HBVdb

Dataset for nucleotide sequence P of genotype C

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                    *   *        *                             *
ATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAG------AC------G------ACGAGGCAGGTCCCCT
           c                g   g     a           t      a       a  t     a     
                                t                                               
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *          *                     *       *      *  *              *           
AGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCTCAATG
                        c       a        a               a  a         g c ct    
                                                                                
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *   *  *   *  *    * *                  ** **                       *     * 
TTAGTATCCCTTGGACTCATAAGGTGGGAAACTTTACTGGGCTTTATTCTTCTACTGTACCTGTCTTTAATCCTGAgTGG
   a   t  c      c           t     g  a     c  c  c  gacg   a t     ct c  c   
       a                                c                 c                 a   
                                        t                                   t   
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      **     * **       *                                   *      *       *    
CAAACTCCCTCcTTTCCTcACATTCATTTacAgGAGGAcATTATtaAtAGATGTCAACAATaTGTgGGCCCTCTTACAGT
a g  c  t  t      a t  a  c  gaga  a  t  c  cgcc  g  cg g    tc  a  t  c  c  ta 
                  g a                                                        g  
                                                                                
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *                    *                *      *             *      *          *
TAAtGAAAAAAGGAGATTAAAATTaATTATGCCTGCTAGGTTcTATCCTAACCTTACCAAATATTTGCCcTTgGAcAAAG
 c  g   c a   c g gg  gg c     g  c  a  t t   c  tagc  t      cga  tc a  t  g 
                         a     c                 at                a          
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *         *  *        *             *                     *           *       
GCATTAAACCtTATTATCCTGAACATgcAGTTAATCATTACTTCaAAACTAGgCATTATTTACATACTCTGTGGAAGGCt
 t  c     a      g  gt catg              tc gg c  a  c     g  c  ct t     a  g
    a     g        c   a                         g                 g            
          c                                                                     
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**                       *           * *      *     * **       *          *     
GGcATTcTATATAAGAGAGAAACTACaCGCAGcGCCTCATTTTGTGGGTCACCATATTCTTGGGAACAAGAGCTACAGCA
  tg  t       a        c  t at  t  t     c  c                                 --
                          c  a                                                  
                          g                                                     
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                       *                      *     *      *    
TGGG---AGGTTGGTCTTCCAAACCTCGA------cAAGGCATGGGGACgAAtCTTTCTGTTCCCAATCCTCTGGGATTC
----   ------------a c      g      a             a  c  c  g  g  a  c  g        t
           ccta c                                      g  c                     
            a                                                                   
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                       **                       
TTTCCCGaTCACCAGTTGGACCCtGCgTTCGGAGCCAAcTCAAACAATCCAGATTGGGACTTCAACCCCAACAAGGATCA
  g   agc  t        t  g  a  ta       t                          t           c c
                       a  t                                                     
                                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *                                                                             
cTGGCCAG-aGGCAAAtCAGGTAGGAGcGGGAgCATTCGGGCCAGGGTTCACcCCACCACACGGCgg------------T
    c  ca  ccgc          t    t c  t  a  g        t     c     aaa            c
              g                                         t                     
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CTTTTGGGGTGGAGCCCTCAGGCTCAGGGCAtATTGACAA------------------------CAGTGCCAGcAGCaCC
a             t  g   a    a   gctc ag                            g  a   att  g  
                              c g                                c        g  t  
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                        *                                       
TCCTCCTGCCTCCACCAATCGGCAGTCAGGAAGACAGCCTACTCCCATCTCTCCACCTCTAAGAGACAGTCATCCTCAGG
         ta t              g  g  g g   c        t        g  c       c           
                                                                                
                                                                                
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CCAT--GCAGT------GGAAcTCCAcaACATTCCACCAAGCTCTGCTAGAtCCCAGAGTGAGGGGCCTaTActTTCCTG
  gc  a  a           t    gc  t  t  t  ga    at    c  a a   a aaa-t--t--tcac    
                              g                                -- -  g  ---     
                              c                                      c          
                                                                     -          

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *                   *  *                                              *
CTGGTGGCTCcAGTTCCGGAACAGTAAACCCTGTTCCGACTACTGCCTCaCCCATATCGTCAATCTTCTCGAGGACTGGG
          a    ta  g    c  g            c    t  tt    cc  a             a  t    
                        g                                                       
                                                                                
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*          *     *   *                **     *  *    *        *         *  *  * 
GACCCTGCACCGAAcATGGAGAaCACaACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTT
        g     t       g   cg                           c           t          
                                                                                
                                                                                
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        * *             **  *    *     *  *  * *   *           **               
GACAAGAATCCTCACAATACCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCACCCACGTGTC
     a               g g      c                      g           a      aga     
                                                                          t     
                                                                          g     
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *      * *  *      *        *           *           *     *     **    *    **  
CTGGCCAAAATTcGCAGTCCCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAAtTTGTCCTGGcTATCGCTGGATG
            t                       t  t      c        g cc        t     t      
                                                                   a            
                                                                                
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
           *  *  **     *    *   * *   *   * *     * *      *  *    **  *      *
TGTCTGCGGCGTTTTATCATaTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTAcCAAGG
 a                  c                            c      a g       g    t gtagg  
                                                                                
