HBVdb

Dataset for nucleotide sequence S of genotype B

[Download (right click)] [Alignment] [Repertoires]

6260 sequence(s)

>gnl|hbvcds|AB010289_S_P-B Feature FT:CDS AB010289_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB010290_S_P-B Feature FT:CDS AB010290_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttgtgtctctgggtatacatgtaa
>gnl|hbvcds|AB010291_S_P-B Feature FT:CDS AB010291_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttgtgtctctgggtatacatgtaa
>gnl|hbvcds|AB010292_S_P-B Feature FT:CDS AB010292_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-4). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB014366_S_P-B Feature FT:CDS AB014366_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 07D07HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB030509_S_P-B Feature FT:CDS AB030509_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBNP3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB031266_S_P-B Feature FT:CDS AB031266_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-3). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB031267_S_P-B Feature FT:CDS AB031267_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtttcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB033554_S_P-B Feature FT:CDS AB033554_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate RTB299). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacaggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB033555_S_P-B Feature FT:CDS AB033555_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAD744). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB048705_S_P-B Feature FT:CDS AB048705_S_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatacctcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgc
agtcccaaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgatcactgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073821_S_P-B Feature FT:CDS AB073821_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgygtgtcytggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB073822_S_P-B Feature FT:CDS AB073822_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi32). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073823_S_P-B Feature FT:CDS AB073823_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi35). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaatttgc
agtccccaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tccctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073824_S_P-B Feature FT:CDS AB073824_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatttggttttgggggccaagtctgtacaacaccttgaaaccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073825_S_P-B Feature FT:CDS AB073825_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi51). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccargtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073826_S_P-B Feature FT:CDS AB073826_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi89). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB073827_S_P-B Feature FT:CDS AB073827_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073828_S_P-B Feature FT:CDS AB073828_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK37). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073829_S_P-B Feature FT:CDS AB073829_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK38). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|AB073830_S_P-B Feature FT:CDS AB073830_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH57). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttattgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactactgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctcgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073831_S_P-B Feature FT:CDS AB073831_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH61). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgktgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073832_S_P-B Feature FT:CDS AB073832_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Th65). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgagtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccgtttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073833_S_P-B Feature FT:CDS AB073833_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi59). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttttyctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073834_S_P-B Feature FT:CDS AB073834_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073835_S_P-B Feature FT:CDS AB073835_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073836_S_P-B Feature FT:CDS AB073836_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw25). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgagtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB073837_S_P-B Feature FT:CDS AB073837_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ku1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcatgggcttccgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB073838_S_P-B Feature FT:CDS AB073838_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ho7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcatggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073839_S_P-B Feature FT:CDS AB073839_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw174). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaccatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggacccactcgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073840_S_P-B Feature FT:CDS AB073840_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw36). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggyggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggytcgtagggctttc
ccccactgtctggctttcagttacatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073841_S_P-B Feature FT:CDS AB073841_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw30). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttacatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073842_S_P-B Feature FT:CDS AB073842_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw11). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttccagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073843_S_P-B Feature FT:CDS AB073843_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw27). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagacttgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcaccactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073844_S_P-B Feature FT:CDS AB073844_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-T11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073845_S_P-B Feature FT:CDS AB073845_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ya16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073846_S_P-B Feature FT:CDS AB073846_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry565). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073847_S_P-B Feature FT:CDS AB073847_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Fu53). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcctggccgaaattcgc
agtcccaaatctccagtcactcaccaatctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttct
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctcagattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073848_S_P-B Feature FT:CDS AB073848_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HUS). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacgcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073849_S_P-B Feature FT:CDS AB073849_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na101). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacaaccgtgtgtcttggccaaaattcgc
agtgccaaatctccagtcactcaccaaccttttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctmtgattccaggatcatcaaccaccagcacgggrccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaartctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073850_S_P-B Feature FT:CDS AB073850_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na102). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaagggatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073851_S_P-B Feature FT:CDS AB073851_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgcttgatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacagctcctgctcaaggaaactttacgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttcttttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggcttttagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073852_S_P-B Feature FT:CDS AB073852_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagagggaccacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073853_S_P-B Feature FT:CDS AB073853_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry24). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggaccccttctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagacttgtggtggacttctctcagttttctaggggaaccacccgtgtgccatggccaaaattcgc
agtgccaaatctgcagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttatgtctttgggtatacatataa
>gnl|hbvcds|AB073854_S_P-B Feature FT:CDS AB073854_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry30). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatctkcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtrtacatttaa
>gnl|hbvcds|AB073855_S_P-B Feature FT:CDS AB073855_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry34). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073856_S_P-B Feature FT:CDS AB073856_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry46). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073857_S_P-B Feature FT:CDS AB073857_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry48). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcgaggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073858_S_P-B Feature FT:CDS AB073858_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Shin). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB100695_S_P-B Feature FT:CDS AB100695_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH133). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgttgtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB106884_S_P-B Feature FT:CDS AB106884_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB115551_S_P-B Feature FT:CDS AB115551_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB15). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgngtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB117759_S_P-B Feature FT:CDS AB117759_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcctggccaaaattcgc
agtcccaaatcttcagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcgaaacccctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB195933_S_P-B Feature FT:CDS AB195933_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB195934_S_P-B Feature FT:CDS AB195934_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB195935_S_P-B Feature FT:CDS AB195935_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205119_S_P-B Feature FT:CDS AB205119_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaatgccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205120_S_P-B Feature FT:CDS AB205120_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctgttgtcctccaatttgccctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggcttccgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205121_S_P-B Feature FT:CDS AB205121_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF720-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagcgtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205122_S_P-B Feature FT:CDS AB205122_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH69-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtttcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcccgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctcctggtatacatttaa
>gnl|hbvcds|AB212625_S_P-B Feature FT:CDS AB212625_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1026). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcgaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgcctctgggtatacatttaa
>gnl|hbvcds|AB212626_S_P-B Feature FT:CDS AB212626_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1022). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggggaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaaaacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgg
ttccctcatgttgctgtacaaaacctacggacagaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB219426_S_P-B Feature FT:CDS AB219426_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4014, PNN1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttatctttgggtatacatctaa
>gnl|hbvcds|AB219427_S_P-B Feature FT:CDS AB219427_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4075, PNN2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaacctacggaaggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttggggaccaagtctgtacaacatcttgagtccgtttatgc
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB219428_S_C-B Feature FT:CDS AB219428_S_C-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4076, PNN3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctctgggtatacatctaa
>gnl|hbvcds|AB219429_S_P-B Feature FT:CDS AB219429_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4101, PNN4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtccaccgatttgtcctggctatcgctggatgtatctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactttcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB219430_S_P-B Feature FT:CDS AB219430_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4148, PNN5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB231909_S_P-B Feature FT:CDS AB231909_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VH10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgctggttcttctggactatcaaggtatgttgcccgtttg
tcctccaattccaggatcatcaaccaccagcactggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232112_S_P-B Feature FT:CDS AB232112_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY808). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaagacctgcacggctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232506_S_P-B Feature FT:CDS AB232506_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TH81). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaagtcctcac
aataccacagagtctagactcgtggtggacttctctcaattctctaggggaaacacccgtgtgtcgtggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaagggacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttattttgtctttgggtatacatttaa
>gnl|hbvcds|AB232519_S_P-B Feature FT:CDS AB232519_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TH62). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB241116_S_P-B Feature FT:CDS AB241116_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC03). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctacgt
ttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcggtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB241117_S_P-B Feature FT:CDS AB241117_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC05). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctacgt
ttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcggtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB246339_S_P-B Feature FT:CDS AB246339_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctatacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246340_S_P-B Feature FT:CDS AB246340_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246341_S_P-B Feature FT:CDS AB246341_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggatcatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246342_S_P-B Feature FT:CDS AB246342_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246343_S_P-B Feature FT:CDS AB246343_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggttgacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253402_S_P-B Feature FT:CDS AB253402_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VC33). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtttgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcataacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253403_S_P-B Feature FT:CDS AB253403_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VC36). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253404_S_P-B Feature FT:CDS AB253404_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VC48). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253405_S_P-B Feature FT:CDS AB253405_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VC58). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB253406_S_P-B Feature FT:CDS AB253406_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VC59). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253410_S_P-B Feature FT:CDS AB253410_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VC63). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253413_S_P-B Feature FT:CDS AB253413_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VC95). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253414_S_P-B Feature FT:CDS AB253414_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VC97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253608_S_P-B Feature FT:CDS AB253608_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TV72). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcgtggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253609_S_P-B Feature FT:CDS AB253609_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TV73). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253610_S_P-B Feature FT:CDS AB253610_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TV77). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggatcatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253613_S_P-B Feature FT:CDS AB253613_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TV85). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctgggtatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253614_S_P-B Feature FT:CDS AB253614_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TV86). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatatggtattgggggccaaatctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttctctttgggtatacatttga
>gnl|hbvcds|AB253616_S_P-B Feature FT:CDS AB253616_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TV88). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatatggtattgggggccaaatctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttctctttgggtatacatttga
>gnl|hbvcds|AB253617_S_P-B Feature FT:CDS AB253617_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TV89). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253618_S_P-B Feature FT:CDS AB253618_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TV91). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tccctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253619_S_P-B Feature FT:CDS AB253619_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TV92). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcgtggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB253621_S_P-B Feature FT:CDS AB253621_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TV94). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggatcatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253622_S_P-B Feature FT:CDS AB253622_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TV95). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287314_S_P-B Feature FT:CDS AB287314_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska433). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287315_S_P-B Feature FT:CDS AB287315_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska419). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287316_S_P-B Feature FT:CDS AB287316_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska427). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggcccaaattcgc
agtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggataatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttatctttgggtatccatttaa
>gnl|hbvcds|AB287317_S_P-B Feature FT:CDS AB287317_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska416). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287318_S_P-B Feature FT:CDS AB287318_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctcgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287319_S_P-B Feature FT:CDS AB287319_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AlaskaG23). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtccacaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287320_S_P-B Feature FT:CDS AB287320_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287321_S_P-B Feature FT:CDS AB287321_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggtctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctttatac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AB287322_S_P-B Feature FT:CDS AB287322_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggagacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacctgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287323_S_P-B Feature FT:CDS AB287323_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaatgcccgggtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggtctttc
ccccactgtatggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgaggccatttacac
cgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AB287324_S_P-B Feature FT:CDS AB287324_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-5). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=681 residues).
atggagaacatcgtatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttctctagggggaacacccgtgtgtcttggccaaaatttgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatctgtcctggttatccctggatgtgtcggcggcgtttt
atcatctccctttacatcctgctgctatgcctcatcttctcgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttt
ccccactgtctggctttcagttatatggatgatttggtattgggggccaagtctgaacaccatcttgagtccctttatgc
cgcggttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287325_S_P-B Feature FT:CDS AB287325_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggagacaaccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaagggacctctatgt
ttccctcatgttgttgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaaatctgtgcaccatcttgagtccctttatgc
cgctgttaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|AB287326_S_P-B Feature FT:CDS AB287326_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A44). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacatctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|AB287327_S_P-B Feature FT:CDS AB287327_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A53). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaatctccaatcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatataa
>gnl|hbvcds|AB287328_S_P-B Feature FT:CDS AB287328_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba 51). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctatacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287329_S_P-B Feature FT:CDS AB287329_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba A55). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaaaacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB289695_S_P-B Feature FT:CDS AB289695_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB289696_S_P-B Feature FT:CDS AB289696_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB289713_S_P-B Feature FT:CDS AB289713_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 22). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtatggggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB289730_S_P-B Feature FT:CDS AB289730_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 39). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcactggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB289732_S_P-B Feature FT:CDS AB289732_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 41). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB289738_S_P-B Feature FT:CDS AB289738_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 47). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaagatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtanggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB300364_S_P-B Feature FT:CDS AB300364_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300370_S_P-B Feature FT:CDS AB300370_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcatttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcacggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB300371_S_P-B Feature FT:CDS AB300371_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient13). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttacccgtttg
tcctatgatacccggatcatcaacaaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggacgatgtggttttgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB302095_S_P-B Feature FT:CDS AB302095_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcgtggccaaaattcgc
agtcccaaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaaactcttcga
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcgtcatgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtcccttcatgc
cgctgttaccaattttcttatgtctttgggtatacatttga
>gnl|hbvcds|AB302942_S_P-B Feature FT:CDS AB302942_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3837NN). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaaccaccagcaccggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB302943_S_P-B Feature FT:CDS AB302943_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3639NN). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaaccaccagcaccggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB302944_S_P-B Feature FT:CDS AB302944_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3641NN). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaaccaccagcaccggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB302945_S_P-B Feature FT:CDS AB302945_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3643NN). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaaccaccagcaccggaacatgcaaaacctgcacgactcctgttcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB362933_S_P-B Feature FT:CDS AB362933_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacaaccgagtgtcttggccaaaattcgc
agttccaaatctccaatcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccacaagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AB365441_S_P-B Feature FT:CDS AB365441_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BOL431). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgc
agtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB365445_S_P-B Feature FT:CDS AB365445_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BOL1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB368295_S_P-B Feature FT:CDS AB368295_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB471854_S_P-B Feature FT:CDS AB471854_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-F). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagaggctagactcgtggtggaattctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB471855_S_P-B Feature FT:CDS AB471855_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-C). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB493827_S_P-B Feature FT:CDS AB493827_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25UC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB493833_S_P-B Feature FT:CDS AB493833_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P9). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttatctttgggtattcatttaa
>gnl|hbvcds|AB493835_S_P-B Feature FT:CDS AB493835_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P30). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB555498_S_P-B Feature FT:CDS AB555498_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA41). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaaaacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB555499_S_P-B Feature FT:CDS AB555499_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA62). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcccaggacacctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB642093_S_P-B Feature FT:CDS AB642093_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagacttgtggtggacttctctcaattttctaggggaaacacccgtgtgtcytggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccmatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tccyctgattccaggatcatcaaccaccagcacgggaccatgcaaaacmtgcacaactcctgctcaaggaacctctatgt
ttccctcatgctgytgtacaaaacctacggacggaaactgcacctgtattcccatcccatcrtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggaygatrtkgttttgggggccaagwctgstcaacatcttgagtccctttatgc
cgctgttaccaattttcttwtgtctttgggtatacatttaa
>gnl|hbvcds|AB642094_S_P-B Feature FT:CDS AB642094_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacractactgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB642101_S_P-B Feature FT:CDS AB642101_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT2009-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttcgaggggaagcacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcactaacctgctgtccaccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttgggtcttctggactaccacggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB675676_S_P-B Feature FT:CDS AB675676_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10A37). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB713527_S_P-B Feature FT:CDS AB713527_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv30). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcatggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB713528_S_P-B Feature FT:CDS AB713528_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv44). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB713529_S_P-B Feature FT:CDS AB713529_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv68). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB713530_S_P-B Feature FT:CDS AB713530_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv94). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactctatgt
ttccctcatggtgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctctgggctcagtttactagtgccatttgttcagtggttcgtagggctttc
cccccctgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB713531_S_P-B Feature FT:CDS AB713531_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv98). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaagacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggcttgc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB713532_S_P-B Feature FT:CDS AB713532_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv132). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatccggctgctatggcccaacttcttgtgggttcttctggacaaataaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcatggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB809488_S_P-B Feature FT:CDS AB809488_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaagtcccgtgtgtcttggccaaaattcgc
agtcccaaatctgcagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttattggctcttctggactctcaaggtatgttgcccacttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccacaatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtgcaccatcttgaggccctttatac
cgctgttaccaattttctgttgtctttgggtatacatt
>gnl|hbvcds|AB809524_S_P-B Feature FT:CDS AB809524_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ibaragi-s-2006). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcatggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttct
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgcctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809526_S_P-B Feature FT:CDS AB809526_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Iwate-S-2006). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809529_S_P-B Feature FT:CDS AB809529_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Aichi1-S-2006). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggcgtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809547_S_P-B Feature FT:CDS AB809547_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Hokkaido-S-2009). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagaatctagacttgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaacctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtagcccgtttg
tcctctgattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacatctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttggggtccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttatgtctttgggtatacatt
>gnl|hbvcds|AB809552_S_P-B Feature FT:CDS AB809552_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Aichi2-S-2011). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacaaccgtgtgtcttggccaaaattcgc
agtgccaaatctccagtcactcaccaaccttttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB828708_S_P-B Feature FT:CDS AB828708_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HB12-0626). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcctgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaytgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatytaa
>gnl|hbvcds|AB900095_S_P-B Feature FT:CDS AB900095_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctgcagtcacttaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttatgc
cgctgttaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|AB900096_S_P-B Feature FT:CDS AB900096_S_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttccagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagaccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB900097_S_P-B Feature FT:CDS AB900097_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttg
tccyctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctwtgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AB900098_S_P-B Feature FT:CDS AB900098_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgygttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB900102_S_P-B Feature FT:CDS AB900102_S_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattggggkccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900103_S_P-B Feature FT:CDS AB900103_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggacaaccgtgtgtcttggccaaaattcgc
agtcccaaatctgcagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900104_S_P-B Feature FT:CDS AB900104_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900105_S_P-B Feature FT:CDS AB900105_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtgccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcrctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900106_S_P-B Feature FT:CDS AB900106_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgttttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaaccaccagcacgggaccatgcaagacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900107_S_P-B Feature FT:CDS AB900107_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctaac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccctgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttctttgttctttgggtatacatataa
>gnl|hbvcds|AB900108_S_P-B Feature FT:CDS AB900108_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900110_S_P-B Feature FT:CDS AB900110_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900111_S_P-B Feature FT:CDS AB900111_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtttctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcraccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaccatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900112_S_P-B Feature FT:CDS AB900112_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttggktctttgggtatacatttaa
>gnl|hbvcds|AB931168_S_P-B Feature FT:CDS AB931168_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1P_HB11-1417). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttctctaggggtaccacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttct
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctgattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB931169_S_P-B Feature FT:CDS AB931169_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1S_HB11-1418). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttctctaggggtaccacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctgattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtgcaacatcttgagtccctttatgc
cgctgttaccaattttctgttgtctttgggtattcatttaa
>gnl|hbvcds|AB976562_S_P-B Feature FT:CDS AB976562_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AK8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cggtgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF013629_S_P-B Feature FT:CDS AF013629_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggccggaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaatttctttttgtctttgggtatacatttga
>gnl|hbvcds|AF013630_S_P-B Feature FT:CDS AF013630_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaagatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggccggaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaatttctttttgtctttgggtatacatttga
>gnl|hbvcds|AF061527_S_P-B Feature FT:CDS AF061527_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xf8298). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccatcctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF100308_S_P-B Feature FT:CDS AF100308_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF100309_S_P-B Feature FT:CDS AF100309_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121243_S_P-B Feature FT:CDS AF121243_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/14611). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121244_S_P-B Feature FT:CDS AF121244_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/15122). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121245_S_P-B Feature FT:CDS AF121245_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/16091). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121246_S_P-B Feature FT:CDS AF121246_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/IK29902). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121247_S_P-B Feature FT:CDS AF121247_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/719). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacrrctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgyaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121248_S_P-B Feature FT:CDS AF121248_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/139-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121249_S_P-B Feature FT:CDS AF121249_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/4014). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121250_S_P-B Feature FT:CDS AF121250_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/6395). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaagactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121251_S_P-B Feature FT:CDS AF121251_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/9873). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggcaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtgcaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF134137_S_P-B Feature FT:CDS AF134137_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=687 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgttttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctgaactaccaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaggaacacaacctgcacgactcctgctcaaggaacct
ctatgtttccctcatgttgctgtacaaaacctacggacagaaactgcacctgtattcccatcccatcatcttgggctttc
gcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagg
gctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccct
ttatgccgctgttaccaattttctatggtctttgggtatacatttaa
>gnl|hbvcds|AF279464_S_P-B Feature FT:CDS AF279464_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF282917_S_P-B Feature FT:CDS AF282917_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcactggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AF282918_S_P-B Feature FT:CDS AF282918_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF397207_S_P-B Feature FT:CDS AF397207_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF411291_S_P-B Feature FT:CDS AF411291_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtctt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacccgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF415217_S_P-B Feature FT:CDS AF415217_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaagaaactccacgc
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattdccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccctactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF415222_S_P-B Feature FT:CDS AF415222_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 24). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=687 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaacggggaacctgcacaactcctgctcaaggaacct
ctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttc
gcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagg
gctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccct
ttatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF461360_S_P-B Feature FT:CDS AF461360_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH14-2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF461362_S_P-B Feature FT:CDS AF461362_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH10). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgtgacaggcggggtttttcttgttgacaaaagtcctcac
aataccacagagtctagactcgtggtagacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcactggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF479684_S_P-B Feature FT:CDS AF479684_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3c). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ627225_S_P-B Feature FT:CDS AJ627225_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 19749). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagacttgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggcacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011084_S_P-B Feature FT:CDS AP011084_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggtccgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011085_S_P-B Feature FT:CDS AP011085_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcattttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011086_S_P-B Feature FT:CDS AP011086_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctatgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatat
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AP011087_S_P-B Feature FT:CDS AP011087_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctatgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AP011088_S_P-B Feature FT:CDS AP011088_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011089_S_P-B Feature FT:CDS AP011089_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011090_S_P-B Feature FT:CDS AP011090_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AP011091_S_P-B Feature FT:CDS AP011091_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AP011092_S_P-B Feature FT:CDS AP011092_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011093_S_P-B Feature FT:CDS AP011093_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttattcagtggttcgtagggctttc
ccccactgtctggctttcagttctatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011094_S_P-B Feature FT:CDS AP011094_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AP011095_S_P-B Feature FT:CDS AP011095_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011096_S_P-B Feature FT:CDS AP011096_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AY033072_S_P-B Feature FT:CDS AY033072_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggacggaaactgcacatgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY033073_S_P-B Feature FT:CDS AY033073_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggacggaaactgcacatgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatagtgatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY163869_S_P-B Feature FT:CDS AY163869_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMClx-1). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaacaaccagcacgggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY163870_S_P-B Feature FT:CDS AY163870_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMU001). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaacaaccagcacgggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167089_S_P-B Feature FT:CDS AY167089_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY167093_S_P-B Feature FT:CDS AY167093_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIa). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgactccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167094_S_P-B Feature FT:CDS AY167094_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIb). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggnaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacanctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167097_S_P-B Feature FT:CDS AY167097_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIIb). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167098_S_P-B Feature FT:CDS AY167098_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IVa). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AY167100_S_P-B Feature FT:CDS AY167100_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Va). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgtatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatccttac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167101_S_P-B Feature FT:CDS AY167101_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vb). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttctctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167102_S_P-B Feature FT:CDS AY167102_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vc). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaatacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgacgcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccattatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206373_S_P-B Feature FT:CDS AY206373_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtctgtttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206375_S_P-B Feature FT:CDS AY206375_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaaccgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206383_S_P-B Feature FT:CDS AY206383_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggggacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206387_S_P-B Feature FT:CDS AY206387_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctggttgacaaaaatcctcac
aataccacagagtctagacttgtggtggacttctctcagttttctagggggaccacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactttcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggagcatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacgcaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206390_S_P-B Feature FT:CDS AY206390_S_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacgtttaa
>gnl|hbvcds|AY206391_S_P-B Feature FT:CDS AY206391_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcgtcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggcacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217355_S_P-B Feature FT:CDS AY217355_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A6-2). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217356_S_P-B Feature FT:CDS AY217356_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A9-2). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217357_S_P-B Feature FT:CDS AY217357_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1r-4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217358_S_P-B Feature FT:CDS AY217358_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B8r-4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217359_S_P-B Feature FT:CDS AY217359_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Q6-5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgcttgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgttcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217360_S_P-B Feature FT:CDS AY217360_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6-4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217361_S_P-B Feature FT:CDS AY217361_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-2). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttaagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217362_S_P-B Feature FT:CDS AY217362_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-4). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217364_S_P-B Feature FT:CDS AY217364_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 586). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacgactcctgctcaatgaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatttggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217368_S_P-B Feature FT:CDS AY217368_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 21949). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaagctatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttttctttgggcatacatttaa
>gnl|hbvcds|AY220697_S_P-B Feature FT:CDS AY220697_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttaccggcggggttttccttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcgtggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatttggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY220698_S_P-B Feature FT:CDS AY220698_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatttggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY220703_S_P-B Feature FT:CDS AY220703_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AY220704_S_P-B Feature FT:CDS AY220704_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatcgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY293309_S_P-B Feature FT:CDS AY293309_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY517489_S_P-B Feature FT:CDS AY517489_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY517619_S_P-B Feature FT:CDS AY517619_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY518556_S_P-B Feature FT:CDS AY518556_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 57-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596102_S_P-B Feature FT:CDS AY596102_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596103_S_P-B Feature FT:CDS AY596103_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596104_S_P-B Feature FT:CDS AY596104_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596105_S_P-B Feature FT:CDS AY596105_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-5). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596106_S_P-B Feature FT:CDS AY596106_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596109_S_P-B Feature FT:CDS AY596109_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-1). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacttctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY596110_S_P-B Feature FT:CDS AY596110_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596111_S_P-B Feature FT:CDS AY596111_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-3). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacttctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacagcatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AY596112_S_P-B Feature FT:CDS AY596112_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738926_S_P-B Feature FT:CDS AY738926_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccgtttgttcagtggtttgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AY738927_S_P-B Feature FT:CDS AY738927_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattctc
agtcccaaatctccagtcactcaccaacgtgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacttgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738928_S_P-B Feature FT:CDS AY738928_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgtttcgtagggctttc
cccctctgtcgggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738929_S_P-B Feature FT:CDS AY738929_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738930_S_P-B Feature FT:CDS AY738930_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738931_S_P-B Feature FT:CDS AY738931_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacactgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggcaggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738932_S_P-B Feature FT:CDS AY738932_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaagtcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtcgttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738933_S_P-B Feature FT:CDS AY738933_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcactggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738934_S_P-B Feature FT:CDS AY738934_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738935_S_P-B Feature FT:CDS AY738935_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacataacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738936_S_P-B Feature FT:CDS AY738936_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738937_S_P-B Feature FT:CDS AY738937_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggagtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738938_S_P-B Feature FT:CDS AY738938_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738939_S_P-B Feature FT:CDS AY738939_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcactggttcgtagggctttc
ccacattgtctggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY766463_S_P-B Feature FT:CDS AY766463_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctccaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcaccttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaccgtctggctttcagttatatggatgatgtggttttggggaccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY800389_S_P-B Feature FT:CDS AY800389_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041024). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY800391_S_P-B Feature FT:CDS AY800391_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041026). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcatggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgacgcctgctcaaggaaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY800392_S_P-B Feature FT:CDS AY800392_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041027). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcatggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgacgcctgctcaaggaaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D00329_S_P-B Feature FT:CDS D00329_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D00330_S_P-B Feature FT:CDS D00330_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D00331_S_C-B Feature FT:CDS D00331_S_C-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aatacctctgagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacaggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D23678_S_P-B Feature FT:CDS D23678_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-HBVYS2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D23679_S_P-B Feature FT:CDS D23679_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-HBVMS2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacggggccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D50521_S_P-B Feature FT:CDS D50521_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgaccaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttccagggggcacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttggccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcgaaacacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttacccattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|D50522_S_P-B Feature FT:CDS D50522_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgaccaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttggccgtttg
tcccctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggcacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141615_S_P-B Feature FT:CDS DQ141615_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH45AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141616_S_P-B Feature FT:CDS DQ141616_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061Chinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141617_S_P-B Feature FT:CDS DQ141617_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH16AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141618_S_P-B Feature FT:CDS DQ141618_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH21AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagggtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgttgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141619_S_P-B Feature FT:CDS DQ141619_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH38AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141620_S_P-B Feature FT:CDS DQ141620_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH30AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141621_S_P-B Feature FT:CDS DQ141621_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH42AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtggtacaggaggggattttctcgttgacaaaaatcctcac
aataccacagagtctagaatcggggtggacttctctcaattttctaggggaaacacccgtgggtcttggtcaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgggtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggaatgttgcccgcttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141622_S_P-B Feature FT:CDS DQ141622_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1839Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141623_S_P-B Feature FT:CDS DQ141623_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1877Chinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141624_S_P-B Feature FT:CDS DQ141624_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2069Chinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141625_S_P-B Feature FT:CDS DQ141625_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2360Chinese). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgaacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141626_S_P-B Feature FT:CDS DQ141626_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2175Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacaaagtctaaactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttggtgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctccatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141627_S_P-B Feature FT:CDS DQ141627_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2059Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141628_S_P-B Feature FT:CDS DQ141628_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH44AJava). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141629_S_P-B Feature FT:CDS DQ141629_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2028Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141630_S_P-B Feature FT:CDS DQ141630_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH24AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141631_S_P-B Feature FT:CDS DQ141631_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1932Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141632_S_P-B Feature FT:CDS DQ141632_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIHM1Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141633_S_P-B Feature FT:CDS DQ141633_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIHM2Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141634_S_P-B Feature FT:CDS DQ141634_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIHM4Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|DQ141635_S_P-B Feature FT:CDS DQ141635_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH27AJava). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgtggctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141636_S_P-B Feature FT:CDS DQ141636_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH31AJava). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcggggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacaactcctgcacaaggaacctctatgt
ttccctcttgtggctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141637_S_P-B Feature FT:CDS DQ141637_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH32Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggctttgggggccaagtctggacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141638_S_P-B Feature FT:CDS DQ141638_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr026East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcacaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141639_S_P-B Feature FT:CDS DQ141639_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr056East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatccctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagccccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ141640_S_P-B Feature FT:CDS DQ141640_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr178East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttacatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141641_S_P-B Feature FT:CDS DQ141641_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2077Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagggccatttgttcaggggttcgtagggctttc
ccccactgtcgggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ141642_S_P-B Feature FT:CDS DQ141642_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2052Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaccatcttgagtccatttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ141643_S_P-B Feature FT:CDS DQ141643_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2050Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ141644_S_P-B Feature FT:CDS DQ141644_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1813Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141645_S_P-B Feature FT:CDS DQ141645_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIHM3Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141646_S_P-B Feature FT:CDS DQ141646_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH43AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgaccaccagcaccgggccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttgctagcgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141647_S_P-B Feature FT:CDS DQ141647_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr001East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgaatccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141648_S_P-B Feature FT:CDS DQ141648_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr029East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctggacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141649_S_P-B Feature FT:CDS DQ141649_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr040East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcctctggactatcaaggtatgttgcccgtttg
tcctctaattccaggattatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
tttcctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctctgggtatacatataa
>gnl|hbvcds|DQ141650_S_P-B Feature FT:CDS DQ141650_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr049East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgaatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggagtttt
atcatcttcctttgcatcctgctgctatgcctcatgttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatccaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ141651_S_P-B Feature FT:CDS DQ141651_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr052East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagactagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctattcctaatcttcttgttggttctcctggactatcaaggtatgttgcccctttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgaatccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141652_S_P-B Feature FT:CDS DQ141652_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr060East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatccaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141653_S_P-B Feature FT:CDS DQ141653_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KD48East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacaactcctgctcaaggaatctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141654_S_P-B Feature FT:CDS DQ141654_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SBT19East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaacatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141655_S_P-B Feature FT:CDS DQ141655_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KD35East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcacgactcccacgacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacaaagtctagactcgtggtggacttctctcaattttctaaggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggactttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ361535_S_P-B Feature FT:CDS DQ361535_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CRP-228). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaaactcttcgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtgcaacatcttgagtccctttgtac
cgctgttaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|DQ377158_S_P-B Feature FT:CDS DQ377158_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WJT31). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412176_S_P-B Feature FT:CDS DQ412176_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate e05010937). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggcttttagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtctacatctaa
>gnl|hbvcds|DQ412177_S_P-B Feature FT:CDS DQ412177_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s02004200). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcarttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgaggccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412178_S_P-B Feature FT:CDS DQ412178_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s02009123). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412179_S_P-B Feature FT:CDS DQ412179_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s02011109). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttyt
atcatmttcctctgcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaagggacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412180_S_P-B Feature FT:CDS DQ412180_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s02012947). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|DQ412181_S_P-B Feature FT:CDS DQ412181_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s02015689). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgtatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412182_S_P-B Feature FT:CDS DQ412182_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s02015693). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgawttgtcctggttatcgctggatgtmtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatrc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412183_S_P-B Feature FT:CDS DQ412183_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s02022147). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaaccctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgcgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412184_S_P-B Feature FT:CDS DQ412184_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S02023964). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacsggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412185_S_P-B Feature FT:CDS DQ412185_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s02023969). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggacacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|DQ412186_S_P-B Feature FT:CDS DQ412186_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s03000368). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccccagagtctagactcgtgggggacttctctcagttttctagggggaacacccgagtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggrccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412187_S_P-B Feature FT:CDS DQ412187_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s03000466). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412188_S_P-B Feature FT:CDS DQ412188_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s03000569). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgawgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412189_S_P-B Feature FT:CDS DQ412189_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S03003845). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccatttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412190_S_P-B Feature FT:CDS DQ412190_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s03006674). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgc
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412191_S_P-B Feature FT:CDS DQ412191_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s03008348). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccctgcaaaacctgcacaactcctgctcaaggcacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412192_S_P-B Feature FT:CDS DQ412192_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s03009620). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctaac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctcgaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatga
atccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgctcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412193_S_P-B Feature FT:CDS DQ412193_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S03010981). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgy
ttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412194_S_P-B Feature FT:CDS DQ412194_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s03017068). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctcaaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412195_S_P-B Feature FT:CDS DQ412195_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s03017071). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcacttaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctctatgt
ttccctcatgttgctgkacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412196_S_P-B Feature FT:CDS DQ412196_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s03022048). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcawcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtayaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatrc
cgctgttaccaattttcttttgtctttgggyatacatttaa
>gnl|hbvcds|DQ412197_S_P-B Feature FT:CDS DQ412197_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s03023231). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcatcgaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412198_S_P-B Feature FT:CDS DQ412198_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s03024903). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttccagggggaacacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaycttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|DQ412199_S_P-B Feature FT:CDS DQ412199_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s04002705). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagagggaacacccgtgtgtcgtggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412200_S_P-B Feature FT:CDS DQ412200_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s04003304). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaawttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacsggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttggggaccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412201_S_P-B Feature FT:CDS DQ412201_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s04008402). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacaccttgagtccatttattc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412202_S_P-B Feature FT:CDS DQ412202_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s04010861). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggraaacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412203_S_P-B Feature FT:CDS DQ412203_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s04012012). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctccatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaartctgtacaacaycttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412204_S_P-B Feature FT:CDS DQ412204_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s04013165). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgttgtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttttctttgggtatacatttaa
>gnl|hbvcds|DQ412205_S_P-B Feature FT:CDS DQ412205_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s04018516). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggytcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412206_S_P-B Feature FT:CDS DQ412206_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s04018517). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412207_S_P-B Feature FT:CDS DQ412207_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s04019583). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtggtaccggcggggttttccttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccacgagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaccatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtattcatttaa
>gnl|hbvcds|DQ412208_S_P-B Feature FT:CDS DQ412208_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s04024459). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgcggtacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacractcctgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412209_S_P-B Feature FT:CDS DQ412209_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s05003009). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcarttttctaggggaaccacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactttcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatatgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412211_S_P-B Feature FT:CDS DQ412211_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s05008025). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412212_S_P-B Feature FT:CDS DQ412212_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s05008455). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412213_S_P-B Feature FT:CDS DQ412213_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S05008970). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacatgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412214_S_P-B Feature FT:CDS DQ412214_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s05010384). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcgtggccaaaattcgc
agtcccaaatctccagtcactcactaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactctayga
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412215_S_P-B Feature FT:CDS DQ412215_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s04026375). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412216_S_P-B Feature FT:CDS DQ412216_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S05011425). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcay
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctrattccaggatcatcaacraccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgytgtayaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412217_S_P-B Feature FT:CDS DQ412217_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s05004976). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctamttccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412218_S_P-B Feature FT:CDS DQ412218_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s02001724). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412219_S_P-B Feature FT:CDS DQ412219_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s03006573). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412220_S_P-B Feature FT:CDS DQ412220_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S05016360). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatckcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgyaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatctaa
>gnl|hbvcds|DQ412221_S_P-B Feature FT:CDS DQ412221_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s05017887). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagagtcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412222_S_P-B Feature FT:CDS DQ412222_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s05021369). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaagtcctcac
aataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttggggtccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412223_S_P-B Feature FT:CDS DQ412223_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s05021810). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaacctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttct
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412224_S_P-B Feature FT:CDS DQ412224_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s05023212). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcatggccaaaattcgc
agtcccaaatctccagtcacttaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccctgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaccatcttgagtccgtttatgc
ctctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|DQ412225_S_P-B Feature FT:CDS DQ412225_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s05024254). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgagtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgcacaacatcttgagtccatttatgc
cgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|DQ412226_S_P-B Feature FT:CDS DQ412226_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s06000630). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgtatcaggactcctaaaacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgcctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412227_S_P-B Feature FT:CDS DQ412227_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate s06000633). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggcttttagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ412228_S_P-B Feature FT:CDS DQ412228_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S06002112). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggytttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448619_S_P-B Feature FT:CDS DQ448619_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYH). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448620_S_P-B Feature FT:CDS DQ448620_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYF). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448621_S_P-B Feature FT:CDS DQ448621_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-HQY). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448622_S_P-B Feature FT:CDS DQ448622_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-JSM). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatccggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448623_S_P-B Feature FT:CDS DQ448623_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-LMX). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448624_S_P-B Feature FT:CDS DQ448624_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-QSA). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448625_S_P-B Feature FT:CDS DQ448625_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-TXB). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448626_S_P-B Feature FT:CDS DQ448626_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-XLB). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448627_S_P-B Feature FT:CDS DQ448627_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZFL). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448628_S_P-B Feature FT:CDS DQ448628_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZX). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ463787_S_P-B Feature FT:CDS DQ463787_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_1979). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaattcgc
agttccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttatac
cgctgttaccaattttcttatgtctttgggtatacatttga
>gnl|hbvcds|DQ463788_S_P-B Feature FT:CDS DQ463788_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_1979). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463789_S_P-B Feature FT:CDS DQ463789_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_1979). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatccggactcctaggacccctgctcgtgttacaggcggggtttttcttgtkgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttct
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ463790_S_P-B Feature FT:CDS DQ463790_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_1979). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcctcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463791_S_P-B Feature FT:CDS DQ463791_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_1979). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggacacacccgtgtgtcctggccaaaattcgc
agtcccaaatctgcagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggctcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcgaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggcttttagttatatggatgatgtggtcttgggggccaaatctgtgcaacaccttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463792_S_P-B Feature FT:CDS DQ463792_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_1979). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggagacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463793_S_P-B Feature FT:CDS DQ463793_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_1979). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacttgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463794_S_P-B Feature FT:CDS DQ463794_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_1979). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaaccacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463795_S_P-B Feature FT:CDS DQ463795_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_2004). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aacaccgcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgagtgtcttggccaaaattcgc
agttccaaatctccaatcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccgtgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtgcaacaccttgagtcgctttgtac
cgctgtttccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463796_S_P-B Feature FT:CDS DQ463796_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_2004). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcactggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463797_S_P-B Feature FT:CDS DQ463797_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_2004). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatccggactcctaggacccctgctcgtgttacaggcggggtttttcttgtkgacaaaaatcctcac
aataccgcagagtctagacttgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatacctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgcgcaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ463798_S_P-B Feature FT:CDS DQ463798_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_2004). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463799_S_P-B Feature FT:CDS DQ463799_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_2004). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggacacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggcttccgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttatgc
cgctgttacccattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|DQ463800_S_P-B Feature FT:CDS DQ463800_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_2004). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggagacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacaccttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463801_S_P-B Feature FT:CDS DQ463801_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_2004). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaaaacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacttgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463802_S_P-B Feature FT:CDS DQ463802_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_2004). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgccacatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ904357_S_P-B Feature FT:CDS DQ904357_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtgtacatataa
>gnl|hbvcds|DQ975271_S_P-B Feature FT:CDS DQ975271_S_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctgaatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgtaggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993680_S_P-B Feature FT:CDS DQ993680_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 268). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993681_S_P-B Feature FT:CDS DQ993681_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 290). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|DQ993682_S_P-B Feature FT:CDS DQ993682_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 479). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcgtggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993683_S_P-B Feature FT:CDS DQ993683_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 82). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ993684_S_P-B Feature FT:CDS DQ993684_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 336). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactccaaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaatccctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattccc
agtcccaaatctccagtcactcaccaacttgttgtcctcccgattgtcctggttatccccggatgtgtctgcggggtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993685_S_P-B Feature FT:CDS DQ993685_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 554). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993686_S_P-B Feature FT:CDS DQ993686_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 342). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcctggccaaaattcgc
agtcccaaatcttcagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcgaaacccctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993687_S_P-B Feature FT:CDS DQ993687_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 700). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcrcatcaggactcctrggacccctgctcgtgttacargcggggtttttctcgttgacaaaaatcctcac
aataccacagagkctagactcgtggtggacttctctcaattttccagggggaacacccgtgtgtcttggccaaaattcrc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcgcatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactattgccatttgttcagtggttcgtaaggctttc
ccccactgtctggttttcagttatatggatgatgtggaattgggggccaagtctgtacaaaatcgggagtccctttatgc
cgctgttacccattttcttttgtcyttsggwattcatttaa
>gnl|hbvcds|DQ993694_S_P-B Feature FT:CDS DQ993694_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 234). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcstcac
aataccacagagkctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcrc
agtcccaaatctccagtcactcaccaacttgttgtcctcccatttgtcctggatatcgctggatgtgtctgcggcgttct
atcatcttcctctgcatcctgctgctatgcctcatcttggtgttggttcttctggactatcaaggtatgttgctcgtttg
tcctctaattcccggatcatcaaccacctacaccggaccatggagaacctgcatgactcctggtgaaggaacctctatgt
ttccctcatgttgctgtacaaaacctaccaacggaaactgcacctgtagtcccatctcatcatcatggactttcgcaaaa
tacctatggtagtgggccaccgtccgtttctctaggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993696_S_P-B Feature FT:CDS DQ993696_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 452b1). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtgggggacttctctaaattttctggtgggagcacccgtgtgtcttgaccaaaattcgc
agtccccaatctccagtcactcaccaacctgttgtcctcccatttgtcctgattatccctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgatggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatggaatacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcgcctgtattcccgtcccatcatcttgggctttcccaaaa
tacctatgggagtgggcctcagttcgtttctcttggctcggtttactagtgccatttgttcagtggttcgtaaggctttc
cccccttgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatgc
csctgttaccawttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993697_S_P-B Feature FT:CDS DQ993697_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 940b1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgttcaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993698_S_P-B Feature FT:CDS DQ993698_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0327-ETCvs3TC-Naive). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttctctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcagaagctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993699_S_P-B Feature FT:CDS DQ993699_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0226-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttctctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcagaagctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993700_S_P-B Feature FT:CDS DQ993700_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0725-ETC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgcaatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggaagatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993701_S_P-B Feature FT:CDS DQ993701_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0210-ETCvs3TC-Brack). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ993702_S_P-B Feature FT:CDS DQ993702_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0919-ETCvs3TC-Naive). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggagtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
caccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacctttaa
>gnl|hbvcds|DQ993703_S_P-B Feature FT:CDS DQ993703_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 236-0526-Nature1.2-Sero). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993704_S_P-B Feature FT:CDS DQ993704_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-1127-Nature3.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993705_S_P-B Feature FT:CDS DQ993705_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0625-Nature3.4-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttaccggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccatatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgccgcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993706_S_P-B Feature FT:CDS DQ993706_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0402-Nature3.3-unSero). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993707_S_P-B Feature FT:CDS DQ993707_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-O218-Nature3.2-unSero). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993708_S_P-B Feature FT:CDS DQ993708_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-1228-Naive). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993709_S_P-B Feature FT:CDS DQ993709_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-0127-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993710_S_P-B Feature FT:CDS DQ993710_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0718-ETC). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttctctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccatttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993711_S_P-B Feature FT:CDS DQ993711_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 221-1120-Nature1.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggnaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgactcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995801_S_P-B Feature FT:CDS DQ995801_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H60-6). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtctctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
ccctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtgcaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995802_S_P-B Feature FT:CDS DQ995802_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H293-16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacgggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaatacccgtgtgtcttggccaaaattcgc
agtccccaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgccggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaatctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagttccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995803_S_P-B Feature FT:CDS DQ995803_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C265-15). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtttctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgattcgtagggctttc
ccccactgtctggcttttagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995804_S_P-B Feature FT:CDS DQ995804_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1691-11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcggttttccaggggggacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatgc
cgctgttactcattctcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995805_S_P-B Feature FT:CDS DQ995805_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H60-2.5KB). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatctcatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtctactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF134945_S_P-B Feature FT:CDS EF134945_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaagaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF134946_S_P-B Feature FT:CDS EF134946_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaagaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF473971_S_P-B Feature FT:CDS EF473971_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2059Java). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF473972_S_P-B Feature FT:CDS EF473972_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1839Java). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF473973_S_P-B Feature FT:CDS EF473973_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH45AChinese). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF473974_S_P-B Feature FT:CDS EF473974_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH21AChinese). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagggtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgttgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF473975_S_P-B Feature FT:CDS EF473975_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061Chinese). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF473976_S_P-B Feature FT:CDS EF473976_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr049East). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgaatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggagtttt
atcatcttcctttgcatcctgctgctatgcctcatgttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatccaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EF473977_S_P-B Feature FT:CDS EF473977_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KD048East). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacaactcctgctcaaggaatctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF494380_S_P-B Feature FT:CDS EF494380_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW836). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttct
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcgcctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF494381_S_P-B Feature FT:CDS EF494381_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW936). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatagcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatctgcttgttgggtcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacgggaactgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF494382_S_P-B Feature FT:CDS EF494382_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TWD347). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgtcacaggcagggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggagacacccgtgtgtcgtggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccggcacgggaccatgcaaaacctgcacgagtcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU075308_S_P-B Feature FT:CDS EU075308_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacttctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggcgaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU131110_S_P-B Feature FT:CDS EU131110_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs1). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatccgcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactacaaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaagcctgcacaactcctgcccaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtaatcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcacttgtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU131111_S_P-B Feature FT:CDS EU131111_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs2). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcac
agtcctaaatctccagtcactcaccaatctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggacttgaaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggcgtgtgcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU131112_S_P-B Feature FT:CDS EU131112_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaatctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggacttgaaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggcgtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU131113_S_P-B Feature FT:CDS EU131113_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU131114_S_P-B Feature FT:CDS EU131114_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs6). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccgacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactctacgt
ttccctcatgttgctgtacaaaacctacggacagcaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagtaatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttctttagtctttgggtatacatttaa
>gnl|hbvcds|EU131115_S_P-B Feature FT:CDS EU131115_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs8). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccgatttgtcctggttatcgctggatgtgtctgaggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
tcccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU131117_S_P-B Feature FT:CDS EU131117_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs11). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU131118_S_P-B Feature FT:CDS EU131118_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaatctattgtcctccaatttgtcctggttatcgctggatgtgcctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggacttgaaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggcgtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU131119_S_P-B Feature FT:CDS EU131119_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs13). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
tgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU131120_S_P-B Feature FT:CDS EU131120_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs14). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggttcttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU131121_S_P-B Feature FT:CDS EU131121_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs15). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtctaggccaaaattcgc
agtctcaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcgcaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctctcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU131123_S_P-B Feature FT:CDS EU131123_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs17). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtttagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggagcctctatgt
ttccctcatgttgctgtacaaaacctacggacagaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU131124_S_P-B Feature FT:CDS EU131124_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs18). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcctgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgccgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU131125_S_P-B Feature FT:CDS EU131125_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs19). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU131126_S_P-B Feature FT:CDS EU131126_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs20). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctactgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacagccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacattttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU131127_S_P-B Feature FT:CDS EU131127_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs22). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaacagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatga
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU131128_S_P-B Feature FT:CDS EU131128_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs24). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaatctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctccgcatcctgctgctatgcctcatcttcttgttggttcttctggacttgaaaggtatgttgcccgtctg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacagacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggcgtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU131129_S_P-B Feature FT:CDS EU131129_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs25). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactacacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU131130_S_P-B Feature FT:CDS EU131130_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate xs27). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggaacatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139529_S_P-B Feature FT:CDS EU139529_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate hwd-24). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaacagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatga
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaatttcctgttgtctttggggatacatttaa
>gnl|hbvcds|EU139533_S_P-B Feature FT:CDS EU139533_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate zxq-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactacacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU139534_S_P-B Feature FT:CDS EU139534_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate zxq-2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactacacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU139535_S_P-B Feature FT:CDS EU139535_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate zxq-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactacacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU139537_S_P-B Feature FT:CDS EU139537_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate zxq-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactacacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU139538_S_P-B Feature FT:CDS EU139538_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate zxq-6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactacacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU139539_S_P-B Feature FT:CDS EU139539_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate zxq-7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactacacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU139542_S_P-B Feature FT:CDS EU139542_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate zxq-10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactacacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|EU139543_S_P-B Feature FT:CDS EU139543_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU158262_S_P-B Feature FT:CDS EU158262_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G116). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU158263_S_P-B Feature FT:CDS EU158263_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G108). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggcacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU305547_S_P-B Feature FT:CDS EU305547_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-481). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtgcaaaacctacgaacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttctttcgtctttgggtatacatttaa
>gnl|hbvcds|EU305548_S_P-B Feature FT:CDS EU305548_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-673). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgacgaccagcatcggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306677_S_P-B Feature FT:CDS EU306677_S_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgcctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttaggggcgaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306678_S_P-B Feature FT:CDS EU306678_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306679_S_P-B Feature FT:CDS EU306679_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacgtttaa
>gnl|hbvcds|EU306680_S_P-B Feature FT:CDS EU306680_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacgtttaa
>gnl|hbvcds|EU306681_S_P-B Feature FT:CDS EU306681_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatctcctgctcaaggaacctctatgt
ttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306695_S_P-B Feature FT:CDS EU306695_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306696_S_P-B Feature FT:CDS EU306696_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagagggcctcagtccgtttctcttggctcagtttactagtgccattcgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306697_S_P-B Feature FT:CDS EU306697_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306698_S_P-B Feature FT:CDS EU306698_S_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306699_S_P-B Feature FT:CDS EU306699_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcagaaccagcacaactcttgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcggtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctcccagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU306700_S_P-B Feature FT:CDS EU306700_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306701_S_P-B Feature FT:CDS EU306701_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306702_S_P-B Feature FT:CDS EU306702_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306703_S_P-B Feature FT:CDS EU306703_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttgcaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggttgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306704_S_P-B Feature FT:CDS EU306704_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tgcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306705_S_P-B Feature FT:CDS EU306705_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccgctgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306706_S_P-B Feature FT:CDS EU306706_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306707_S_P-B Feature FT:CDS EU306707_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tgcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306708_S_P-B Feature FT:CDS EU306708_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306709_S_P-B Feature FT:CDS EU306709_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306710_S_P-B Feature FT:CDS EU306710_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306711_S_P-B Feature FT:CDS EU306711_S_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcacttaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306712_S_P-B Feature FT:CDS EU306712_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330989_S_P-B Feature FT:CDS EU330989_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-74). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcagccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcgtgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
cacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggcttttagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330990_S_P-B Feature FT:CDS EU330990_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-146). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcagccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcgtgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
cacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggcttttagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330992_S_P-B Feature FT:CDS EU330992_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-6). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacctgaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330994_S_P-B Feature FT:CDS EU330994_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-10). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccggtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaaggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330995_S_P-B Feature FT:CDS EU330995_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-80). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacagaaatcctcac
aataccacagagcctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttgccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|EU330996_S_P-B Feature FT:CDS EU330996_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-81). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330997_S_P-B Feature FT:CDS EU330997_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-216). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330998_S_P-B Feature FT:CDS EU330998_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1043). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtcgctggatgtgtctgcggcttttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330999_S_P-B Feature FT:CDS EU330999_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1044). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtcgctggatgtgtctgcggcttttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU331000_S_P-B Feature FT:CDS EU331000_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1045). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU331001_S_P-B Feature FT:CDS EU331001_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1046). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU350409_S_P-B Feature FT:CDS EU350409_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BTO5856). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439018_S_P-B Feature FT:CDS EU439018_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439020_S_P-B Feature FT:CDS EU439020_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcggttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439021_S_P-B Feature FT:CDS EU439021_S_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattctcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439022_S_P-B Feature FT:CDS EU439022_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttc
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaaccgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439023_S_P-B Feature FT:CDS EU439023_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgctgcccgtttg
tcctctaattccaggaccatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU487256_S_P-B Feature FT:CDS EU487256_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactactgctcaaggaacctctttgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
agctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU487257_S_P-B Feature FT:CDS EU487257_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU522066_S_P-B Feature FT:CDS EU522066_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 4N). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctatacaacatcttgagtccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU522067_S_P-B Feature FT:CDS EU522067_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 4T). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctccaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU522072_S_P-B Feature FT:CDS EU522072_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8N). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtgttcatttaa
>gnl|hbvcds|EU522073_S_P-B Feature FT:CDS EU522073_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcaccctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtgttcatttaa
>gnl|hbvcds|EU522074_S_P-B Feature FT:CDS EU522074_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|EU522075_S_P-B Feature FT:CDS EU522075_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcaccctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtgttcatttaa
>gnl|hbvcds|EU547563_S_P-B Feature FT:CDS EU547563_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MC06). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggraacacccgtgtgtcytggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU564822_S_P-B Feature FT:CDS EU564822_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TA). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU564823_S_P-B Feature FT:CDS EU564823_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TB). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU564824_S_P-B Feature FT:CDS EU564824_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10N). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
tgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU564825_S_P-B Feature FT:CDS EU564825_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-11T). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagacttgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtcggcggcatttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgtaggttcttctggactatcaaggtatgttgcccgtttg
tcctccaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtgttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU564826_S_P-B Feature FT:CDS EU564826_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-11N). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU570069_S_P-B Feature FT:CDS EU570069_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacgggaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgagtatacatttaa
>gnl|hbvcds|EU570070_S_P-B Feature FT:CDS EU570070_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU570071_S_P-B Feature FT:CDS EU570071_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4-B24). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU570075_S_P-B Feature FT:CDS EU570075_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11-S142). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacccgcgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcgacaacgagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggcaaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU579441_S_P-B Feature FT:CDS EU579441_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctcccaattttccagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcctgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcgacaacgagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggcaaaatctgtacaccatcttgagtccctttatgc
cgctgttaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU589335_S_P-B Feature FT:CDS EU589335_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142-5). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcgacaacgagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggcaaaatctgtacaccatcttgagtccctttatgc
cgctgttaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU595031_S_P-B Feature FT:CDS EU595031_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttttctttgggtatacatttaa
>gnl|hbvcds|EU660224_S_P-B Feature FT:CDS EU660224_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-12N). Non-functional genomic sequence. [Hepadnaviridae] (length=672 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtacgttgcccgtttg
tcctctaacaaacagaaccagcaccggaccatgcaaaacctgcacaactactgctcaaggaacctctttgtttccctcat
gttgctgttccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgg
gagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgt
ctggctttcagttatatggatgatgtggtattgggggccaagtctgtatgccatcttgagtccctttatacagctgttac
caattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU660230_S_P-B Feature FT:CDS EU660230_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16T-del1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttccaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccgtttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU660231_S_P-B Feature FT:CDS EU660231_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16T-del2). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttccaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccgtttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU660232_S_P-B Feature FT:CDS EU660232_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16N-del1). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=672 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttccaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggaaccagcaccggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtttccctcat
gttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgg
gagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgt
ctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgttac
caattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU660233_S_P-B Feature FT:CDS EU660233_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16N-del2). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=672 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttccaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggaaccagcaccggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtttccctcat
gttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgg
gagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgt
ctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgttac
caattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU796066_S_P-B Feature FT:CDS EU796066_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU796067_S_P-B Feature FT:CDS EU796067_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggcttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU796068_S_P-B Feature FT:CDS EU796068_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggtgaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU796071_S_P-B Feature FT:CDS EU796071_S_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgtaggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttttctttgggtatacatttaa
>gnl|hbvcds|EU881997_S_P-B Feature FT:CDS EU881997_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcgaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU881998_S_P-B Feature FT:CDS EU881998_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU882002_S_P-B Feature FT:CDS EU882002_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU882003_S_P-B Feature FT:CDS EU882003_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient21). Non-functional genomic sequence. [Hepadnaviridae] (length=672 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggaaacagcaccggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgtttccctcat
gttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgg
gagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgc
ctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgttac
caattttctattgtctttgggtatacatttaa
>gnl|hbvcds|EU882004_S_P-B Feature FT:CDS EU882004_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient21). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgctcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU915485_S_P-B Feature FT:CDS EU915485_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcagaacctgcacaacttctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU919171_S_P-B Feature FT:CDS EU919171_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU919172_S_P-B Feature FT:CDS EU919172_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient30). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcacaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU919173_S_P-B Feature FT:CDS EU919173_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient30). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU919175_S_P-B Feature FT:CDS EU919175_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcttcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU919176_S_P-B Feature FT:CDS EU919176_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcttcgacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU921791_S_P-B Feature FT:CDS EU921791_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgtttccaattttcttttntctttgggtatacatt
>gnl|hbvcds|EU921794_S_P-B Feature FT:CDS EU921794_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaacagcaccggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgt
ttcactcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU926432_S_P-B Feature FT:CDS EU926432_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcanttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU926434_S_P-B Feature FT:CDS EU926434_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU926436_S_P-B Feature FT:CDS EU926436_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggaacatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctacgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttctttggtctttgggtatacatt
>gnl|hbvcds|EU926437_S_P-B Feature FT:CDS EU926437_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgactaccagcaccggaccatgcaaaacctgcacatctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU926443_S_P-B Feature FT:CDS EU926443_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU926448_S_P-B Feature FT:CDS EU926448_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU926450_S_P-B Feature FT:CDS EU926450_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU926455_S_P-B Feature FT:CDS EU926455_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatccacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tncctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacancttgagtccctttatgc
cgctgttaccaattttcttttntctttgggtatacatc
>gnl|hbvcds|EU926460_S_P-B Feature FT:CDS EU926460_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtatttctngttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccantgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatnc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU926462_S_P-B Feature FT:CDS EU926462_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtacacatt
>gnl|hbvcds|EU926464_S_P-B Feature FT:CDS EU926464_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU926465_S_P-B Feature FT:CDS EU926465_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tncctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU926470_S_P-B Feature FT:CDS EU926470_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU926471_S_P-B Feature FT:CDS EU926471_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU926473_S_P-B Feature FT:CDS EU926473_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcaatttactagtgccatttgttcagtggtccgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927155_S_P-B Feature FT:CDS EU927155_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927156_S_P-B Feature FT:CDS EU927156_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927164_S_P-B Feature FT:CDS EU927164_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927177_S_P-B Feature FT:CDS EU927177_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaactaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927181_S_P-B Feature FT:CDS EU927181_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaagactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtntggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatnc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927187_S_P-B Feature FT:CDS EU927187_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccacttntncantgnttngnagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927189_S_P-B Feature FT:CDS EU927189_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgacgaccagcaccggaccatgcaaaacctgcacaactactgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatttggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927190_S_P-B Feature FT:CDS EU927190_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927191_S_P-B Feature FT:CDS EU927191_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactactgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927192_S_P-B Feature FT:CDS EU927192_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggnaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927198_S_P-B Feature FT:CDS EU927198_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatctcctgctcaaggaacctctatgc
ttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927200_S_P-B Feature FT:CDS EU927200_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927201_S_P-B Feature FT:CDS EU927201_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927210_S_P-B Feature FT:CDS EU927210_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927213_S_P-B Feature FT:CDS EU927213_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctatacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927215_S_P-B Feature FT:CDS EU927215_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtctttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927216_S_P-B Feature FT:CDS EU927216_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcactggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacata
>gnl|hbvcds|EU927220_S_P-B Feature FT:CDS EU927220_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgngttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927222_S_P-B Feature FT:CDS EU927222_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927223_S_P-B Feature FT:CDS EU927223_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatagcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttctatctttgggtatacatt
>gnl|hbvcds|EU927224_S_P-B Feature FT:CDS EU927224_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcnaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927226_S_P-B Feature FT:CDS EU927226_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggnaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggngtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927231_S_P-B Feature FT:CDS EU927231_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtgnttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927233_S_P-B Feature FT:CDS EU927233_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcccttcatgc
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|EU927234_S_P-B Feature FT:CDS EU927234_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927235_S_P-B Feature FT:CDS EU927235_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacttctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927236_S_P-B Feature FT:CDS EU927236_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927239_S_P-B Feature FT:CDS EU927239_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927242_S_P-B Feature FT:CDS EU927242_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgngttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggnaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcntggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggangatgtggttttgggggccaagtctgtacaacatcttgagtccctttatnc
cgctgttaccaattttcttgtgtctttgggtatacatt
>gnl|hbvcds|EU927243_S_P-B Feature FT:CDS EU927243_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctngtngacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927244_S_P-B Feature FT:CDS EU927244_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927247_S_P-B Feature FT:CDS EU927247_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcat
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtactacatcttgagtccctttatgc
cgctgttaccaattttcttttgtatttgggtatacatt
>gnl|hbvcds|EU927251_S_P-B Feature FT:CDS EU927251_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggcacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927272_S_P-B Feature FT:CDS EU927272_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU927284_S_P-B Feature FT:CDS EU927284_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcntggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|EU939559_S_P-B Feature FT:CDS EU939559_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C67). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939633_S_P-B Feature FT:CDS EU939633_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C181). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatgc
cgctattaccaattttctttggtctttgggtatacatgtaa
>gnl|hbvcds|EU939634_S_P-B Feature FT:CDS EU939634_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C19). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatgc
cgctattaccaattttctttgstctttgggtatacatgtaa
>gnl|hbvcds|EU939635_S_P-B Feature FT:CDS EU939635_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B125). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtatttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaaactgtacagcatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939636_S_P-B Feature FT:CDS EU939636_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttggggtccaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939637_S_P-B Feature FT:CDS EU939637_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C13). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaagtctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggcttccgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacgacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939638_S_P-B Feature FT:CDS EU939638_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C17). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgttgtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatat
ttccctcatgttgctgtacaaaacctacggacggcaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939639_S_P-B Feature FT:CDS EU939639_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C28). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggaacatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939660_S_P-B Feature FT:CDS EU939660_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C34). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939661_S_P-B Feature FT:CDS EU939661_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C40). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939663_S_P-B Feature FT:CDS EU939663_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C74). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939664_S_P-B Feature FT:CDS EU939664_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C85). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaamcacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939665_S_P-B Feature FT:CDS EU939665_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C129). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939666_S_P-B Feature FT:CDS EU939666_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C150). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939667_S_P-B Feature FT:CDS EU939667_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C171). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatttggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939669_S_P-B Feature FT:CDS EU939669_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C185). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939670_S_P-B Feature FT:CDS EU939670_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C189). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaagtcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcatggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatcaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939671_S_P-B Feature FT:CDS EU939671_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C201). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctttga
ctccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939672_S_P-B Feature FT:CDS EU939672_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacactcgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939673_S_P-B Feature FT:CDS EU939673_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C219). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacatgcacatctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939674_S_P-B Feature FT:CDS EU939674_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttatctttgggtatacatttaa
>gnl|hbvcds|EU939675_S_P-B Feature FT:CDS EU939675_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C235). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggtctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaccatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939676_S_P-B Feature FT:CDS EU939676_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D54). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaactaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939677_S_P-B Feature FT:CDS EU939677_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D95). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaatacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatccacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939678_S_P-B Feature FT:CDS EU939678_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D106). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttct
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtcccttcatgc
cgctgttacccattttcttgtgtctttgggcatacatttaa
>gnl|hbvcds|EU939679_S_P-B Feature FT:CDS EU939679_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D134). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgtaggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgaccaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatga
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023631_S_P-B Feature FT:CDS FJ023631_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2_C04-1213). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacaaccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctttcattccaggatcatcaacaaccagcaccggaccatgcaaaacttgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtaccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgtttccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|FJ023632_S_P-B Feature FT:CDS FJ023632_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-0254). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|FJ023633_S_P-B Feature FT:CDS FJ023633_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-0583). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023634_S_P-B Feature FT:CDS FJ023634_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-1358). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023635_S_P-B Feature FT:CDS FJ023635_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_M04-0467). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023636_S_P-B Feature FT:CDS FJ023636_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_M04-0876). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaccaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatat
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023637_S_P-B Feature FT:CDS FJ023637_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0013). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcrcatcargactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023638_S_P-B Feature FT:CDS FJ023638_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0465). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023697_S_P-B Feature FT:CDS FJ023697_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C04-0326). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcacggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023715_S_P-B Feature FT:CDS FJ023715_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-0131). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023718_S_P-B Feature FT:CDS FJ023718_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-0204). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023720_S_P-B Feature FT:CDS FJ023720_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-0238). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023723_S_P-B Feature FT:CDS FJ023723_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-0349). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023724_S_P-B Feature FT:CDS FJ023724_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-0405). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023729_S_P-B Feature FT:CDS FJ023729_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-0492). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023731_S_P-B Feature FT:CDS FJ023731_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-0516). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023738_S_P-B Feature FT:CDS FJ023738_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-0771). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023739_S_P-B Feature FT:CDS FJ023739_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-0875). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacgcaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023741_S_P-B Feature FT:CDS FJ023741_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-0980). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023743_S_P-B Feature FT:CDS FJ023743_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-1165). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaacatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggcaaaatctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023746_S_P-B Feature FT:CDS FJ023746_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-1362). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023749_S_P-B Feature FT:CDS FJ023749_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-1458). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023750_S_P-B Feature FT:CDS FJ023750_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-1519). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023762_S_P-B Feature FT:CDS FJ023762_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-1916). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023763_S_P-B Feature FT:CDS FJ023763_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-1925). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023767_S_P-B Feature FT:CDS FJ023767_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-2073). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023770_S_P-B Feature FT:CDS FJ023770_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-2140). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023771_S_P-B Feature FT:CDS FJ023771_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-2146). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023772_S_P-B Feature FT:CDS FJ023772_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CO5-2147). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023773_S_P-B Feature FT:CDS FJ023773_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-0081). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023776_S_P-B Feature FT:CDS FJ023776_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-0415). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
taccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023792_S_P-B Feature FT:CDS FJ023792_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-1580). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023797_S_P-B Feature FT:CDS FJ023797_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-1760). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatat
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023801_S_P-B Feature FT:CDS FJ023801_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2035). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccacaagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023803_S_P-B Feature FT:CDS FJ023803_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2064). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023808_S_P-B Feature FT:CDS FJ023808_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2099). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023810_S_P-B Feature FT:CDS FJ023810_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2129). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023811_S_P-B Feature FT:CDS FJ023811_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2163). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023813_S_P-B Feature FT:CDS FJ023813_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2289). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023814_S_P-B Feature FT:CDS FJ023814_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2365). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatagcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaaactgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023816_S_P-B Feature FT:CDS FJ023816_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2370). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ023817_S_P-B Feature FT:CDS FJ023817_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2394). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023825_S_P-B Feature FT:CDS FJ023825_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2656). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023829_S_P-B Feature FT:CDS FJ023829_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2763). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaacatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023830_S_P-B Feature FT:CDS FJ023830_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2766). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaagggacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023831_S_P-B Feature FT:CDS FJ023831_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2770). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023832_S_P-B Feature FT:CDS FJ023832_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2783). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggacaacacaacatcaggattcctaggacacctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaccacccgtgtgtcgtggccaaaattcgc
agtccccaatctccaatcactcaccaacctcctgtccaccaacttgtcctggctatcgctggatgtctctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacaaccagcgccggaccatgcagaacctgcacgactcctgctcaaggaacctctatga
ttccctcttgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccactttccttctttctttgggtatacatttga
>gnl|hbvcds|FJ023835_S_P-B Feature FT:CDS FJ023835_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2800). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023836_S_P-B Feature FT:CDS FJ023836_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2866). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023838_S_P-B Feature FT:CDS FJ023838_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2884). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023842_S_P-B Feature FT:CDS FJ023842_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3009). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023846_S_P-B Feature FT:CDS FJ023846_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3069). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023848_S_P-B Feature FT:CDS FJ023848_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3122). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ023850_S_P-B Feature FT:CDS FJ023850_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3175). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023852_S_P-B Feature FT:CDS FJ023852_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3214). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023853_S_P-B Feature FT:CDS FJ023853_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3222). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ023855_S_P-B Feature FT:CDS FJ023855_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3234). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcactaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatctccctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaacatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023857_S_P-B Feature FT:CDS FJ023857_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3260). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023858_S_P-B Feature FT:CDS FJ023858_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3289). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgcctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023860_S_P-B Feature FT:CDS FJ023860_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3304). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023862_S_P-B Feature FT:CDS FJ023862_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3331). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023863_S_P-B Feature FT:CDS FJ023863_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3361). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023867_S_P-B Feature FT:CDS FJ023867_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3425). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023869_S_P-B Feature FT:CDS FJ023869_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3457). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023870_S_P-B Feature FT:CDS FJ023870_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3461). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023871_S_P-B Feature FT:CDS FJ023871_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3504). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023873_S_P-B Feature FT:CDS FJ023873_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3567). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatat
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023876_S_P-B Feature FT:CDS FJ023876_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3688). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtcttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023888_S_P-B Feature FT:CDS FJ023888_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3719). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ023889_S_P-B Feature FT:CDS FJ023889_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3720). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtcttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023893_S_P-B Feature FT:CDS FJ023893_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3732). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtggggctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023895_S_P-B Feature FT:CDS FJ023895_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3800). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023899_S_P-B Feature FT:CDS FJ023899_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3847). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaagttcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023900_S_P-B Feature FT:CDS FJ023900_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3853). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaaaacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023902_S_P-B Feature FT:CDS FJ023902_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4000). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023903_S_P-B Feature FT:CDS FJ023903_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4005). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcacyaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023905_S_P-B Feature FT:CDS FJ023905_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4072). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023909_S_P-B Feature FT:CDS FJ023909_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4144). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaccaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023910_S_P-B Feature FT:CDS FJ023910_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4149). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023911_S_P-B Feature FT:CDS FJ023911_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4160). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccgggccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023913_S_P-B Feature FT:CDS FJ023913_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4186). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacwcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaccaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023915_S_P-B Feature FT:CDS FJ023915_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4257). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023916_S_P-B Feature FT:CDS FJ023916_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4272). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatccttac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023918_S_P-B Feature FT:CDS FJ023918_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4293). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactyctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023919_S_P-B Feature FT:CDS FJ023919_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4295). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctagcacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023921_S_P-B Feature FT:CDS FJ023921_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4325). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023923_S_P-B Feature FT:CDS FJ023923_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4449). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023924_S_P-B Feature FT:CDS FJ023924_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4450). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcagcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023925_S_P-B Feature FT:CDS FJ023925_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4486). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023930_S_P-B Feature FT:CDS FJ023930_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4604). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatat
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023933_S_P-B Feature FT:CDS FJ023933_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4685). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcactactcctgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023934_S_P-B Feature FT:CDS FJ023934_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4734). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcagcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023937_S_P-B Feature FT:CDS FJ023937_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4783). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023940_S_P-B Feature FT:CDS FJ023940_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4869). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatat
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023941_S_P-B Feature FT:CDS FJ023941_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-4917). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatccttac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023946_S_P-B Feature FT:CDS FJ023946_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-0152). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023948_S_P-B Feature FT:CDS FJ023948_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-0159). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023950_S_P-B Feature FT:CDS FJ023950_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-0189). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023951_S_P-B Feature FT:CDS FJ023951_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-0220). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcggtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023952_S_P-B Feature FT:CDS FJ023952_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-0268). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023953_S_P-B Feature FT:CDS FJ023953_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-0279). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|FJ023954_S_P-B Feature FT:CDS FJ023954_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-0285). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023957_S_P-B Feature FT:CDS FJ023957_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-0426). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023958_S_P-B Feature FT:CDS FJ023958_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-0431). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023959_S_P-B Feature FT:CDS FJ023959_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-0537). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023960_S_P-B Feature FT:CDS FJ023960_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-1072). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023962_S_P-B Feature FT:CDS FJ023962_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-1230). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023963_S_P-B Feature FT:CDS FJ023963_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-1427). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgccctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtmcaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023964_S_P-B Feature FT:CDS FJ023964_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-1608). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcycatcaggactcctaggacccctgctcgtgttacaggsggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgccctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023965_S_P-B Feature FT:CDS FJ023965_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-1623). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023970_S_P-B Feature FT:CDS FJ023970_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-1867). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023971_S_P-B Feature FT:CDS FJ023971_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-1898). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023972_S_P-B Feature FT:CDS FJ023972_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-1937). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023973_S_P-B Feature FT:CDS FJ023973_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-1973). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023974_S_P-B Feature FT:CDS FJ023974_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2068). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023975_S_P-B Feature FT:CDS FJ023975_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2118). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023976_S_P-B Feature FT:CDS FJ023976_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2156). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023978_S_P-B Feature FT:CDS FJ023978_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2164). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023981_S_P-B Feature FT:CDS FJ023981_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2237). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023982_S_P-B Feature FT:CDS FJ023982_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2278). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023983_S_P-B Feature FT:CDS FJ023983_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2367). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023984_S_P-B Feature FT:CDS FJ023984_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2381). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023986_S_P-B Feature FT:CDS FJ023986_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2388). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023987_S_P-B Feature FT:CDS FJ023987_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2391). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023989_S_P-B Feature FT:CDS FJ023989_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2485). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctamttccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023990_S_P-B Feature FT:CDS FJ023990_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2492). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcgtggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcrtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaycttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023992_S_P-B Feature FT:CDS FJ023992_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2511). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023993_S_P-B Feature FT:CDS FJ023993_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2518). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023995_S_P-B Feature FT:CDS FJ023995_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2563). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023996_S_P-B Feature FT:CDS FJ023996_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2566). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggayggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023997_S_P-B Feature FT:CDS FJ023997_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2580). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023998_S_P-B Feature FT:CDS FJ023998_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2596). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023999_S_P-B Feature FT:CDS FJ023999_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2673). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024000_S_P-B Feature FT:CDS FJ024000_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2705). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024004_S_P-B Feature FT:CDS FJ024004_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2752). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024005_S_P-B Feature FT:CDS FJ024005_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2767). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024006_S_P-B Feature FT:CDS FJ024006_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2835). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024008_S_P-B Feature FT:CDS FJ024008_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2842). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024010_S_P-B Feature FT:CDS FJ024010_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2894). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024012_S_P-B Feature FT:CDS FJ024012_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2963). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024013_S_P-B Feature FT:CDS FJ024013_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-2964). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024014_S_P-B Feature FT:CDS FJ024014_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-3019). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024015_S_P-B Feature FT:CDS FJ024015_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-3023). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024016_S_P-B Feature FT:CDS FJ024016_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-3164). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024017_S_P-B Feature FT:CDS FJ024017_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-3165). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024018_S_P-B Feature FT:CDS FJ024018_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-3206). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatat
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FJ024019_S_P-B Feature FT:CDS FJ024019_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-3249). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgaytcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtytggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024020_S_P-B Feature FT:CDS FJ024020_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-3275). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024022_S_P-B Feature FT:CDS FJ024022_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-3540). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcatgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024027_S_P-B Feature FT:CDS FJ024027_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-3861). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtwttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024029_S_P-B Feature FT:CDS FJ024029_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-3976). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024030_S_P-B Feature FT:CDS FJ024030_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-4122). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024032_S_P-B Feature FT:CDS FJ024032_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-4148). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024033_S_P-B Feature FT:CDS FJ024033_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-4152). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacaccagtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024036_S_P-B Feature FT:CDS FJ024036_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-4217). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024038_S_P-B Feature FT:CDS FJ024038_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-4282). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024040_S_P-B Feature FT:CDS FJ024040_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-4377). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024041_S_P-B Feature FT:CDS FJ024041_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-4451). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaraacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024042_S_P-B Feature FT:CDS FJ024042_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-4454). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaraacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024044_S_P-B Feature FT:CDS FJ024044_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-4636). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgttcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024045_S_P-B Feature FT:CDS FJ024045_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-4686). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ024046_S_P-B Feature FT:CDS FJ024046_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M05-4750). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032342_S_P-B Feature FT:CDS FJ032342_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S659-2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcgtggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactcttcgt
taccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcccttcatgc
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|FJ032344_S_P-B Feature FT:CDS FJ032344_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S659-5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcgtggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactcttcgc
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcccttcatgc
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|FJ032349_S_P-B Feature FT:CDS FJ032349_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S734-1). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcatcaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaccaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcacgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatttggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032352_S_P-B Feature FT:CDS FJ032352_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-3). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctacgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tatctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032353_S_P-B Feature FT:CDS FJ032353_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctacgc
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032354_S_P-B Feature FT:CDS FJ032354_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctacgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032357_S_P-B Feature FT:CDS FJ032357_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1607-8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032358_S_P-B Feature FT:CDS FJ032358_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1607-10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttggcaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtggcccgtttg
tcctctaattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccacgtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttgtgtctttgggtatacatgtaa
>gnl|hbvcds|FJ349236_S_P-B Feature FT:CDS FJ349236_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C15). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ358591_S_P-B Feature FT:CDS FJ358591_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-2769). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagcctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgccccatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaagggacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttagctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ386582_S_P-B Feature FT:CDS FJ386582_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1765). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtttgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386583_S_P-B Feature FT:CDS FJ386583_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1780). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386584_S_P-B Feature FT:CDS FJ386584_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1798). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtttgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386600_S_P-B Feature FT:CDS FJ386600_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1893). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtttgcggcgtttt
atcctcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctacgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386608_S_P-B Feature FT:CDS FJ386608_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1998). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgacaaccagcactggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggttttggggaccaagtctgtacaacatcgtgaggccatttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FJ386610_S_P-B Feature FT:CDS FJ386610_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2000). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386615_S_P-B Feature FT:CDS FJ386615_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386634_S_P-B Feature FT:CDS FJ386634_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2392). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaactaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386636_S_P-B Feature FT:CDS FJ386636_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1813). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtttgcggcgtttt
atcctcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386642_S_P-B Feature FT:CDS FJ386642_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1829). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctamttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386648_S_P-B Feature FT:CDS FJ386648_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2419). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatcaactaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
tacctatgggagtgggcctcaatccgtttctcttcgctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttttgc
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386654_S_P-B Feature FT:CDS FJ386654_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S51). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgacaaccagcaccgggccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386655_S_P-B Feature FT:CDS FJ386655_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S121). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386656_S_P-B Feature FT:CDS FJ386656_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttccagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcgacaacgagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggcaaaatctgtacaccatcttgagtccctttatgc
cgctgttaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386658_S_P-B Feature FT:CDS FJ386658_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S185). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386660_S_P-B Feature FT:CDS FJ386660_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S221). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386666_S_P-B Feature FT:CDS FJ386666_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S367). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatat
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386668_S_P-B Feature FT:CDS FJ386668_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S395). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386669_S_P-B Feature FT:CDS FJ386669_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S411). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcgaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386675_S_P-B Feature FT:CDS FJ386675_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S734). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatckcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaccaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatttggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386676_S_P-B Feature FT:CDS FJ386676_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1055). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtttcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386680_S_P-B Feature FT:CDS FJ386680_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1244). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccgtttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386681_S_P-B Feature FT:CDS FJ386681_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1336). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggttcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccattcatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386682_S_P-B Feature FT:CDS FJ386682_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1416). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386683_S_P-B Feature FT:CDS FJ386683_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1450). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggaacatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386684_S_P-B Feature FT:CDS FJ386684_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1554). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386688_S_P-B Feature FT:CDS FJ386688_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1632). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aattccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctccttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ518811_S_P-B Feature FT:CDS FJ518811_S_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttcggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttgactcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ518812_S_P-B Feature FT:CDS FJ518812_S_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttgtctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ560992_S_P-B Feature FT:CDS FJ560992_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ560995_S_P-B Feature FT:CDS FJ560995_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H26). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccrcatagtctaaactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattccc
actcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ560996_S_P-B Feature FT:CDS FJ560996_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H41). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ561001_S_P-B Feature FT:CDS FJ561001_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Q30). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggttgacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcacttaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccgggccatgcaaaacctgcacaacgcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ561007_S_P-B Feature FT:CDS FJ561007_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate QS263). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ561009_S_P-B Feature FT:CDS FJ561009_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate QS88). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ561013_S_P-B Feature FT:CDS FJ561013_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S118). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ561015_S_P-B Feature FT:CDS FJ561015_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S124). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgctgtcctccaatttgtcctggttatcgctggatgtrtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaycatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ561018_S_P-B Feature FT:CDS FJ561018_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S17). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ561019_S_P-B Feature FT:CDS FJ561019_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S26). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ561021_S_P-B Feature FT:CDS FJ561021_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S40). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ561024_S_P-B Feature FT:CDS FJ561024_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S50). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaacgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaagttatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ561027_S_P-B Feature FT:CDS FJ561027_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S61). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggraacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|FJ561034_S_P-B Feature FT:CDS FJ561034_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S77). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ561038_S_P-B Feature FT:CDS FJ561038_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S93). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctcycattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacarctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ561044_S_P-B Feature FT:CDS FJ561044_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate QS216). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgkggkggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggcttccgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562219_S_P-B Feature FT:CDS FJ562219_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctcttcgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562222_S_P-B Feature FT:CDS FJ562222_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I14). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562224_S_P-B Feature FT:CDS FJ562224_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562231_S_P-B Feature FT:CDS FJ562231_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I44). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacagaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562234_S_P-B Feature FT:CDS FJ562234_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I49). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttttcctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562236_S_P-B Feature FT:CDS FJ562236_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I51). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|FJ562237_S_P-B Feature FT:CDS FJ562237_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I53). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562240_S_P-B Feature FT:CDS FJ562240_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I65). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcgactaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562246_S_P-B Feature FT:CDS FJ562246_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I74). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctcattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562253_S_P-B Feature FT:CDS FJ562253_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I86). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggttttccttgttgataaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562254_S_P-B Feature FT:CDS FJ562254_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I87). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562257_S_P-B Feature FT:CDS FJ562257_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I96). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcatcggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562259_S_P-B Feature FT:CDS FJ562259_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I106). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562260_S_P-B Feature FT:CDS FJ562260_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I107). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcay
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgttggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562262_S_P-B Feature FT:CDS FJ562262_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I111). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttttagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562289_S_P-B Feature FT:CDS FJ562289_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I160). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562296_S_P-B Feature FT:CDS FJ562296_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I171). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaaactgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562303_S_P-B Feature FT:CDS FJ562303_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I189). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcctcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgt
ttccatcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ562311_S_P-B Feature FT:CDS FJ562311_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I202). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562312_S_P-B Feature FT:CDS FJ562312_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I203). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacatctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562316_S_P-B Feature FT:CDS FJ562316_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I208). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcctcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562321_S_P-B Feature FT:CDS FJ562321_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I214). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562322_S_P-B Feature FT:CDS FJ562322_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I216). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621592_S_P-B Feature FT:CDS FJ621592_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3157). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaaaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccacaagcaccgggccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FJ621602_S_P-B Feature FT:CDS FJ621602_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2068). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcgtggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaacatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttwctagtgccgtttgttcagtggttcgcagggctttc
ccccattgtctggctttcagttatrtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621603_S_P-B Feature FT:CDS FJ621603_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4782). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621604_S_P-B Feature FT:CDS FJ621604_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3194). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccacaagcaccgggccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621605_S_P-B Feature FT:CDS FJ621605_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccacaagcaccgggccatgcagaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621606_S_P-B Feature FT:CDS FJ621606_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcgaccacaagcaccgggccatgcagaacctgcacgactcctgctcacggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621607_S_P-B Feature FT:CDS FJ621607_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2967). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccacaagcaccggtccatgccraacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621608_S_P-B Feature FT:CDS FJ621608_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3012). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
gataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaatctccartcactcaccaacctsttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatmttcctctkcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctamttccaggawcatcaactaccagcacsggaccatgcaaaacctgcacaaytcctgctcaaggaacctctatgt
ttccctcwtgttgctgtacmaaacctwcggacggaaactgcacytgtattcccatcccatcatcytgggctttcgcaara
tacctatgggagtgggcctcagtccgtttctcttggytcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ckctgttaccaattttcttttgtctttgggtatacatttra
>gnl|hbvcds|FJ621612_S_P-B Feature FT:CDS FJ621612_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2956). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacagttaa
>gnl|hbvcds|FJ621613_S_P-B Feature FT:CDS FJ621613_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3147). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacatctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtgcaacatcttgagtccctttatac
cgctgttaccaattttctgttgtctttgggcatacatttaa
>gnl|hbvcds|FJ621614_S_P-B Feature FT:CDS FJ621614_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4314). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621615_S_P-B Feature FT:CDS FJ621615_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4744). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcagaacctgcacgactcctgctcacggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621616_S_P-B Feature FT:CDS FJ621616_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2794). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggggacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggatatcgctcgatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaagcctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621617_S_P-B Feature FT:CDS FJ621617_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3086). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggttcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621618_S_P-B Feature FT:CDS FJ621618_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3191). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621619_S_P-B Feature FT:CDS FJ621619_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4783). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcccaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgacctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcgaggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttgactcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621620_S_P-B Feature FT:CDS FJ621620_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4756). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtatttcttgtggacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|FJ621621_S_P-B Feature FT:CDS FJ621621_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4019). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=684 residues).
atggagaacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatatgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctcta
tgtttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgca
aaatacctatgggtgtgggcctcagtccgtttctcttgactcagtttactagtgccatttgttcagtggttcgtagggct
ttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcccttta
tgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621622_S_P-B Feature FT:CDS FJ621622_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4722). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacgtttaa
>gnl|hbvcds|FJ621623_S_P-B Feature FT:CDS FJ621623_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3001). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaagacccctgctcgtgttaccggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggatcatgcagaacctgcacaackcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621624_S_P-B Feature FT:CDS FJ621624_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4057). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621625_S_P-B Feature FT:CDS FJ621625_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4220). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621626_S_P-B Feature FT:CDS FJ621626_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4603). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621627_S_P-B Feature FT:CDS FJ621627_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4109). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtctgttgcccgtttg
tcctataattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggttttgggggcgaaatctgtacaacatcttgaatccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621628_S_P-B Feature FT:CDS FJ621628_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2837). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggcacctctaygt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621629_S_P-B Feature FT:CDS FJ621629_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3031). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621630_S_P-B Feature FT:CDS FJ621630_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4301). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggaggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagtaccggaacatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621631_S_P-B Feature FT:CDS FJ621631_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2020). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaraacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621632_S_P-B Feature FT:CDS FJ621632_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2061). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621633_S_P-B Feature FT:CDS FJ621633_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3015). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacractcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagwctgtacaacatcttgagtccatttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621634_S_P-B Feature FT:CDS FJ621634_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3131). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621635_S_P-B Feature FT:CDS FJ621635_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3142). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|FJ621636_S_P-B Feature FT:CDS FJ621636_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4184). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctamttccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatrc
cgctgttaccaattttcttttrtctttgggtatacatttaa
>gnl|hbvcds|FJ621637_S_P-B Feature FT:CDS FJ621637_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4204). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaacaactgctcaaggcacctctatgw
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|FJ621638_S_P-B Feature FT:CDS FJ621638_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4567). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621639_S_P-B Feature FT:CDS FJ621639_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4546). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatcgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621640_S_P-B Feature FT:CDS FJ621640_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4457). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatctttggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtcccttyatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621641_S_P-B Feature FT:CDS FJ621641_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1885). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggwtatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctamttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcatgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatkgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccamttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621642_S_P-B Feature FT:CDS FJ621642_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4340). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgkctttgggtatacatttaa
>gnl|hbvcds|FJ621643_S_P-B Feature FT:CDS FJ621643_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3152). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaacaacgagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggttttgggggcaaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggcatacatttaa
>gnl|hbvcds|FJ621644_S_P-B Feature FT:CDS FJ621644_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4649). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcatggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacgaccagcaccggaccatgcaaaacctgcacgactcctgctcaagggacctctatgt
ttccctcatgttgctgtttaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccgtttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621645_S_P-B Feature FT:CDS FJ621645_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2781). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aattccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctccttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621646_S_P-B Feature FT:CDS FJ621646_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4252). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggttttcagttatattgatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621647_S_P-B Feature FT:CDS FJ621647_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2950). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatrc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621648_S_P-B Feature FT:CDS FJ621648_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4288). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621649_S_P-B Feature FT:CDS FJ621649_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4651). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggacacacccgtgtgtcgtggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacawcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621650_S_P-B Feature FT:CDS FJ621650_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4157). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621651_S_P-B Feature FT:CDS FJ621651_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4031). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcgtggcccaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactcttcgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatttggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621652_S_P-B Feature FT:CDS FJ621652_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3902). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621653_S_P-B Feature FT:CDS FJ621653_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4081). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaccaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgaatccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621654_S_P-B Feature FT:CDS FJ621654_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4640). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagrgctttc
ccmcactgtctggctttcagttatatggatgatgtggtaktgggggccaagtctgtacaacatcttgagtccctytatgc
mgctgttaycaattttcttttgtctttgggtatwcatttaa
>gnl|hbvcds|FJ621655_S_P-B Feature FT:CDS FJ621655_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4555). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621656_S_P-B Feature FT:CDS FJ621656_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3196). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621657_S_P-B Feature FT:CDS FJ621657_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4333). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatygatgatgtggttttgggggccaagtctgtacaacaccttgagtccctttatrc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621658_S_P-B Feature FT:CDS FJ621658_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3956). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621659_S_P-B Feature FT:CDS FJ621659_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4364). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621660_S_P-B Feature FT:CDS FJ621660_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4490). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagyggttcgtagggctttc
ccccactgtytggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621661_S_P-B Feature FT:CDS FJ621661_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1875). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621662_S_P-B Feature FT:CDS FJ621662_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2009). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctcyaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621663_S_P-B Feature FT:CDS FJ621663_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2014). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621664_S_P-B Feature FT:CDS FJ621664_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2091). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgacgcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctgtgggtatacatttaa
>gnl|hbvcds|FJ621665_S_P-B Feature FT:CDS FJ621665_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2098). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621666_S_P-B Feature FT:CDS FJ621666_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2809). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatctacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621667_S_P-B Feature FT:CDS FJ621667_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2835). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tccctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621668_S_P-B Feature FT:CDS FJ621668_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2855). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621669_S_P-B Feature FT:CDS FJ621669_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2856). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621670_S_P-B Feature FT:CDS FJ621670_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2880). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621671_S_P-B Feature FT:CDS FJ621671_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2927). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacractcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621672_S_P-B Feature FT:CDS FJ621672_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2929). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621673_S_P-B Feature FT:CDS FJ621673_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2948). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FJ621674_S_P-B Feature FT:CDS FJ621674_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2961). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621675_S_P-B Feature FT:CDS FJ621675_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2992). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621676_S_P-B Feature FT:CDS FJ621676_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3024). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621677_S_P-B Feature FT:CDS FJ621677_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3032). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621678_S_P-B Feature FT:CDS FJ621678_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3042). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621679_S_P-B Feature FT:CDS FJ621679_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3047). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621680_S_P-B Feature FT:CDS FJ621680_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3123). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621681_S_P-B Feature FT:CDS FJ621681_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3143). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621682_S_P-B Feature FT:CDS FJ621682_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3160). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621683_S_P-B Feature FT:CDS FJ621683_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3162). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacarctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621684_S_P-B Feature FT:CDS FJ621684_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3167). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaagaaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621685_S_P-B Feature FT:CDS FJ621685_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3187). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621686_S_P-B Feature FT:CDS FJ621686_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3830). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttsgtwmttmtggactatmaaggtatgttkcccgtttg
tcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacagctycwgstcaaggaacctctwtgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcmcatcatcttgkgctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621687_S_P-B Feature FT:CDS FJ621687_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3836). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggamggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621688_S_P-B Feature FT:CDS FJ621688_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3852). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttctwwtgtctttgggtatacatttaa
>gnl|hbvcds|FJ621689_S_P-B Feature FT:CDS FJ621689_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3857). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621690_S_P-B Feature FT:CDS FJ621690_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3865). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621691_S_P-B Feature FT:CDS FJ621691_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3874). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621692_S_P-B Feature FT:CDS FJ621692_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3893). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatrtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621693_S_P-B Feature FT:CDS FJ621693_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3905). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggatcatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621694_S_P-B Feature FT:CDS FJ621694_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3909). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621695_S_P-B Feature FT:CDS FJ621695_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3911). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621696_S_P-B Feature FT:CDS FJ621696_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3913). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggcacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621697_S_P-B Feature FT:CDS FJ621697_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3935). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621698_S_P-B Feature FT:CDS FJ621698_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3951). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tccctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621699_S_P-B Feature FT:CDS FJ621699_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3960). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaactaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621700_S_P-B Feature FT:CDS FJ621700_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S3975). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaayctytrtgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttmgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621701_S_P-B Feature FT:CDS FJ621701_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4001). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tccctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttsttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621702_S_P-B Feature FT:CDS FJ621702_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4006). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621703_S_P-B Feature FT:CDS FJ621703_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4020). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621704_S_P-B Feature FT:CDS FJ621704_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4078). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcgtcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621705_S_P-B Feature FT:CDS FJ621705_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4093). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621706_S_P-B Feature FT:CDS FJ621706_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4107). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatkgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621707_S_P-B Feature FT:CDS FJ621707_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4136). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621708_S_P-B Feature FT:CDS FJ621708_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4175). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgtctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621709_S_P-B Feature FT:CDS FJ621709_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4231). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacgaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621710_S_P-B Feature FT:CDS FJ621710_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4237). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621711_S_P-B Feature FT:CDS FJ621711_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4265). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621712_S_P-B Feature FT:CDS FJ621712_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4279). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttkggctttcgcaaaa
tacctatgggagtkggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621713_S_P-B Feature FT:CDS FJ621713_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4286). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621714_S_P-B Feature FT:CDS FJ621714_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4306). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaga
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FJ621715_S_P-B Feature FT:CDS FJ621715_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4321). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621716_S_P-B Feature FT:CDS FJ621716_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4330). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621717_S_P-B Feature FT:CDS FJ621717_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4331). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621718_S_P-B Feature FT:CDS FJ621718_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4373). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621719_S_P-B Feature FT:CDS FJ621719_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4415). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccwayyttcytttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621720_S_P-B Feature FT:CDS FJ621720_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4432). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621721_S_P-B Feature FT:CDS FJ621721_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4503). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621722_S_P-B Feature FT:CDS FJ621722_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4504). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621723_S_P-B Feature FT:CDS FJ621723_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4510). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattbggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttmccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621724_S_P-B Feature FT:CDS FJ621724_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4512). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattbggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttmccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621725_S_P-B Feature FT:CDS FJ621725_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4513). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtakggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtmcaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621726_S_P-B Feature FT:CDS FJ621726_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4521). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacgaccagcacgggatcatgcagaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactaatgccatttgttcagtggttcgtakggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621727_S_P-B Feature FT:CDS FJ621727_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4525). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccastgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621728_S_P-B Feature FT:CDS FJ621728_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4549). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621729_S_P-B Feature FT:CDS FJ621729_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4553). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcwtggctcagtttactagtgccatttgttcagtggttcgtaggkctttc
ccccactgtctggctttcagttatrtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621730_S_P-B Feature FT:CDS FJ621730_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4554). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621731_S_P-B Feature FT:CDS FJ621731_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4562). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatct
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621732_S_P-B Feature FT:CDS FJ621732_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4584). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621733_S_P-B Feature FT:CDS FJ621733_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4590). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccgggccatgcaaaacctgcacmactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621734_S_P-B Feature FT:CDS FJ621734_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4591). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtstggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621735_S_P-B Feature FT:CDS FJ621735_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4601). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccctgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatrc
cgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621736_S_P-B Feature FT:CDS FJ621736_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4670). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaactaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621737_S_P-B Feature FT:CDS FJ621737_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4687). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgc
crmtgttrccavktttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621738_S_P-B Feature FT:CDS FJ621738_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4761). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ621739_S_P-B Feature FT:CDS FJ621739_S_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S4768). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgt