY206388_P_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol). [Hepadnaviridae] (length=2511 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaggcaggtcccctagaagaagaactccctcgcct
cgcagacgaaggtctcaatcgcctcgtcgcagacgatctcaatctcgggaatctcaatgttagtatcccttggactcata
aggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcac
attcatttaaaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaa
attaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctg
aacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaa
actacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatgggga
caaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaat
ccagattgggacttcaaccccaacaaggatcattggccagaggcaactcaggtaggagcgggagcattcgggccagggtt
cacccctccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcacctcctc
ctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccata
cagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccag
ttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccga
acatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctc
acaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattc
gcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtt
tgtcctctacttccaggaaattcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctat
gagtccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggccttcgcaa
gattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggtccgtagggctt
tcccccactgtgtggctttcagttatatggatgatgtggtattaggggccaagtctgtacaacatcgtgaggcccttttt
accactattaccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaa
cttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaaacaatgttttcgaa
aactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttaca
caatgtggctatcctgcattgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaa
ggcctttctgcgtaaccaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacg
caacccccactggatggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatact
gcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctc
tcggaaatacacctcctttccatggctgctggggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcc
cgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgg
ccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttc
acctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY206389_P_P-C Feature FT:CDS AY206389_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcccgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagaga
gaaactacacgaagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatgg
ggacgaatctttctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccagctcaaac
aatccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagtgggagcattcgggccagg
gttcaccccaccacacggcggtcttttggggtggagccctcgggctcagggcatattgacaacagtgccagcagcacctc
ctcctgcctccaccaatcggcagtcaggaagacagcctactcccatagcagcacctcctcctgcctccaccaatcggcag
tcaggaagacactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcaccctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactccct
taacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttc
gaaaattgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttt
acacaatgtggctatcctgccttgatgcctttatatgcatgtatccaatctaagcaggctttcactttctcgccaactta
caaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctg
acgcaacccccactggatggggcttggccataggtcatcggcgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagcagcttgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcct
ctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacg
tcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcttctgccgttc
cggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgcaggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY206392_P_P-C Feature FT:CDS AY206392_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagatt
aaaattaattatgcctgctaggttctatcctagccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatacgctgtggaaggctggcattttatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgcccgcagcacatcctcctgcatccaccaatcggcagtcaggcagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgagaggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaatttcctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactctaccgcaggaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtcaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacccaatgtggctatcctgccttaatgcctttatatgcaagtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY220699_P_P-C Feature FT:CDS AY220699_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatccggagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccctattatc
ctgaacatgcagttaatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccttgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccgccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcatgccatacagtggaactccacaacattccaccaaactctgctagaccccagagtgaggggcctata
cattcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
caagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggac
tacaaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttctttggtctttgggtatacatttgaatcctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcaccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY220701_P_P-C Feature FT:CDS AY220701_P_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaactcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcctctactgtacctatctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
gaaattaattatgcctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttcatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttatcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggcaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtgattcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctcca
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtattaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggctttgccgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaac
tgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcct
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY220702_P_P-C Feature FT:CDS AY220702_P_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacccttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcctctactgtacctatctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
gaaattaattatgcctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatgg
ggacgaatctttctgttcccaaccctctgggattctttcccgatcaccagttggaccctgcattcggagccaactcaaac
aatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagg
gttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcacctc
ctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcc
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccaacacgggaccatgcaaaacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttga
caagattcctatgggagtgggcctcaatccgtttctcctgactcaatttactagtgccatttgttcaatggttcgtaagg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctaccccct
taacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtattaaaaatcaagcaatgttttc
gaaaactgcctgtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgccgcccctttt
acacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaactta
taaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctg
acgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgacaactctgttgtcct
ctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacg
tcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttc
cggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY247031_P_P-C Feature FT:CDS AY247031_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUHB84). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctaccgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacatttcaccaagctttgctagatcccagagtgaggggcctcta
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
agactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtatgccaaagaattgtggggcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgcgtcaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tctgccaagtgtttgctgatgcaacccccactggatggggcttggccataggccaccagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgcttgggactctaccgtccc
cttcttctactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY247032_P_P-C Feature FT:CDS AY247032_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUHB95). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaaccctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactttgtggaaggctggcatcctatataagaga
gaaactacacgcagtgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaa
ctgtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccaattccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttgccacaggaacatattgtactaa
aactcaaacaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccttttacacaatgtggctatcctgccttgatgcctatatatgcgtgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttatg
gctcctttgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY306136_P_P-C Feature FT:CDS AY306136_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H85). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttactaaatatttgcccttggataaaggcattaaaccatattatc
ctgaacatgtggttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcccga
ggactggggaccctgcactgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtcggcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtactaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacccttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcctcacctctgtacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY596107_P_P-C Feature FT:CDS AY596107_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib-1). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggtaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatacttgcccttggacaaaggcattaaaccgtattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcacatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcacctccctctgccttcaccaatcgggagtcaggaagacagactactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaacttcacaaccttccaccaaactctgttagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacttgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctcatggctaagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactaa
aactcaagcaatgttttcgaaaattgcctgtaaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcctgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY596108_P_P-C Feature FT:CDS AY596108_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib-2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcacttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaagggcattaaaccctattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggaattctatataagaga
gaaactacacgcagtgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctgtgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctttccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY641558_P_P-C Feature FT:CDS AY641558_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He74). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccccgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaatttcatgggatatgtaattggaagctggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggttatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacatgcacctgtaccccgttgcccggcaacggcctggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcaacacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY641559_P_P-C Feature FT:CDS AY641559_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He53). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactc
acaaggtgggaaattttactgggctttactcgtctactgtacctatctttaatcctgattggcaaactccctcctttcct
aacattcatttacaggaggacattattgatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtcggagt
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcggggcatagtgacac
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctactagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcaatttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaggccctttatacctctattaccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aaattaagcaatgttttcggaaactgcctgtcaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttg
ggatttgctgccccttttacacaatgtggctatcctgctttgatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgtcaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY641560_P_P-C Feature FT:CDS AY641560_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He100). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattcttaatagatgtcaacaatttgtgggccctctcacaattaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgtgcccaatcctctgggattctttcccgatcaccagttggacccagcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagt
gggaacattcggtccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctattcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacacattgtactaa
aactcaagcaatgttttcggaagctgcctgttaatagacctattgattggaaagtatgtcaaagaattgtggggcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttgatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaccaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcttagcagcgtgttttgctcgcagccggtctggagcaaaccttatcgggac
tgacaactctgttgtcctttcacggaaatacacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY641561_P_P-C Feature FT:CDS AY641561_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He127). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacggttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggtattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgaagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagctcctcctcctgtctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggagcatattgtactaa
aaatcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggttttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcgtgtatacaagctaagcaggcttt
cactttctcgccaatttacaaggcctttctgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccgactacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY641562_P_P-C Feature FT:CDS AY641562_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He82). Complete genome. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttacaaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatgg
ggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaac
aatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggccagg
gttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagcgcctc
ctactgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcc
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaaacacctc
tatttttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcgtcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactccct
taacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactaaagcaatgttttc
ggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttt
acacaatgtggctatcctgctttgatgcctttatatgcgtgtatacaatctaagcaggctttcactttctcgccaactta
caaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctg
acgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccat
accgcggaactcctagcggcttgttttgctcgcagccggtctggagcaaaacttattgggactgacaactctgttgtcct
ctcacggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacg
tcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttc
cggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY641563_P_P-C Feature FT:CDS AY641563_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He52). Complete genome. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgcggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcct
aacattcatttacatgaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatgctctgtggaaggcgggcattctatataagaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatcaaacctcgacaaggca
tggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactca
aacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtcggagcattcgggcc
agggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagctc
ctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcag
gccatgcagtggaactccaccacattccaccaagctctgctagatcccaaagtgaggggcctatattttcctgctggtgg
ctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctg
caccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggcca
aaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttg
cccgtttgtcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcac
ctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctt
tcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgca
gggctttcccccactgtttggctttcagttatatggatgatttggtattgggggccaaatctgtacaacatctggagtcc
ctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactc
ccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaagcaatgtt
ttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccct
tttacacagtgtggctatcctgccttgatgcctttatatgcatgtatacaagctaagcaagctttcactttctcgccaac
ttataaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttg
ctgacgcaacccccactggatggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgt
cctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtct
acgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccg
ttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY862869_P_P-C Feature FT:CDS AY862869_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H8). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatc
cggaacatatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggagcattcgggccggggttcactccaccacacggcaatcttttggggtggagctctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccactattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aaatcaaacaatgttttcggtagcttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
gggtttgccgctccctttacacaatgtggttacccagcattaatgcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtg
gctcctctaccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D00630_P_P-C Feature FT:CDS D00630_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggtctctattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aatattcatttacaggaggatattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggtattaaaccttattatc
ctgaacatgcagttaatcattatttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgtagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcatttgggccagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagcagcgcctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctgtgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggcccaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtactaa
aaatcaagcaatgttttcggaagctgcctgtaaatagacctattgattggaaagtatgtcaaaggattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccattggccaatcgggcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcgcctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D12980_P_P-C Feature FT:CDS D12980_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtgccaaactccctcctttcct
aacattcatttacaagaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatacgctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagacggaatcaaggtaggagc
gggagacttcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatcttgacaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttggtgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttataaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttggtgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D23680_P_P-C Feature FT:CDS D23680_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B4-HBVST1). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagtgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcatattgacaa
ccgtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattacccattttcttttatctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaaagcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccgacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
gggccgtgtgcacttcgcttcacctctgcacgtcgcatggaaacctccgtga
>gnl|hbvcds|D23681_P_P-C Feature FT:CDS D23681_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C4-HBVST2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtaccccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaagttaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggaaaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagtgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttactcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcatattgacaa
ccgtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgcttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattacccattttcttttatctttgggtatacatttgaaccccaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaaagcctttatatgcatgtatacaagctaagcaggcttt
cactttctcgccgacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagctggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcatctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
gggccgtgtgcacttcgcttcacctctgcacgtcgcatggaaacctccgtga
>gnl|hbvcds|D23682_P_P-C Feature FT:CDS D23682_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B5-HBVKO1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctaccgtacctgtctttaatcctgattggcaaactccctccttccct
aacattcatttacaggaggatattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaactttaccaaatatttccctttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctttggaaggctggcattctatataagaga
gaaactacacacagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggatccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttctcgttgacaagaatccacacaatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tacaaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggcaaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
gcgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactaaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttgaagcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagcggcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D23683_P_P-C Feature FT:CDS D23683_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C5-HBVKO2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctaccgtacctgtctttaatcctgattggcaaactccctccttccct
aacattcatttacaggaggatattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaactttaccaaatatttccctttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctttggaaggctggcattctatataagaga
gaaactacacacagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggatccggcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcacattgacaa
cagtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgttt
ttctcgttgacaagaatccacacaatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tacaaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggcaaggtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtattcatttgaaccctaataaaaccaa
gcgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtacaaa
aactaaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgctttgaagcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccataccgcggaactcctagcggcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatcccggggtcgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D23684_P_P-C Feature FT:CDS D23684_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C6-TKB588). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttgcaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttgcatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggtgcattgacaa
cagtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagaccacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccgcaagaccatattgtactaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaccaatatctgaacctttaccccgttgcccggcaacggtcaggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcgccgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaac
ggacaactctgttgttctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgtttaggtctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D28880_P_P-C Feature FT:CDS D28880_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Plasma 1992-085-9434). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
cacattcatttacaggaggacattattgatagatgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggcattaaaccatattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagaga
gaaactacacgcagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacgaggcatggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgcactgacaa
ccgtgccagtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctata
cttccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatctcctcga
ggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagacttgtggtggacttctctcaattttctagggggagcacc
caagtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctcgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacaccaactaccagcacaggaccatgcaagacctgcacgag
tcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcatttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgta
caacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggatgttggggtactttaccgcaagaacatattgtactaa
aaatcaagaactgttttcgaaaactgcctgtaaatagacctattgattggaaagtctgtcagagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatccaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgcgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcgccgcgtgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttctcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacaacccgtctcggggccgtttgggactctaccgtccc
cttcttcgcctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|D50517_P_P-C Feature FT:CDS D50517_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagccgcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtcttaa
aactcaaacaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtctggtg
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D50518_P_P-C Feature FT:CDS D50518_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagccgcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgctggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtcttaa
aactcaaacaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtctggtg
tctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttctgcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D50519_P_P-C Feature FT:CDS D50519_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagaagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtattacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctgggtcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttggccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcggcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgaatggagaccaccgtga
>gnl|hbvcds|D50520_P_P-C Feature FT:CDS D50520_P_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcct
aacattcatttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattaattatgcctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaaga
gaaactacacgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagc
gggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtgccagaagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctata
tcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctcgtattacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgag
tcctgctcaaggaacctctacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcc
catcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccacaggaacatattgtattaa
aaatcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgccccttttacacaatgtggctatcctgcattgatgcctttatatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttggccggcaacggtccggtc
tctgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcggcgcatgcgtggaacctttatg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccc
cttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089757_P_P-C Feature FT:CDS DQ089757_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2342). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaacttyactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttaccaaatatttgcccttrgataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgmagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtysgtcttcca
aacctcgamraggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacctggca
ttcagagccaattcaaacaatccagattgggacttcaaccccaacaaggatccatggccagaggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccaccyctaaga
gacagycatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaagggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaagatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccraaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccaytgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacaycttgaayccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctactaaaactaa
acgttggggctactcccttcacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccacactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttctcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089758_P_P-C Feature FT:CDS DQ089758_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1733). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcagcaatatgtaggccctcttaccgttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgccattagataaaggcattaaaccttattatc
ctgatcacctagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatcttgctgttcccaatcctctgggattctttcccgatcaccagttggaccttgca
ttcagagccaatacaaacaatccagattgggacttcaaccccaacaaggatccatggccagaggcayggcaggtaggagc
gggatccttcgggccagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctccttctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaaga
gacagtcatcctcaggccgtgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactattgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaaaatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
caagtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtccaccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgag
tcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctgctaaaactaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctacaaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccatagrccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaactgatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089759_P_P-C Feature FT:CDS DQ089759_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1512). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcaaggcatattgacaa
cagtaccagcagcgtctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgatagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttctggttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgtaaccaattttcttttgtctttgggtatacatttaaaccctactaaaactaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattatacaca
aaatcaaacaatgttttcggaaacttcctataaatagaccgattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089760_P_P-C Feature FT:CDS DQ089760_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK454). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacataccctgtggaaggctggtattttatataagaga
gaaactacccgcagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggart
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcaaggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcaccctcaggccatacagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgtcaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctgctaaaactaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgctgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaagcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatcagaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcctgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089761_P_P-C Feature FT:CDS DQ089761_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK515). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatacaagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggcaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcatcagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacta
caataccagcagcgcctcctcctgcctccaccaatcggcaggtaggaagaaagcctactcccatctctccacctctaaga
gacagtcatcctcaggccrtgcagtggaattccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcagtcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctgcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacaccttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctrccaaaactaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtgggtacccagcattaatgcctttgtatgcctgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctctgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggcc
tttgccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcac
cgacaactctgttgtcctgtctcggaaatacacctcatttccatggctgctaggttgtgctgcccactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089762_P_P-C Feature FT:CDS DQ089762_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1644). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctmaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacatccatttgaaagaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaagcggagatt
aaaattgattatgcctgctaggttctatcctaaccktaccaaatatttgcccttagacaaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggcaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttagggtggagccatcaggcacagggcatattgacta
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggragacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagaacattccaccaagctctgctagatcccagagtgaagggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
crcgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacaccttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctacaaaaactaa
acgttggggctactcccttaacttcatgggttatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaamttatcggcac
cgacaactctgttgtcctttctcggaaatacacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaycgtccc
cttcttcgtctgccgttccgsccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089763_P_P-C Feature FT:CDS DQ089763_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1048). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
tacattcatttgaaagaggatattatcaatcggtgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatacttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcggcaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctgctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
caagtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatc
gcttgatgtatctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctactaaaactaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctgtaaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
tactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttctcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089764_P_P-C Feature FT:CDS DQ089764_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK967). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaacgaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctactaaaactaa
acgttggggctactccctcaacttcatgggatatgtaattggaagttggggtactttaccacaagaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagccaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctcccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgtttggggctctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089765_P_P-C Feature FT:CDS DQ089765_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK428). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcttttcct
ctcatacatttaaaagaggatattatcaatagatgtcaaaattatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatc
cagaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggcattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
cttccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctactaaaactaa
acgttggggatactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaacacttctcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgactacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089766_P_P-C Feature FT:CDS DQ089766_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK553). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactcccacttttcct
ctcattcatttgaaagaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgca
ttcggagccaatacaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtgggagt
gggatccttcgggccagggttcactccaccacatggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaagcggcagtcaggaagacagcctactcccatctctccacctttaaga
gacagtcatcctcaggccacgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaagggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaacatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttctatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccamggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgyaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctgctaaaactaa
acgttggggatactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccttttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaatctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcacatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcctgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089767_P_P-C Feature FT:CDS DQ089767_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1663). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
ctcattcatttgaaagaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaattcaaacagtccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctaaggctcagggtctactaacca
ctgtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgatagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
caagtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctctggtcctccaayttgtcctggttatc
gctggatgtgtctgcggcgttytatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tacaaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccamgtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctactaaaactaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaaa
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaacccttctcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgtttcggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089768_P_P-C Feature FT:CDS DQ089768_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1814). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
gaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagaga
gaaactactagaagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccggtcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaacccaaacaaggatcaatggccagcggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgtcaa
cagtaccagcagcgcctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccacacagtggaactccagcacattccaccaagctctgatagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
caagtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaaccttttgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttytatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tacaaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctactaaaactaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctatcaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgccccctttacacaatgtgggtacccagcattaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggcaataggccatcagcgcgtgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcramacttctcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgcc
ggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|DQ089769_P_P-C Feature FT:CDS DQ089769_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK430). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccataccaaatatttgcctttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactacccgcagcgcctcattttgtgggtcaccatattcttgggaacaagagytacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccggtcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ttttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcgtgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctactaaaactaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcgaaaaattcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtatttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcgaaactgctcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089770_P_P-C Feature FT:CDS DQ089770_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1272). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagccaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cactaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggcmatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggttccagttccggaacagtaaaccctgttccgaytactgcctctcccatatcgtcaatcttctcga
ggaytggggaccctgcaccgaatatggaaagcaccatatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctactaaaactaa
acgttggggctattcccttaacttcatgggttatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatccaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089771_P_P-C Feature FT:CDS DQ089771_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1629). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggacgc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaagaagaagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgcctttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcattatttacatactctgtggaaagctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggaccctgca
ttcagagccaattcaaacattccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagt
gggatccttcgggccagggttaactccaccacatggcggtcttctggggtggagccctcaagctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcggtcaggaagacagcctactcccatcactccacctctaaga
gacagtcatcctcaggccatacagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcactacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaaaccctactaaaactaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacacattgtacaca
aaatcaaacaatgttttcggaaactgcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtcaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctcgcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|DQ089772_P_P-C Feature FT:CDS DQ089772_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK910). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
cacattcatttaaaagaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagatt
aaaattgattatgcctgctaggttctatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaaaaaggatcaatggccagcggcacaccaggtaggagt
gggatcattcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagccgcgcctcctcctgcctccaccaatcggcagtcaggaagaaagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaaactctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttatctttgggtatacatttaaaccctgctaaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaagaacatattgtccaca
aaatcaaacaatgttttcggaaactgcctattaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcattaatgccgttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacattctcggcac
cgacaactctgtggtcctctctcggaaatacacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089773_P_P-C Feature FT:CDS DQ089773_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1193). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttyttagacgacgaggcagctcccctagaagaagaactccctcg
cctcgcagacgaagttctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactgccaaactcccttttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaacggagatt
aaaattgattatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatc
ctgaacacatagttaatcattacttccaaactaggcatwatttacatactctgtggaaggcgggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagt
gggatccttcgggccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatacagtggaactccaaaacattccaccaagctctgctagatcccagagtgaggggcctata
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttatcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacc
caagtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctactaaaactaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccacaggaacatattgtacaca
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctg
ggctttgccgctccctttacacaatgtggttacccagcgttaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttctcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089775_P_P-C Feature FT:CDS DQ089775_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK290). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcct
cacattcatttgaaagaggatattatcaatagatgtcaacaatatgtgggcccccttacagttaacgaaaaacggagatt
aaaattgatcatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatc
ctgaacatatagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgtycccaatcctctgggattctttcccggtcaccagttggacccggca
ttcggagccaattcaaacmatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagt
gggatcattcgggccggggttcactccaccacacggcaatcttttggggtggagccctcaggctcaaggcatattgacaa
cagtaccagcagcgcctcctcctgcctctaccaaacggcagccaaaaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccccgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgstgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccattgtttggcttttagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacacattgtacaaa
aaatcaaacaatgttttcggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggacttttg
ggttttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacttttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggcac
cgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|DQ089776_P_P-C Feature FT:CDS DQ089776_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK884). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcct
cacattcatttaaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
maaattgatcatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcatcaaaccttattatc
ctgaacatacagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattctatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatgggaggttggtctgcca
aacctcgacaaggcatggggacgaatctktctgttcccaatcctctgggattctttcccgatcaccagttggacccggct
ttcggagccaattcaaacaatccagattgggatttcaaccccaacaaggaccaatggcctgcggcaaatcaggtaggagt
gggatcattcgggccggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggkagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctgcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctattaccaattttcttgtgtctttgggtatacatttaaaccctrataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aaatcaaacaatgttttaggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggttttgccgctccctttacgcaatgtggatacccagcattaatgcctttgtatgcctgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttggg
gctcctctgccgatccatactgcggaactcctggcagcttgttttgctcgcagccggtctggagcaaaccttatcggcac
cgacaactctgtcgtcctctntcggaaatacacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089777_P_P-C Feature FT:CDS DQ089777_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1159). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcct
cacattcatttaaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcatcaaaccttattatc
ctgaacatacagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattctatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatgggaggttggtctgcca
aacctcgacaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggacccggct
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggaccaatggcctgcggcaaatcaggtaggagt
gggatcattcgggccggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcaatggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgccaaggtatgttgcccgtttgtcctctgcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctattaccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aaatcaaacaatgttttaggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggttttgccgctccctttacacaatgtggatacccagcattaatgcctttgtatgcctgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttggg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcac
cgacaactctgtcgtcctctctcggaaatacacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtccgcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcctggagaccaccgtga
>gnl|hbvcds|DQ089778_P_P-C Feature FT:CDS DQ089778_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1442). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagacgatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcct
aacattcatttaaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaagccttattatc
ctgaacatgtagttaatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagt
gggatcattcgggccggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaacacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccggttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttataccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aaatcaaacaatgtttcaggaaacttcctgtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggtttcgccgctccctttacacaatgtggatacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|DQ089779_P_P-C Feature FT:CDS DQ089779_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK554). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactggactttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcct
cacattcatttaaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttctatcctaaccttaccaaatatttgcccctagataaaggcatcaaaccttattatc
ctgaacatatagttgatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagt
gggatcattcgggccggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctata
ctttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaa
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aaatcaaacaatgttttaggaaacttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggttttgccgctccctttacacaatgtggatacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcacaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtccttkgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaraccaccgtga
>gnl|hbvcds|DQ089780_P_P-C Feature FT:CDS DQ089780_P_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK947). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcct
aacattcatttgaaagaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagatt
aaaattgatcatgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatc
ctgaacatacagttaatcattacttccaaactaggcattatttacatactttgtggaaggctggtattttatataagaga
gaaactactcgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggca
ttcggagccaattcaaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagt
gggatcattcggtccagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaa
cagtaccagcagcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaactycagcacattccaccaagctctgctagatcccagagtgaggggccktta
ccttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcga
ggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgcgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttggttgttcttckggac
taccgaggtatgttgcccgtttgtcctcyacttccaggaacatcaactaccagcaygggaccatgcaagacctgcacgat
tcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcc
catcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtgrttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttttaccgctattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccag
acgttggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaa
aaatcaaacaatgttttaggaagcttcctataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggttttgccgctccctttacacaatgtggttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcac
cgacaactctgttgtcctctctcggaaatacacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccc
cttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ089781_P_P-C Feature FT:CDS DQ089781_P_P-C of [Viruses] Hepatitis B Virus genoty