HBVdb

Dataset for nucleotide sequence P of genotype C

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                    *   *        *                             *
ATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAG------AC------G------ACGAGGCAGGTCCCCT
           c                g   g     a           t      a       a  t     a  t  
                                                         c                      
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *                                *       *         *              *           
AGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCTCAATG
                        c       a        a                  a         gcc ct    
                                                                                
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *   *  *   *  *    * *                  ** **                             * 
TTAGTATCCCTTGGACTCATAAGGTGGGAAACTTTACTGGGCTTTATTCTTCTACTGTACCTGTCTTTAATCCTGAgTGG
       t  c      c           t     g  a     c     c a  ct   a t     ct c  c   
                                        c                 g                 a   
                                                                            t   
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      **     * **       *                                   *      *       *    
CAAACTCCCTCcTTTCCTcACATTCATTTacAgGAGGAcATTATtaAtAGATGTCAACAATaTGTgGGCCCTCTTACAGT
a g     t  t      agt  a  c  gaga  a  t     cgcc  g  cg      tc  a  t     c atac
                  g                                                             
                                                                                
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *                    *                *      *             *                  
TAAtGAAAAAAGgAGATTAAAATTaATtATGCCTGCTAGGTTcTATCCTAAcCTTACCAAATATTTGCCcTTgGAtAAAG
 c  g  gc a   c gtcg  g  c     g  c  a  t t   c  atgc  t      c a  tc a  c  g 
                         a     c                 ta                a          
                                                   g                            
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *         *  *        *             *                     *           *       
GCATtAAACCtTATTATCCTGAACATgcAGTTAATCATTACTTCaAAACTAGgCATTATTTACATACTCTGTGGAAGGCt
 t  c     g      g   t catg              tc  g c  a  c     g  c  ct t     a  g
          a        c   a                         g                 g           a
          c                                                                     
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**                       *             *      *     * **                  *     
GGcATTcTATATAAGAGAGAAACTACaCGCAGcGCCTCATTTTGTGGGTCACCATATTCTTGGGAACAAGAGCTACAGCA
  tg  t       a        c  t at  t  t     c  c                                 --
                          c  a                                                  
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                           *    
TGGG---AGGTTGGTCTTCCAAACCTCGA------cAAGGCATGGGGACgAATCTTTCTGTTCCCAATCCTCTGGGATTC
----   ----c-------a c      g      a             a  c  g  g  g  a     g        t
           -at  c                                      c  c                     
            c                                                                   
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                       *                        
TTTCCCGaTCACCAGTTGGACCCtGCgTTCGGAGCCAAcTCAAACAATCCAGATTGGGACTTCAACCCCAACAAGGATCA
  g   agc  t        t  g  a  ta    a  t  c        c        tc                c c
                       a  t                                                     
                                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *                                                                             
cTGGCCAG-aGGCAAAtCAGGTAGGAGcGGGAgCaTTCGGGCCaGGGTTCACcCCACCACACGGCgg------------T
    t  ca  ccgc     g    ta   t c     a  g        t     c     aaa            c
    g      tt g                 t                       t                     
      c                                                                         
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CTTTTGGGGTGGAGCCCTCAGGCTCAGGGCATATTGACAA------------------------CAGTgCCAGcAGCaCC
              t  g   a    a   gctc a                             g ca a atta g  
                              c g                                c        g  t  
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TCCTCCTGCCTCCACCAATCGGCAGTCAGGAAGACAGCCTACTCCCATCTCTCCACCTCTAAGAGACAGTCATCCTCAGG
         aa t                 g  g g   c  g     t        g        a cc     g    
                                                                                
                                                                                
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CCAT--GCAGT------GGAACTCCAcaACaTTCCACCAAGCTCTGCTAGAtCCCAGAGTgAGGGGCCTaTActTTCCTG
  gc  a  a           t    gc  t  t  t  ga    at    c  a a  -ac-------c--tcac    
                          a   c                             --aa  t  -  --      
                                                                     t          
                                                                     g          

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                             *  *                                               
CTGGTGGCTCCAGTTCCGGAACAGTAAACCCTGTTCCGACTACTGCCTCaCCCATATCGTCAATCTTCTCGAGGACTGGG
          a     a  g    c  g            c t  t   t    cc  a          t  a  t    
                        g                                                       
                                                                                
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
           *     *   *                **     *  *    *        *         *  *  * 
GACCCTGCACCGAAcATGGAGAgCACaACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTT
        g     t       a   cg                           c           t          
              a                                                                 
              g                                                                 
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        * *             **  *    *     *       *   *           **               
GACAAGAATCCTCACAATACCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCACCCACGTGTC
     a               g g                             g           a      aga     
                                                                          g     
                                                                          t     
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *           *      *        *           *           *     *     **    *    **  
CTGGCCAAAATTcGCAGTCCCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAAtTTGTCCTGGcTATCGCTGGATG
            t                       t  t      c          cc        t     t      
                                                                   a            
                                                                                
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
           *  *  **     *    *   * *   *   * *     * *         *    **  *       
TGTCTGCGGCGTTTTATCATaTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTACCAAGG
             c      c                            c      a g       g       t gg  
                                                                                
                                                                                
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *       *     *                   *                                         * 
TATGTTGCCCGTTTGTCCTCTACTTCCAG------GAA---CAT------------CAACtACCAGCACGGGACCATGCA
                      a              t    ta             g  c  a ct  a  g  c    
                                          c                 a                   
                                                                                
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                              *          *         *       *                 *  
AGACCTGCACGAtTCCTGCTCAAGGAACCTCTATGTTTCCCTCTTGTTGCTGTACAAAACCTTCGGACGGAAAcTGCACT
ga        a caa        a c a     c a       a  c                     a    t     c
            g                                                                   
                                                                                
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *    *   **             *             ****        *     *                    
TGTATTCCCATCCCATCATCcTGGGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAGTCCGTTTCTCCTGGCTCAGTTT
                 g  t t        t  a                                 a           
                    a                                               t           
                                                                                
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                         *      
ACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGG
     c               a    cc                 c          c  cg t           t     
                                                                                
                                                                                
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                *     *      *              *        *           *    *     *   
GGCCAAGTCTGTACAACATCTTGAgTCCCTTTTTACCtCTaTTACCAATTTTCTTTTGTCTTTGGGTATACATTTaAACC
   g   a                ag      a    g  g             gc a   c           c g  t 
                                                                                
                                                                                
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *     *   *  ** *  *    *            * *        *       * *       *        
CTAATAAAACCAAaCGtTGGGGcTACTCCCTTAAcTTCATGGGATATGTAATTGGAaGTTGGGGTACtTTaCCaCAgGAA
 cccc     t  ga      t  t  cc t  t     c     c     gt c     a  c  g  g  a  c
          a                a           g     g     c        c  a           g
                                                                               t
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**          **                          *           *                 *         
CATATTGTACtaAAAaTcAAgCAATGTTTTCGaAAAcTgCCTgTAAATAGaCCTATTGATTGGAAAGTATGTCAaAGAAT
  c  ca gtag  gc g  aa c      a gc  t t  cact   c g              g  g  c  gc g  
     a     c   t t     g        t     a     c                       c           
           t                    c                                               
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *                           *        *  *    *           **  *                 
TGTGGGTCTTtTGGGcTTTGCtGCcCCtTTTACACAATGTGGcTAtCCtGCcTTaATGCCTTTaTATGCATGTATACAAt
   a  g  gc a  t     c  t  c  c  g        t  c  a  ac gc c   g  ct g  c  t  tg
      c              g           t        g     c  t     a                    ca
                                          a     g                             g 
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        **           *       *                    *  *           *  *           
CTAAGCAGGCTTTCACTTTCTCGCCAACTTACAAGGCCTTTCTGTGTAAACAATATCTGaACCTTTACCCCGTTGCcCGG
 c  a  a     t     t   t    a  t  aa t   t a   c       ca  cc      t        ta  
 g                                   a     t            t                   g   
                                                                            a   
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *       *                                                                
CAACGGtCaGGTCTcTGCCAAGTGTTTGCTGACGCAACCCCCACTGGaTGGGGCTTGGCcATaGGCCATCagCGCATGCG
      c c  c  t                 t              t           tc t c   cagc   c    
      g t  g  a                                c           ag g                 
              g                                               c                 
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                     *  *                 *     
TGGAACCTTTGTGGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCAGCTTGTTTTGCTCGCAGCcGGTCTGGAGCgA
          a                t     c           t  g  c     c         a       g  a 
                                             g  c  g                            
                                                                                
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
           *                                    *    **                    *    
AaCTtATCGGaACcGACAACTCTGTTGTCCTCTCTCGGAAATACACCTCcTTTCCATGGCTGCTaGGgTGTGCTGCCAAC
cca cc t  c  t        c  c  t  t  c  a  g     a  t  c           c  c            
    g  a  g  g                    g  c           g                 a            
          t                                      a                 t            
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *                      *              **     *          *                
TGGATCCTGCGCGGGACGTCCTTTGTCTACGTCCCGTCGGCGCTGAATCCCGCGGACGACCCgTCTCGGGGCCGTTTGGG
        a     a           t           a  a        t        t  a  g  c  t  cc    
        t                                                     c  c              
                                                              t                 
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
           *                                                **                  
aCTCTAcCGTCCCCTTCTtCgTCTGCCGTTCCGgCCGACCACGGGGCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTGC
ga t  t     t     gta   a       aa  ac    a     a                aa      aa     
c                 c t                                                           
t                 a c                                                           
                                                                                

      2570      2580      2590      2600      2610      2620      2630 
....:....|....:....|....:....|....:....|....:....|....:....|....:....|.
                 *         *       **                         *  **    
CTTCTCATCTGCCGGaCCGTGTGCACTTCGCTTCACCTCTGCACGTC------GCATGGAgACCACCGTGA
    a g  c     t                                           ca       ---
               g                                                       
               c                                                       
                                                                       
© 1998-2022Legal notice