Dataset for nucleotide sequence X of genotype C

[Download (right click)] [Edit] [Sequences] [Repertoires]

4099 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

KC774351_X_P-C      atggctggtccaatggggtcccgaccggaacctccgcggggtcggccctgtatacgtcga
KC774357_X_P-C      atggctgttagggggtgctgccaactggatcctgcgcgggacgtccttggtctacgtccc
KC774180_X_P-C      atggttcctagggtgtgcggccaactggatcctgcgcgggacgtccgttgtctacgtccc
KC774196_X_P-C      atggaatacagggtgtgttgccaactggatcctgcgggggacgtcctttgtctacgtccc
KC774336_X_P-C      atggaatacagggtgtgttgccaactggatcctgcgggggacgtcctttgtctacgtccc
MF115871_X_P-C      atggctgctaggctgtgctgccaactggaccctgcgcgggacgtcccttgtttacgtccc
MF115873_X_P-C      atggctggcgggctgtgctgccaactggattcttcacgggacgtcctttgtttacgtcca
EF594767_X_P-C      atgtctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
EF594769_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
EF594768_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KT235618_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
JN574721_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
EF594764_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
EF594766_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
EF594763_X_P-C      atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtccc
FJ876192_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876229_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876191_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876246_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876251_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876202_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876205_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876252_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876239_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876238_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876206_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876230_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876204_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876203_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
FJ876190_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
EF594758_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
EF594760_X_P-C      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtccc
KC774244_X_P-C      atggttgctagggtgtgctgccaagtggatcatgcgcgggacgtccttagtttacgtccc
KC774292_X_P-C      atggatgctaggctgtgctcccaactggatcctgcgcgggcaatcctttatttacgtccc
KR811467_X_P-C      atggatgctaggctgtgctgccaactgratcctgcgcgggacgtcctttgtctacgtccc
KC774264_X_P-C      atggatgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171580_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774191_X_P-C      atggatgatagggtgtgttgccaactggatcctgcgcgggacgtcctttgtctacgtccg
KC774227_X_P-C      atgggtgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KR811476_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
KC814901_X_P-C      atgggtggtagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
X75665_X_P-C        atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
MF925403_X_P-C      atggctgctaggctgttctgccaactggattctgcgcgggacgtcctttgtctacgtccc
KU679951_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023677_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcgggacatcctttgtctacgtccc
MH488824_X_P-C      atggttgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774200_X_P-C      atggatgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB493844_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ358157_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HQ700516_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KC774229_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG826137_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF059688_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173316_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX429912_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgcccc
KC774265_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171517_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774335_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774197_X_P-C      atggttgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ536410_X_P-C      atggctgctcgggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtccc
DQ536412_X_P-C      atggctgctcgggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtccc
DQ536414_X_P-C      atggctgctcgggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtccc
DQ536411_X_P-C      atggctgctcgggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtccc
DQ536413_X_P-C      atggctgctcgggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtccc
KC774334_X_P-C      atggatgctagggtgtgttgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939542_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899767_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN104440_X_P-C      gtggctgctcggctgtgctgcaaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939541_X_P-C      atggctgctagggtgtgctgccaactggatccttcgcgggacgtcctttgtatacgtccc
KC774184_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM750131_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939548_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774220_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY028303_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171404_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171341_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410508_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774345_X_P-C      atggctgctagggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtccc
HM750136_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171351_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
FJ386611_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB642100_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040152_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916229_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU670263_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU547562_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171627_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG893560_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475356_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU589344_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774199_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774274_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386605_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089797_X_P-C      atggctggtagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774316_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774338_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171438_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939537_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774217_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
KC774189_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX026888_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562255_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386678_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
EU939582_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB300362_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
FJ386603_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774242_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX026878_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtatacgtccc
FJ562326_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU589345_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH094411_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF536065_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF536066_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013761_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013763_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013764_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtcttcgtccc
KR013767_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013768_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013895_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013766_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013769_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgcctacgtccc
KR013915_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013919_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013923_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173393_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173394_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774261_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774262_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774194_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939617_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939558_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939557_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774337_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KC774342_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF384366_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF384365_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF384364_X_P-C      atggctgctagggtgtgctgccagctggatcctgcgcgggacgtcctttgtctacgtccc
AF384367_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534674_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279245_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KJ803762_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774192_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670308_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562282_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377528_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF214655_X_P-C      atggctgctagggtgtactgccaactggatcctccgcgggacgtcctttgtctacgtccc
EU916212_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916211_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916213_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916214_X_P-C      atggctgctcgggtgtggtgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH887433_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013778_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM213037_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774278_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774187_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM750141_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
FJ386576_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB675677_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171493_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774270_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774214_X_P-C      atggatgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774181_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GU357845_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173327_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173328_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774224_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386616_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279250_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MK171602_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX429905_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MN683729_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX276835_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774356_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774232_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562319_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013786_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013779_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013781_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013782_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013783_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013784_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013785_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013780_X_P-C      atggctgctagggtgtgctgccaactgaatcctgcgcgggacgtcctttgtctacgtccc
KR013792_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013795_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013794_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013793_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013796_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410505_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774348_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774295_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171388_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MK171265_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814882_X_P-C      atggctgctagggtgtgctgccaactggtgctaatgccgttcgtcctttgtctacgtccc
KJ173313_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173314_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MN683726_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279258_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KP027477_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774284_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774185_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX661488_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX429913_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418535_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN104434_X_P-C      atggctgcttgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM750137_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475349_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475316_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377517_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787449_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562332_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386575_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939569_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY251142_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF326586_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU570068_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU570067_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU554537_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU554539_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU554538_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787470_X_P-C      atggctgctcgggtgtgctgccaactgggtcctgcgcgggacgtcctttatctacgtccc
FJ787471_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774309_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418560_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410510_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171387_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN104432_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN104433_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MN683727_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774289_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377631_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164089_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164086_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306673_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164087_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164088_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164100_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164101_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164102_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164103_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164104_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164105_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164106_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164107_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164108_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164109_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164110_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164111_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164112_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164113_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164114_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164115_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164116_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164117_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164118_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164085_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306676_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916223_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX560520_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562218_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MN683728_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM011489_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171279_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
OK106255_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774250_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377533_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279246_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279247_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279248_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279249_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB111124_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB111125_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB246344_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM359441_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013797_X_P-C      atggctgctagggtgtgctgccgactggatcctgcgcgggacgtcctttgtctacgtccc
KR013798_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013961_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN315779_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475328_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB697490_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475339_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774213_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562280_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY167096_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AF326585_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF326587_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171512_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171446_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171314_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814894_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814925_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX661491_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM011465_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG893557_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggggcgtcctttgtctacgtccc
KJ173446_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173437_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173438_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173296_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173287_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF485389_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774346_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774277_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774275_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774272_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774252_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774233_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774206_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX661489_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN104435_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475307_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
GQ377551_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377538_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377527_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787474_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562291_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ478900_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB362932_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB198078_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG893556_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774216_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774215_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341872_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534588_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774209_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924633_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386588_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB198081_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ993690_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ790199_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814912_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggagtgtctttgtctacgtccc
KC814911_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774223_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774257_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774259_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774182_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377531_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ478899_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916237_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916238_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171281_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ478885_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814893_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475321_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT426108_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173445_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774247_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013762_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013765_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562297_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774287_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171509_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562233_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386587_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774339_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306719_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306720_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306721_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171311_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171390_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279254_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279255_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279256_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279257_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774255_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171367_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377523_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774190_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM750138_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ688404_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173426_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF873544_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
KC814919_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171608_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ027317_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM875412_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803790_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ671249_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ671250_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ675792_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013870_X_P-C      atggctgctcggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtccc
KR013871_X_P-C      atggctgctcggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtccc
KR014077_X_P-C      atggctgctcggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtccc
KR014078_X_P-C      atggctgctcggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtccc
KR014082_X_P-C      atggctgctcggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtccc
KR014079_X_P-C      atggctgctcggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtccc
KR014083_X_P-C      atggctgctcggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtccc
MT644997_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT645008_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645013_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645020_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU410079_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439310_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439326_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924622_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB241112_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB241113_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB241111_X_P-C      atggctgctcggttgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtccc
AB241110_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU410081_X_P-C      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AP011099_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AP011101_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT645009_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AP011100_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU410080_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439307_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439308_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439309_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439311_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439312_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439314_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439318_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439319_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439325_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439327_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439315_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439316_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439317_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439320_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439321_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439322_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439323_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439328_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439329_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439330_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439331_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439313_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT644996_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439324_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924620_X_C-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439629_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
MZ439631_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
MZ439637_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
