HBVdb

Dataset for nucleotide sequence S of genotype B

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
---------ATGGAGA-----------ACATC--GCATCAGGACTCCTAGGA------CCCCTGCTCGTGTTACAGGCGG
                           g  ca  a        t    c                   g           
                                  t                                 c           
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
GGTTTTTCTtGTTGACAAAAATCCTCACAATACCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAaTTTTCTAGGGGgA
         c        g               g                               g           ag
         y                                                                    r 
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                      **       *               *         * *    
ACACCCGTGTGTCTTGGCCAAAATTCGCAGTCCCAAATCTCCAGTCACTCACCAACcTGTTGTCCTCCAATTTGTCCTGG
c            c                    c  c     a        t   t cc        g c         
g            g                                            a                     
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                  *  *        *      *                       *                  
TTATCGCTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTGCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTC
c     t       a                  a     t t                                      
                                                                                
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *                                                                              
TGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCAT---CAACaACCAGCACCGGACCATGCAa----
       c                          cc        a c     g  c     t  g  gt c    g    
                                  g                    g                        
                                                       t                        

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                              *               *                 
--AACCTGCACaACTCCTGCTCAAGGAACCTCTATGTTTCCCTCATGTTGCTGTACAAAACCTACGGACGGAAACTGCAC
  g  a     gg ga      gc         tc         t          tc       t   t     t     
           r                                                                    
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                        *                                  *    
CTGTATTCCCATCCCATCATCTTGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTCTCTTGGCTCAGTT
                     c          t     t                              a          
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                 *                                                              
TACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTCTGGCTTTCAGTTATATGGATGATGTGGTtTTGG
c         g                               t   t             cg t      a    ac   
                                                                                
                                                                                

       650       660       670       680       690       700       710        
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:...
                                                                              
GGGCCAAGTCTGTACAACATCTTGAGTCCCTTTATgCCGCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAA
       aa          c     a   a   t a  t  a     cc       c t   c    c       -g-
                                                        g                   - 
                                                                              
© 1998-2020Legal notice