                                                                                
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *       *     *                   *                                         * 
TATGTTGCCCGTTTGTCCTCTACTTCCAG------GAA---CAT------------CAACTACCAGCACGGGACCATGCA
                      a              t    ta             g  c  a ct  a  g  c    
                                          c              c  a                   
                                                                                
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                              *          *  *      *       *                 *  
AGACCTGCACGAtTCCTGCTCAAGGAACCTCTATGTTTCCCTCTTGTTGCTGTACAAAACCTTCGGACGGAAAcTGCACT
ga        a caa        aac a     c a       a  c                    tac   t     c
            g                                                                   
                                                                                
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *    *  ***             *             ****        *     *      *             
TGTATTCCCATCCCATCATCcTGGGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAGTCCGTTTCTCCTGGCTCAGTTT
                 g  t          t  a                                 a           
                                                                    t           
                                                                                
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                         *      
ACTAGTGCCATTTGTTCAGTGGTTCGtAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGG
     c               a    c                  c          c   g t      a    t     
                                                                                
                                                                                
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*               *     *   *  *     *        *        *           *    *     *   
GGCCAAGTCTGTACAACATCTTGAgTCCCTTTTTACCtCTaTTACCAATTTTCTTTTGTCTTTGGGTATACATTTgAACC
   g  aa          c     ag      a    g  g             gc a   c    c      c a  t 
                                                       g                        
                                                                                
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *     *   *  ****  *    *           ** *        *       * *     * *        
CTAATAAAACCAAACGtTGGGGCTACTCCCTTAAcTTCATGGGATATGTAATTGGAaGTTGGGGTACtTTaCCaCAgGAA
 cccc     t  ga      t  t  cc t  t     c     g    agt c     a  cc g  g  a  c
          a                                        c        c  a           g
                                                       t                       t
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** *        **                          *           *                 *         
CATATTGTACtaAAAaTcAAgCAATGTTTTCGaAAAcTgCCTgTAAATAGACCTATTGATTGGAAAGTATGTCAaaGAAT
  c   a gtag  gc g  aa c     ca g   t t   act   c g  g           g  g  c  gc gc 
           c   t t     g        t     a     c                       c        c  
           t     a              c                                               
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *                           *        *  *    *           **  *                 
TGTGGGTCTTtTGGGCTTTGCtGCcCCtTTTACACAATGTGGcTAtCCtGCcTTaATGCCTTTaTATGCATGTATACAAt
   a  g  gc a  t  c  c  t  c  c  g  g     t  c  a  ac g a      g  c  g     t  tg
               a                 t        a     c  t                          c 
                                          g                                   g 
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        **  *        *       *                    *  *           *  *           
CTAAGCAGGCTTTCACTTTCTCGCCAACTTACAAGGCCTTTCTGTGTAAACAATATcTGaACCTTTACCCCGTTGCcCGG
 g  a  a     t     t  at    a  t  aatt   t t   c       ca  cc               ta  
 c                                         a            t                   g   
 a                                                                          a   
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *       *                                                                
CAACGGTCaGGTCTcTGCCAAGTGTTTGCTGACGCAACCCCCACTGGaTGGGGCTTGGCcATaGGCCATCggCGCATGCG
      c c  c  t                 t     t        t           tc t     caac   c    
      g t     a                                c           ag g            t    
              g                                               c                 
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                 *   *  *      *          *     
TGGAACCTTTGTGGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCAGCTTGTTTTGCTCGCAGCcGGTCTGGAGCgA
          a          a     t     c        tt g  g  c     c         a       g  a 
                                             t  c  g                            
                                                                                
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
           *                                 *  *    **                    *    
AaCTtATCGGaACcGACAACTCTGTTGTCCTCTCTCGGAAATACACCTCCTTtCCATGGCTGCTaGGgTGTGCTGCCAAC
cca cc t  c  t        c  c  t  t  g  c  g      g ac           c  c            
    g  a  g  g        g     a     c  a           a                 a            
          t                                      t                 t            
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *                      * *            ** *   *          *                
TGGATCCTGCGCGGGACGTCCTTTGTCTACGTCCCGTCGGCGCTGAATCCCGCGGACGACCCgTCTCGGGGCCGTTTGGG
        a  a  a           t           a  a        t        t  a  g  c  t  cc    
        t                                         a           c  c              
                                                              t                 
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
           *                                      *         **                 *
aCTCTAcCGTCCCCTTCTtCgTCTGCCGTTCCGgCCGACCACGGGGCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTGC
ga t  t     t  c  gtag  a       aa  ac    a     a                a              
c                 c c                                                           
t                 a t                                                           
                                                                                

      2570      2580      2590      2600      2610      2620      2630 
....:....|....:....|....:....|....:....|....:....|....:....|....:....|.
                 *         * *     **                         *  **    
CTTCTCATCTGCCGGaCCGTGTGCACTTCGCTTCACCTCTGCACGTC------GCATGGAgACCACCGTGA
    a g  c     t                              t            ca   t   ---
               c                                                       
               g                                                       
                                                                       
© 1998-2020Legal notice