MK534677_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534638_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN827414_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN827415_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645011_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534636_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534640_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ675793_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173335_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173336_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT644999_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439613_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645010_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439602_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439625_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439632_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439633_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439635_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439634_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439638_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439624_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439601_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439603_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439604_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439605_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439607_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439608_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439609_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439610_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439611_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439612_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439614_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439615_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439618_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439619_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439620_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439621_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439616_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MZ439606_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439617_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439622_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439623_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645007_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439626_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
MZ439627_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
MZ439628_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
MZ439639_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
MZ439630_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439636_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645019_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF241410_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ671248_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ675791_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645021_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645014_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB112472_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB112066_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341878_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ855543_X_P-C      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ904423_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KX276850_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM011488_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB112065_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM011472_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK818227_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803818_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ478901_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB112348_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089768_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AP011097_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801505_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcggaacgtcctttgtctacgtccc
GQ377536_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ671245_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ675787_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB246346_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB117758_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803826_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341875_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089771_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ671234_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ671246_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ675790_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171635_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341891_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM875428_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924655_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410493_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171537_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341896_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341863_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG571345_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674429_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410496_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341886_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX507214_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
DQ089758_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410518_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX870000_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801495_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB105174_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171417_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB111946_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341885_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC592171_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC592172_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG571332_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX276852_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801517_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924636_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF494379_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089766_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089763_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089762_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089761_X_P-C      atggctgctaggttgtgctgcccactggatcctgcgcgggacgtcctttgtctacgtccc
AY167099_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674475_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF223958_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674402_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801481_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801483_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ671241_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG725248_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674435_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674398_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341902_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171633_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089759_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF594748_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925410_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ855525_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MF674502_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924612_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924613_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924649_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803793_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK628732_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925369_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925387_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925398_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925405_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925374_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171465_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171368_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341890_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ341868_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341859_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU305540_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341860_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645006_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645012_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925375_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674514_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674457_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674386_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX276851_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013927_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173324_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ027318_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN104437_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtctacgtccc
EF594753_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089767_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089765_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY251140_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB105173_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173323_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023646_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AJ748098_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF223961_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089760_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013787_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410504_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089769_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534650_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534656_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089770_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765824_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU305542_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU305541_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341898_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674454_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674472_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410501_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410513_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF473543_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811748_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811763_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811756_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811754_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811749_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811747_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023653_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023650_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF223957_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811746_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811750_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811762_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534628_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811760_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811758_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171472_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439575_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674494_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674486_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674468_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC875269_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023655_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF223960_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089773_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ688403_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439552_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439554_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439555_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439556_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439557_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439558_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439559_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439560_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439561_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439562_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439563_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439566_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439567_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439568_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439569_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439570_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439573_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439574_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439576_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439578_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089790_X_P-C      atggctgctaggctgtgctgccaactggatmctgcgcgggacgtcctttgtytacgtccc
KX276846_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811755_X_P-C      atggctgctatgctgtgctgccaactggatcctgcgcgggacatcctttgtctttgtctc
KJ803774_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ027322_X_P-C      atggctgctaggrtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
KM875406_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU717214_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU872005_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341865_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX276840_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803810_X_P-C      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410514_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013900_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ027320_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439685_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013903_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ027321_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT426107_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013826_X_P-C      atggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013823_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013820_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF688062_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ089787_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089783_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089780_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089784_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089781_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089779_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttkgtctacgtccc
KR013821_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013996_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013822_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013825_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013824_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674442_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatctacgtccc
DQ246215_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171301_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341895_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013902_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013856_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013857_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctctgtctacgtccc
KR013855_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013854_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377632_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939554_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089789_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY862869_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341883_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013904_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410519_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089786_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF223955_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089782_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013770_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013899_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013905_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341877_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF223956_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF223959_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX276849_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB074047_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX507211_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803770_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX026880_X_P-C      atagctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcct
KR013849_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013844_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013846_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013848_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013847_X_P-C      atggctgctagggtgtgctgccaactggaccctgcgcgggacgtcctttgtctacgtccc
KR013842_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013845_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG571359_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MN066399_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341887_X_P-C      atggctgctaggmtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997796_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997801_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997906_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997840_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997841_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997846_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089778_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674430_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040165_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023648_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089764_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803766_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089775_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY167092_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtcttcgtccc
MZ439392_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439393_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439400_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439402_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439406_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439396_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439399_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439403_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674403_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU498227_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803757_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439571_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439577_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC875265_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC875268_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439598_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439596_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439590_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439580_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439581_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439582_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439583_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439584_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439585_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439586_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439587_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439588_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439589_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439591_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439592_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439593_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439594_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439595_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439597_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439599_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439600_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC875272_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ027333_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439386_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439553_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439564_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439565_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674504_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX504535_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439385_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439338_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439343_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439341_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439345_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439332_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439333_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439335_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439337_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439339_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439340_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439342_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439344_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439346_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439347_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439348_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439349_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439350_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439352_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439353_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439354_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439355_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439356_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439357_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439358_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439359_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439360_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439336_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439382_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439398_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439401_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439405_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439387_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439369_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439372_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439391_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439394_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439395_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439397_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439404_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439376_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439378_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674501_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439371_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439366_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439381_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439390_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439364_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439334_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439351_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439361_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439362_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439365_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439367_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439368_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439370_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439373_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439374_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439375_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439377_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439379_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439380_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439383_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439388_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439389_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439363_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439384_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707768_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707769_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707770_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707771_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707772_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707774_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707773_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171324_X_P-C      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
KX276841_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171527_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040133_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410498_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811745_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811730_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF214669_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674489_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811752_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811744_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctctgtctacgtccc
KR811742_X_P-C      atggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811728_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811725_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811723_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811740_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341888_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811459_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811757_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811751_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811743_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811733_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811734_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811726_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811739_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811753_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811736_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811729_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811741_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811764_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811737_X_P-C      atgggtgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811722_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811727_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR811732_X_P-C      atgggtgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774179_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774297_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171648_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534586_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171274_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171405_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171406_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF488701_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089772_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674425_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674458_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674471_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341855_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410511_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089756_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF197911_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU547559_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826143_X_P-C      atggttgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171315_X_P-C      atggctgctcggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF594755_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645003_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ027324_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtytacgtccc
MK171496_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089785_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB112408_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341893_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF925367_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410515_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF214675_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF594751_X_P-C      atggctgctcggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
KJ803780_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410489_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgcccc
KJ410499_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410494_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgcccc
KJ410495_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgcccc
KJ410491_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ410492_X_P-C      atggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF488703_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341899_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM875430_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089792_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674484_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF674411_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674388_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
KJ997856_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803760_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF214676_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF214672_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ801498_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089803_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534671_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF214673_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT347089_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF115898_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF115897_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF115899_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ184326_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ222210_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ222211_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ222212_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX507212_X_P-C      atggctgctaggatgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
MF674428_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801482_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801515_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM875424_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcggaacgtcctttgtctacgtccc
KM875425_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC315399_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801509_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT644995_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT114171_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK534595_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG826123_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925394_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925376_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674408_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765839_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX429617_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148563_X_P-C      atggctgctaggctatgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801521_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801518_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801472_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ855541_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023652_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ315782_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
DQ089791_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089777_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB112063_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB074756_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtttacgtccc
MK534652_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674418_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX276853_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ855537_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534557_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925409_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674444_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765828_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF594752_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT366464_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765822_X_P-C      atggctgctaggctgtgctgccaactggatcctgcscgggacgtcctttgtctacgtccc
KX765842_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN827422_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ801502_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ439270_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439271_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439272_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439273_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439274_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439275_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439276_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439277_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439278_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439279_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439280_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439281_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439282_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439283_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439284_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439285_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439286_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439288_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439289_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439290_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439291_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439292_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439293_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439294_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439296_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439297_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439298_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439299_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439300_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439301_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439302_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439303_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439304_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439305_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439306_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439287_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439295_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803776_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023645_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089757_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534619_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534645_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765820_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803823_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801489_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM011468_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534593_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148560_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148547_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148545_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148532_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148513_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148512_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148473_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148471_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148468_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148466_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801501_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148570_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148558_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148549_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148546_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148493_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148480_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148472_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148315_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148462_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148464_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148469_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148477_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148479_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148481_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148482_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148488_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148540_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148561_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148564_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148571_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148463_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148551_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148572_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148575_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148538_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148535_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148525_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148514_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148520_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148523_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148537_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148517_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148519_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148521_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148524_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148526_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148529_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148530_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148531_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148534_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148566_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148548_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148555_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148574_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148568_X_P-C      atggctgctaggctgtgctgccgactggatcctgcgcgggacgtcctttgtctacgtccc
KP148543_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148470_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148474_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148475_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148476_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148552_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148554_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148557_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KP148562_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439720_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439710_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439644_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534649_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534596_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925365_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674390_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470917_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470916_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470915_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgccctttgtctacgtccc
KY470913_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470911_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcaggacgtcctttgtctacgtccc
KY470909_X_P-C      atggctgctaggctgtgctgccaactggatcctgcacgggacgtcctttgtctacgtccc
JQ801499_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ801497_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN574724_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF594750_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089788_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089776_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB205125_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439678_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925359_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF384201_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF384205_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF394328_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470914_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470906_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470907_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470908_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470918_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470920_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470912_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418553_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470910_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171640_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534597_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439671_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF214671_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925395_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801503_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF594749_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF594754_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN827423_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ315781_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ315783_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801522_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341892_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ518364_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924616_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ429078_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801490_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ855521_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674417_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674467_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645000_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439730_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439728_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MZ439727_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439704_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439686_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439692_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439677_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439672_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439668_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439682_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439683_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439688_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439640_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439641_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439642_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439643_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439645_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439647_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439648_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439649_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439650_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439651_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439653_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439654_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439655_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439656_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439657_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439658_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439659_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439660_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439661_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439662_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439663_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439664_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439665_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439666_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439667_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439669_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439670_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439675_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439676_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439679_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439680_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439681_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439684_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439689_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439690_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439691_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439694_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439695_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439696_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439697_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439698_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439699_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439700_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439701_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439702_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439703_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439705_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439706_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439707_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439708_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439709_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439711_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439712_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439713_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439714_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439715_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439717_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439718_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439719_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439729_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439732_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439736_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439652_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439687_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418536_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC875270_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439733_X_P-C      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
MZ439734_X_P-C      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
MZ439735_X_P-C      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
MZ439737_X_P-C      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
MZ439716_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439721_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439722_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439723_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439724_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439725_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439726_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC875273_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC875274_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997766_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997785_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997786_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674463_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439572_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163865_X_P-C      atggctgctaggatgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
KC163868_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163875_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163874_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163872_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163869_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163866_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163867_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163879_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163880_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163886_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163884_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163883_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163873_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163871_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163881_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163904_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163897_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163895_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163882_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163876_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163877_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163896_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163898_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163899_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163900_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163901_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163887_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163888_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163890_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163889_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163892_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX276848_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcggracgtcctttgtctacgtccc
KJ803754_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924658_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924604_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924623_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803792_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ855531_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023643_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023644_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ855528_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765855_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765819_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765847_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418527_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173285_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ173286_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtytacgtccc
KJ803779_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924642_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765852_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM011491_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803794_X_P-C      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ349225_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013839_X_P-C      atggctgttaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KR013836_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgcctacgtccc
KR014021_X_P-C      atgactgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KR013841_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KR013835_X_P-C      acggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KR013837_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KR013838_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KR013840_X_P-C      atggctgccaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KX276847_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacrtcctttgtctacgtccc
KX276844_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU051423_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ361534_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765829_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT987426_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
JQ341889_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801500_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ855534_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ358154_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089804_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765845_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT235627_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT235628_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801488_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924643_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765838_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtttacgtccc
JN418519_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439486_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439451_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439456_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439472_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439479_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439482_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439492_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439493_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439495_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439497_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439498_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439500_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439502_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439503_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439504_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439505_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439506_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439507_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439508_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439509_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439510_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439513_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439515_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439516_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439419_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439437_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439438_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439439_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439440_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439441_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439442_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439443_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439445_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439446_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439447_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439448_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439449_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439450_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439452_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439453_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439454_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439463_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439466_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439467_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439478_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439483_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439496_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439461_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439464_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439481_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439484_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439485_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439488_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439459_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439465_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439489_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439455_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439457_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439458_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439460_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439462_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439468_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439469_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439470_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439471_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439473_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439474_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439475_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439476_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439477_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439480_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439487_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439490_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439491_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439494_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439499_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439501_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439511_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439512_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439514_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439407_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439408_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439409_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439410_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439411_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439414_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439415_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439416_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439417_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439418_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439420_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439422_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439423_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439424_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439425_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439426_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439427_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439429_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439431_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439432_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439433_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439434_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439435_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439436_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439412_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439413_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439421_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439428_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439430_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ439444_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164038_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164037_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164036_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164044_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164042_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164041_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164040_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164046_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164047_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164048_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164049_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164050_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164051_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164052_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164053_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164054_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164055_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164056_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164057_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164058_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164059_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164060_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164061_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164062_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164063_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164065_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164066_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164067_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164068_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164069_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164070_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164071_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164072_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765836_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF214668_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801523_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801491_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674412_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ671247_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ675789_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534657_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765851_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765834_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023654_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
FJ023651_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KX276854_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925378_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924615_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164127_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164126_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164125_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164123_X_P-C      atggctgctgggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164122_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164120_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164124_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164128_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164129_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164130_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164131_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164132_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164133_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164134_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164135_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164136_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164137_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164138_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164139_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164140_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164141_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164142_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164143_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164144_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164145_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164146_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164147_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164148_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164149_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164150_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164151_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164121_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF899336_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
EU306690_X_P-C      atggctgctaggccgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306685_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306687_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306688_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306689_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306691_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534644_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774228_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534622_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826122_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT987423_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU051427_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997811_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997816_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997815_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ855533_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023656_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC875264_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC875271_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC875267_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997826_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997830_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997831_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ997829_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765823_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF223954_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341857_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801473_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023647_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801504_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765827_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534678_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF674474_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtctacgtccc
KY470936_X_P-C      atggctgctaggctgtgctgccgactggatcctgcgcgggacgtcctttgtctacgtccc
KX765825_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT366463_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT364718_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803812_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774236_X_P-C      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
JQ801510_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801496_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801480_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023658_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB300363_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801478_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ924650_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB031262_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470937_X_P-C      atggctgctaggccgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765849_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT307718_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT364721_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534647_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765821_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803759_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803761_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttggctacgtccc
GQ924619_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765830_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB074755_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB112471_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803800_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN827424_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN827425_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT364719_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT364720_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765843_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534605_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534604_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534720_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534667_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MF925377_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765844_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765837_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU051425_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT307719_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801519_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801513_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801475_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924629_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ855530_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ358153_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023642_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023640_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023639_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF068756_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534642_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT987425_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KU051424_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU051426_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803799_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765832_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765826_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801493_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801511_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GU563561_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801470_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765853_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801520_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765840_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418500_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ855523_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023641_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ855548_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN827416_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT111596_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023657_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ023649_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB247916_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
JQ801508_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765833_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765846_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ924609_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925406_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF925408_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534643_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534624_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534666_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765848_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765831_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT235617_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ801486_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN827421_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN827418_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN827417_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN827420_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT987424_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765818_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX765850_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534631_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HQ700522_X_P-C      atggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
HQ700543_X_P-C      atggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AB115418_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH488859_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU522071_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171325_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171339_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB115417_X_P-C      atggctgctaggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
EF494377_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803809_X_P-C      atggctgctagggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY206386_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX276836_X_P-C      atggctgctaggctgtrctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803777_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU882005_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX276833_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
JN418509_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ027332_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB931170_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB931171_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB900113_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418505_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB368297_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB049610_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB900109_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171454_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
MK171361_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171340_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418546_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964049_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964050_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964051_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964052_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964053_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964054_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964055_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964056_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964057_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964058_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964059_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964060_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964061_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964062_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964063_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826125_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY206385_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367431_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171533_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171329_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtcttcgtccc
DQ089801_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964028_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964020_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964021_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964022_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964023_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964024_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964025_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964026_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964029_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964030_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964031_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964032_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964033_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964027_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562298_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171289_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774203_X_P-C      atggatgttagggtgtgttgccaagtggatcgtgcgcgggacgtcctttgtctacgtccc
KF873539_X_P-C      atggctgctcggttgtgctgcgaactggatcctgcgcgggacgtcctttgtctacgtccc
KF873541_X_P-C      atggctgctcggttgtgctgcgaactggatcctacgcgggacgtcctttgtctacgtccc
KU679937_X_P-C      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
HQ700577_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700575_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700457_X_P-C      atggctgctcggatgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700570_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700562_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700556_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700563_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700564_X_P-C      atggctgctcggatgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700565_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700504_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700568_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700573_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700502_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700574_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700529_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HQ700576_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctmcgtccc
HQ700572_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700569_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700567_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700475_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700578_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700476_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700571_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700456_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700555_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700490_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700495_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700496_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700559_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700566_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700558_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
HQ700561_X_P-C      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
KF873536_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU679960_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH488821_X_P-C      atggctgccagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU679947_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU679957_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF873526_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF873528_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF873529_X_P-C      atggctgctyggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF873525_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU679936_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU679949_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF873514_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF873516_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF873520_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939586_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB900115_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171646_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB493839_X_P-C      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
MK171345_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040149_X_P-C      atggctgctaggrtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645027_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171637_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171617_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645022_X_P-C      atggctgctagggtgtgctgcaaactggatcctgcgcgggacgtcctttgtctacgtccc
HQ700517_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171382_X_P-C      atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
EU939553_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171322_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
MK171630_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171449_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB300373_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH488831_X_P-C      atggctgctaggacgtgctgccaactggaccctgcgcgggacgtcctttgtctacgtccc
KC774319_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562310_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670311_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB300368_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013777_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KX429625_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171564_X_P-C      atggctgctaggatgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
AB670253_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939579_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899774_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ671240_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ675788_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ671242_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171500_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171457_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171394_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171318_X_P-C      atggctgctaggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KC774279_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040151_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT644998_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418552_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916226_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089796_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AY206388_X_P-C      atggctgctggggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ671243_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787488_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040143_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171258_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171259_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826140_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598769_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598762_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598778_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598772_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598770_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598775_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598768_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598767_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598773_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598776_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598777_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598766_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598771_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598774_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598779_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598780_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598756_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598757_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598760_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598765_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598761_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171473_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645028_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171471_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645017_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171621_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC875262_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgggggacgtcctttgtctacgtccc
JN418542_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377593_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
GQ377518_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386689_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939594_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939592_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939583_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB300360_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341870_X_P-C      atggctgctaggrtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916224_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171363_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040166_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171299_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562306_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU919168_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341903_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU562215_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU562216_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU562217_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787457_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787458_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ227692_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ227697_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ227693_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ227694_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ227695_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ259588_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ227696_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM750134_X_P-C      atggctgctagggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM750135_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171411_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171435_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171415_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171353_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341879_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939647_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645026_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171583_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803765_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418498_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899768_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562264_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY206378_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014390_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB971714_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB971715_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB485809_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB485810_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171582_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787489_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY206382_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787442_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787443_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562243_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774355_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171355_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171330_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367417_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU939587_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM011500_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939536_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377540_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939571_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939643_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171590_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470886_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470888_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470880_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377617_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377605_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939570_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470889_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470883_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470873_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470876_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470878_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470879_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470884_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470892_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470891_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470890_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470887_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470885_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470874_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470875_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470877_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470882_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386626_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470881_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU560440_X_P-C      atggctgctagggtgtgctgccaactggatcctccgcgggacgtcctttgtctacgtccc
EU579442_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562244_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF059674_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171591_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774340_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386685_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089795_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171362_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ027319_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM011481_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX276839_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU919165_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939651_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774243_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032355_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032356_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939616_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562288_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418496_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171320_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171433_X_P-C      atggctgctaggatgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
MG826131_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163906_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826138_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306671_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
EU306672_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KX276855_X_P-C      atggctgctcggttgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826132_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171554_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY251141_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826139_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826128_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826129_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826136_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826134_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826133_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826135_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AP011106_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AP011107_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX429658_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171459_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB113878_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195930_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195931_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195932_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB697502_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670298_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377623_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
AB042285_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787490_X_P-C      atagctactagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014360_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171347_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670268_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670304_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtatacgtccc
MK171540_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475357_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367405_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctccgtccc
AB014386_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386624_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ372968_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN418558_X_P-C      atggctgctcggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
GQ475343_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377601_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367426_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367801_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM011479_X_P-C      atggctgctaggrtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX276837_X_P-C      atggctgctaggrtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828937_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670292_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670265_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367392_X_P-C      atggctgctcgggtgtactgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB014368_X_P-C      atggctgctcgggtgtgctgccaattggatcctgcgcgggacgtcctttgtytacgtccc
JF828925_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828921_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828922_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828923_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828926_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828928_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828930_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828924_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828929_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828931_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH488850_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ027323_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377577_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377576_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899788_X_P-C      atggcagctagggtgtgctgccaactggatcctgcgcgggacgtcttttgtctacgtccc
AB670278_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670262_X_P-C      atggctgctcgggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ683578_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY641558_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN400087_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN400088_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN400089_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645054_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363257_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367432_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB367804_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB670272_X_P-C      atggctgctcgggtgtgctgccaactggatccttcgcgggacgtcctttgtttacgtccc
AB670246_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ671244_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171641_X_P-C      atggctgctcgggtgtgctgccaactggatcttgcgcgggacgtcctttgtctacgtccc
KY363264_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367409_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgggggacgtcctttgtctacgtccc
AB367399_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB104892_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB471853_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB471851_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB471852_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363266_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363267_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013791_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377620_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
FJ562299_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KY363282_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363283_X_P-C      atggctactcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171268_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032346_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032347_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014374_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171442_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB042284_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386621_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670266_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670301_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY206389_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ151413_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171574_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH488809_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363275_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX504534_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562304_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670290_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367423_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367412_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB106895_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367401_X_P-C      atggctgctcggatgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtccc
KY363268_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN418512_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377572_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014363_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475330_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418506_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU570073_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU570074_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014371_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562340_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386597_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386667_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562269_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171514_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU570072_X_P-C      atggctgctagggtgtgctgccaactggaccctgcgcgggacgtcctttgtctacgtccc
EU560438_X_P-C      atggctgctagggtgtgctaccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU560439_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418539_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363278_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363279_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171412_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171445_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB485808_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367402_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367403_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH891502_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670239_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670240_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363287_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367420_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367425_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774225_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367406_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645046_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB222714_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB222715_X_P-C      catgctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171317_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386629_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ475326_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939572_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040156_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY247032_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899765_X_P-C      atggctgccagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899764_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899763_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899775_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939538_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899761_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916219_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899789_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562232_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939615_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386671_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916222_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171431_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386647_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
EU939550_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY641560_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367433_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367413_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014394_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtytacgtccc
AB365451_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367427_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcgtttgtctacgtccc
AB014376_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670243_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195942_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195943_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195944_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670242_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670256_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171338_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341900_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363284_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363260_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KF214651_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774245_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418504_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ872211_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475355_X_P-C      atggctgctcgggtgtgctgccaactggatcctrcgcgggacgtcctttgtctacgtccc
GQ475353_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475333_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475324_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU881996_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
D12980_X_P-C        atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670295_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670277_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670241_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB642095_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367422_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367421_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB300361_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195946_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195945_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB176642_X_P-C      atggctgctcggrtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB298720_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB298721_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040135_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040161_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670288_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367435_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367398_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475319_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670291_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279252_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AB205124_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670247_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670283_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279251_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279253_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670260_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB182589_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367394_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475317_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670310_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418494_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195947_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195948_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670255_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171302_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670297_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
D50517_X_P-C        atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
D50518_X_P-C        atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475354_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171629_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171578_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363274_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctatgtccc
KJ803769_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386607_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475327_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475334_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363285_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475341_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475342_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475351_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU919164_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562284_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171358_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171610_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418507_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475332_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475315_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475312_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475314_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475336_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670302_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306726_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171597_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670252_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670300_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367411_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB202071_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB202072_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670306_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH818373_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY311588_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
D50519_X_P-C        atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367408_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
D50520_X_P-C        atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377618_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645051_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814871_X_P-C      aaggctgctagggtgtgctgccaactaaactctgcgggagacgttctttgtctacgtccc
FJ386644_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089800_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH488822_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377636_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562266_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939556_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ787485_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787482_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787483_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171344_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363254_X_P-C      atggctgctagggtgtgctgccaactggatcctgtgcggggcgtcctttgtctacgtccc
KC774210_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ890381_X_P-C      atggctgctggggtgtgctgccaactggatcctacgcgggacgtcctttgtttacgtccc
GQ377526_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171300_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774283_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU939595_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774326_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX429918_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU919169_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171559_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF485390_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377580_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171327_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774301_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916227_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171391_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171312_X_P-C      atggctgctagggtgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
MK171267_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881805_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964014_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418540_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ475352_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939642_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY206392_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF182804_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195949_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KC814903_X_P-C      atggctgctagggtgtgctgccaactgaattacgcgcgggaggtcctttgtctacgtccc
KC814927_X_P-C      atggctgctagggtgtgctgccaactgaattacgcgcgggaggtcctttgtctacgtccc
MT645055_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX661497_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418515_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377584_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU872012_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171393_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF324347_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418555_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939560_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279275_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279276_X_P-C      atggctgctaggctgtgctaccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032336_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032338_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279274_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC318702_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562252_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939580_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY028298_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF325701_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF325199_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF325700_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY028597_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040162_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttctctacgtccc
FJ386670_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871975_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871977_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU872008_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ986376_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871978_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871979_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU522069_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871970_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939614_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562331_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF182805_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ151414_X_P-C      atggctgctaggatgtgatgacaactggatcctgcgcgggacgtcctttgtctacgtccc
AF182803_X_P-C      atggctgctaggatgtggtgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871969_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871974_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871973_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871971_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ788835_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF182802_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871972_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014005_X_P-C      atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB111115_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB111116_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB111117_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ475306_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB367418_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB670309_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN418503_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ518810_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386662_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814902_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814899_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814926_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB042282_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AB042283_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
AF461358_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF461359_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171487_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171423_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU939564_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363252_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcggggcgtcctttgtctacgtccc
GQ475310_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ787462_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ562337_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562313_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386661_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386619_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939545_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY641561_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY220699_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU872003_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU872002_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU872000_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU872001_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU872004_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814866_X_P-C      atggctgctagggtgtgctgccaactggattctatgcgcgaagtcctttgtctacgtccc
JF828911_X_P-C      atggctgcccggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828906_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828907_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939610_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386595_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040163_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtytacgtccc
FJ562308_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386632_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF436920_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171346_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB111121_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB111122_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB111123_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171586_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
MK171262_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171626_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY363253_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013975_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
JQ040145_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787463_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ386579_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032351_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032350_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939567_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU522068_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ993693_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013790_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013788_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013937_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013789_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814887_X_P-C      atgggtggtagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814923_X_P-C      atgggtggtagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814854_X_P-C      aaggctgttagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814855_X_P-C      atggctgttagggtgtgctgccaactggatcttgcgcgggacgtcctttgtctacgtccc
AY167090_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939645_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562251_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386594_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF363961_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY596108_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171430_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171291_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964360_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964358_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964352_X_P-C      atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964349_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964363_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964364_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KR013801_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ562283_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU939600_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF533983_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964350_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964353_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964354_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964355_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964356_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964357_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964359_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964361_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964362_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KU964365_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ377530_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171530_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645038_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ386602_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014382_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB014385_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ040132_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814852_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171452_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM011493_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562300_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598724_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598732_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598739_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964239_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598722_X_P-C      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964241_X_P-C      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598728_X_P-C      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964234_X_P-C      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598738_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598734_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598723_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598729_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598735_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964231_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964232_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964233_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964240_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598731_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964229_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598727_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964235_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598725_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964237_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598721_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964242_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598730_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964230_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598720_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598726_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964236_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964238_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964243_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598736_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598737_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598733_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598674_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598667_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598662_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598669_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598678_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598677_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598672_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598670_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598663_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598665_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598666_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598668_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598671_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598673_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598676_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598664_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774235_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171389_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163949_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC163950_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttatctacgtccc
KC163958_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163957_X_P-C      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163956_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163954_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163948_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgcctacgtccc
KC163961_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163952_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163953_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163959_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163963_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163955_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163962_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163971_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163970_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163969_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163966_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163967_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163965_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163964_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163968_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163972_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163973_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163974_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163975_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163976_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163977_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163978_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163979_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171519_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826126_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377555_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF495606_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171436_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171399_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171526_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173333_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ173334_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX504537_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY670782_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470985_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KY470986_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KY470980_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KY470981_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KY470982_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KY470984_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KY470988_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KY470983_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KY470990_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KY470991_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KY470987_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KY629637_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY251135_X_P-C      atggctgctatgctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963900_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963901_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963902_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963903_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963904_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963905_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963906_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963907_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963908_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963909_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963910_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963911_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963912_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963913_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963914_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY629631_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY251134_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG826127_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH488839_X_P-C      atggttgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418565_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
JN418510_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363276_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363277_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562245_X_P-C      atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HQ700506_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AY247031_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163947_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttatctacgtccc
GU721029_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcggaacgtcctttgtctacgtccc
MK171531_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171616_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013800_X_P-C      atggctgctagggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939578_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171624_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774343_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386638_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171508_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171295_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
D00630_X_P-C        atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY308741_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598658_X_P-C      atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598645_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598642_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598639_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598654_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598657_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598661_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598655_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598641_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598660_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598638_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598637_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598635_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598646_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598659_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598636_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598640_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598644_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598647_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598648_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598649_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598650_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598651_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598652_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598653_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598656_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939599_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386596_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386687_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY641563_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF137802_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EF137803_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418554_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418556_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171479_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171453_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562318_X_P-C      atggctgctagggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtccc
FJ562221_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU717212_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
AB014372_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtytacgtccc
AB014365_X_P-C      atggctgctcgggtgtgctgccaactggatcttgcgcgggacgtcctttgtctacgtccc
JQ040141_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171264_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475347_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY641559_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814910_X_P-C      atggctgctagggtgtgctgccaactggatcctgctcgggaggtcctttgtctacgtccc
MK171625_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AB670273_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ341897_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774269_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY596107_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645036_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173295_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386577_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171323_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562330_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377603_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171483_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171464_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171271_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX026877_X_P-C      atggctgctagggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH488838_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418514_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475325_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475313_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ751770_X_P-C      atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939549_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU439010_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899793_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899794_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171639_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014367_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377535_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377553_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171549_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939585_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386641_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828915_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
JF828917_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
JF828916_X_P-C      atggctgctcggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
JF828919_X_P-C      atggctgctcggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
GQ475345_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
JN418523_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
JF828913_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
JF828918_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
JF828920_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KC774299_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475344_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY641562_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386630_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171309_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774251_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774208_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774331_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171458_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171440_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171392_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040129_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899795_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562295_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562285_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939641_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ377160_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171521_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939652_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171634_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU439013_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171600_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171373_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774240_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787469_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032332_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939658_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU439025_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU439014_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU439009_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306727_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306725_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU439005_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306722_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306713_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ377164_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
DQ377161_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ377162_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ377163_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ377165_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306714_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306724_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306728_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU306729_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU439011_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU439012_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787468_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171277_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MW310259_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY057947_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377621_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MZ671235_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MZ671251_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
HM011495_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670259_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcca
KY470926_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470927_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645043_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX429914_X_P-C      atggccgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089802_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MK171447_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF214667_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF214670_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171328_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF214677_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171520_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171480_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171560_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ855544_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH220971_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670263_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171316_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645072_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT284756_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR819180_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774352_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418533_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB113877_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB111114_X_P-C      atggctgctcggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AB111112_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AB111113_X_P-C      atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
HM011486_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM875404_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM875405_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM011497_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG571335_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HQ622095_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939573_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171269_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645004_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171619_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173319_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475309_X_P-C      atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
EU939644_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939601_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB900116_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670264_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939539_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562325_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB250109_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171550_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgrgacgtcctttgtctacgtccc
MK171551_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418544_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916225_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367404_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB198082_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418493_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX560519_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171360_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171326_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171370_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386645_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171297_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363286_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418543_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670281_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195936_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195937_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195938_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670270_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939540_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386601_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562334_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB113875_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AB113876_X_P-C      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
EU939648_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171462_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171400_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814863_X_P-C      atggctgctaggctgtgctgccaactgggtctcgcgcgggacgtcctttgtctacgtccc
FJ562241_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939546_X_P-C      atggctggtagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ986375_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171485_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX661495_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU717215_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814880_X_P-C      tttgctgctagggtgtgctgtcaacttgatgatgccgaagacgttctttgtctacgtccc
FJ386640_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
D23682_X_P-C        atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
D23683_X_P-C        atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814884_X_P-C      atggctgctagggtgtgctgccaactgagcctaacgccggaagtcctttgtctacgtccc
GQ377597_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU554541_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FJ032345_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
EU554542_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KC814877_X_P-C      atggctgctagggtgtgctgccaactaacagaggccggagacgttctttgtctacgtccc
KT284754_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377624_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171506_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG826124_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916233_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916234_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF059475_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040144_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377575_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386612_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171384_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814913_X_P-C      atggctgttagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU717217_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899770_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386614_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171444_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171379_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363261_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ173289_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173301_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173302_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX504539_X_P-C      atggccgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939618_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
EU939574_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171484_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171397_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171398_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX429903_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562238_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014059_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014057_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013862_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014055_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014060_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013859_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013860_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013861_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814881_X_P-C      ttggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF411412_X_P-C      atggctgctagggtgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
MK171352_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899769_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562275_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ922649_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY306136_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670282_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014389_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU939563_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899771_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774353_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377640_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670254_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562272_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871976_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089799_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
EU939605_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814915_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787452_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963915_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963916_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963917_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963918_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963919_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963920_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963921_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963922_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963923_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963924_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963925_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963926_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963927_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963928_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963929_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KM875423_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562258_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195952_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195953_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB195954_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562228_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171357_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171557_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814916_X_P-C      atggctgctagggtgtgctgccaactgggtcctgcggagtacgtcctttgtctacgtccc
MK171261_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562279_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386637_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ975274_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171522_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814865_X_P-C      ttggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377642_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562315_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377637_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814892_X_P-C      atggctgttagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814914_X_P-C      atggctgttagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032339_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171577_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171504_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
MK171348_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171293_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171620_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtccc
KP784761_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX026885_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040167_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418541_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377600_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377574_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787461_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ562248_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ518813_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670307_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774358_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418501_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU439016_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013974_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ377578_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KR013969_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171359_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171596_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB014364_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ386592_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC814857_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386657_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814858_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814891_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814924_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY206381_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF059725_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171333_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013799_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377515_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377619_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562324_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562274_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU881999_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173429_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173430_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU882000_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171491_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367410_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
FJ787455_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgttcacgtccc
FJ562265_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ787456_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU939568_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU939646_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB198080_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774333_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT645037_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ386650_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB198077_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB205123_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774231_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ475338_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MF059652_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ377541_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377585_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386589_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AB198076_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FJ386604_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787437_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774260_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774267_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040127_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
X04615_X_P-C        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013865_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013863_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013866_X_P-C      atggctgctagggtgtgctgccaaccggatcctgcgcgggacgtcctttgtctacgtccc
KR013864_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013867_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814922_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggaggttctttgtctacgtccc
MT645032_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814888_X_P-C      ataggtggtagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB697510_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645023_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtctacgtccc
JN418508_X_P-C      atggctgctcgggtgtgctgcaaactggatcctgcgagggacgtcctttgtctacgtccc
JN418550_X_P-C      atggctgctcgggtgtgctgcaaactggatcctgcgagggacgtcctttgtctacgtccc
KY470929_X_P-C      atggctgctagggtgtgctgccaaccggatcctgcgcgggacgtcctctgtctacgtccc
GQ377514_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386672_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386617_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475337_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774354_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470934_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470933_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470925_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470930_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475305_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475329_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475346_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171561_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645033_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363280_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774329_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787487_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562268_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386620_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU717218_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU562218_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
X52939_X_P-C        atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032333_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386665_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB026815_X_P-C      atggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670276_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX504542_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418532_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377628_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HQ638218_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645030_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964225_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT284758_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM750139_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475308_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ377562_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377559_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562301_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032331_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939593_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916216_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377554_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377570_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562320_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT284757_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939552_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939612_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562225_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964227_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964216_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964218_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964221_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964215_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964217_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964220_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964223_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964226_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964214_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964219_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964222_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964224_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964228_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670305_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014387_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171534_X_P-C      atggctgctcgggtgtgctgccaactggatactgcgagggacgtcctttgtttacgtccc
AB367430_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367429_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367802_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171494_X_P-C      atggctgctcggatgtgctgccaactggatactgcgcgggacgtcctttgtttacgtccc
AB367396_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363258_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014377_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014361_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB697494_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418564_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418528_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418524_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367395_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367416_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367803_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB033552_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418521_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB033553_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB033551_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB033556_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY363281_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367424_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418567_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670238_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475320_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK321266_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK720629_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK720630_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC814900_X_P-C      atggctgctagggtgtgctgccaactggatgatgcgcgggacgtcgtttgtctacgtgcc
GQ475311_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ475318_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY881816_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY881809_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY881812_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN418495_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418530_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB014396_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB014388_X_P-C      atggctgctagggtgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT645024_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN418518_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU939603_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB014391_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB014383_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774219_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171402_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
D23684_X_P-C        atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB014380_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB014384_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtccc
AB014381_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB014395_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB014392_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB014399_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ386673_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ475331_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB111118_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB111119_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB111120_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU554535_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgaccc
EU554536_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY066028_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF411408_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF411411_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU796070_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU796072_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX504541_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774286_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ922651_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939544_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ922650_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939596_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828908_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828905_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828910_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JF828912_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171585_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014393_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU939659_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171432_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964208_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964200_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964202_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964203_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964204_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964205_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964206_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964207_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964209_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964210_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964211_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964212_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964213_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964201_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171539_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014379_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171410_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU589336_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171647_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814907_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggaggtcctttgtctacgtccc
KC814928_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggaggtcctttgtctacgtccc
KC814897_X_P-C      ttggctgttagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KC814906_X_P-C      ttggctgttagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FJ562220_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171622_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774226_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KC163980_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939609_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377608_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KC163981_X_P-C      atggctgctagggtgtgctgccgaatggatcctgcgcgggacgtcctttgtctacgtccc
KC163983_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163985_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163986_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163998_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163997_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163996_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163995_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163994_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163993_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163990_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163988_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163987_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163982_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163991_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163992_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164000_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164003_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164004_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164005_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164006_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164007_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164008_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164009_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164010_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164011_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164012_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164013_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164014_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164015_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164016_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164017_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164018_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164019_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164020_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164021_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164022_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164023_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164024_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164025_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164026_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164027_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164028_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164029_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164030_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC164033_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC163999_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ980549_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
KJ173290_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939657_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774218_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171470_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF411410_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939611_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
EU939619_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AB300372_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171428_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814889_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814920_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707733_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707730_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707718_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707715_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707711_X_P-C      atggctgctaggatgtgctgcaaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707709_X_P-C      atggctgctaggatgtgctgacaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707707_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707710_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707712_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707713_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707716_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707717_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707719_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707720_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707721_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707722_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707723_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707724_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707725_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707726_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707727_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707728_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707729_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707731_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707732_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ707708_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562335_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774361_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562327_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787459_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FJ787484_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
JN418511_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ787441_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgccctttgtctacgtccc
FJ386677_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670261_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814874_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814908_X_P-C      tgggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814862_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814896_X_P-C      tgggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814909_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171425_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KU964016_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964015_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964004_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964019_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964011_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964012_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964013_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964017_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964018_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032340_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032341_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939590_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
EU939591_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ899777_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JN418525_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871980_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871998_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU872013_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171488_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418526_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM011502_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475348_X_P-C      atggctgctcgggtgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
FJ562290_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU579443_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ975273_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ980550_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787439_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787479_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171541_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
JQ040164_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386659_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY220700_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939562_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT284759_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939613_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562281_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY220702_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171319_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171401_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386591_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
FJ562339_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562242_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386598_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939576_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MK171441_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939640_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JQ040139_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171450_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171581_X_P-C      atggctgctagggtgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
FJ386613_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX504536_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645044_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171451_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386663_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562249_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM750132_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ997866_X_P-C      atggctgctgggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ997875_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ997876_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KJ803815_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803811_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803813_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ803814_X_P-C      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX276831_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418534_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171611_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171615_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF214652_X_P-C      atggctgctagggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774311_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KX276838_X_P-C      atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
MK171429_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ993181_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MT645053_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013942_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964322_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964324_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964323_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964332_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964321_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964326_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964327_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964333_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964318_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964331_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964319_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964320_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964325_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964328_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964329_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964330_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU554540_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171278_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645050_X_P-C      atggctgctaggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MT645052_X_P-C      atggctgctaggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MK171260_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013868_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377586_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377583_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089794_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171275_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ089793_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173439_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173440_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386679_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT426105_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX429909_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367407_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367414_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774313_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX661490_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171375_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774195_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MK171305_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MK171477_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171439_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171631_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377557_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939654_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916215_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY220701_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171614_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK534592_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939649_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939566_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774266_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB697500_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939597_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562273_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KR014013_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014012_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014011_X_P-C      atggctgctagggcgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014010_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014017_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014018_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014008_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014015_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014016_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014014_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgcctacgtccc
JN418561_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386627_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FJ562307_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171313_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU589340_X_P-C      atggctgctcggatgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
EU589342_X_P-C      atggctgctcggatgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
FJ562276_X_P-C      atggctgctcggatgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
FJ787481_X_P-C      atggctgctcggatgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
EU589341_X_P-C      atggctgctcggatgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
EU939653_X_P-C      atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
AF355779_X_P-C      atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
KM229703_X_P-C      atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
MT645047_X_P-C      atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
MK171505_X_P-C      atggctgctaggwtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
FJ386631_X_P-C      atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
FJ386652_X_P-C      atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
JQ040158_X_P-C      atggctgctcgggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
AB670279_X_P-C      atggctgctcgggtgtgctgccaactggatccttcgcgggacgtcatttgtttacgtccc
FJ562250_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377598_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787464_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787465_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787466_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787467_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774211_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774254_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774256_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670287_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670294_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475322_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF286594_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT426109_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670274_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377616_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377563_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670269_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013852_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013853_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013850_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013851_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645042_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173283_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173284_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032360_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032359_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032361_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377545_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014398_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB113879_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670237_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ475350_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ358158_X_C-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774253_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
EU939607_X_P-C      atggctgctagggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899783_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774296_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774238_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774306_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774325_X_P-C      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774280_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774202_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386664_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY251137_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377529_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT364751_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT364752_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171623_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774303_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB675674_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB675675_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774205_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774285_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013817_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774204_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774298_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562256_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939588_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899778_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774302_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562333_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171645_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171510_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171282_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645059_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774330_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY028593_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013819_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171463_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774321_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939626_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013818_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774221_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774308_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939625_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171303_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171609_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171529_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013890_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013885_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774300_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013883_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013878_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013882_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377591_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787450_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787451_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774288_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774304_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY206376_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY206379_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171593_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171543_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774282_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562323_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386623_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774207_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367428_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB900099_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MW310260_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814905_X_P-C      atggctgctagggtgtgctgccaactggacgatgcgcgggaggttctttgtctacgtccc
KC814879_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtctacgtccc
KC814898_X_P-C      aaggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC814904_X_P-C      aaggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386625_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774271_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386618_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881959_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
AB670258_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173305_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173306_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY882000_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881915_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881996_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881986_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881976_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881931_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881930_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881923_X_P-C      atggctgctcgggtgtgctgccaattggatcctgcgcggaacgtcctttgtctacgtccc
KY881916_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881924_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881925_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881926_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881927_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881928_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881929_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881932_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881933_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881934_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881935_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881936_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881938_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881939_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881963_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881965_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881969_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881975_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881977_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881982_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881983_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881985_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881995_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881998_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881999_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881992_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881967_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881943_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881968_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881964_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881937_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881917_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881918_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881920_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881921_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881922_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881940_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881941_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881942_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881970_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KY881919_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KR014041_X_P-C      atggctgctagggtgtgctgccaactggatcctgtgcgggacgtcctttgtctacgtccc
KR014049_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013858_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014048_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173311_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173312_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013815_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KU963882_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963877_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963879_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963881_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963885_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963874_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963871_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963878_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963880_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963884_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963872_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963873_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963875_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963876_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013804_X_P-C      atagctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377552_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377615_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377543_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774312_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964034_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964036_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964037_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964038_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964039_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964040_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964041_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964042_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964043_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964044_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964045_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964046_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964047_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964048_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964035_X_P-C      atggctgttagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964341_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013811_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
JX429915_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040131_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645031_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC318703_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040172_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377609_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377571_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377599_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562235_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173331_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173332_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013805_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB198079_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013802_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013803_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013807_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013808_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013984_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB300359_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562292_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013812_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KR013814_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KR013809_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KR013813_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KR013810_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcac
JX661496_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
MK171298_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MK171263_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC090200_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776413_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776414_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173433_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173434_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173391_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173392_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB299858_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB426467_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF384372_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF384371_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU560441_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787486_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899776_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171310_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171378_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171584_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX429917_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX504544_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774315_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774320_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418513_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY881818_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY881807_X_P-C      atggctgctagggtgtgctgccaaccggatcctgcgcgggacgtcctttgtttacgtccc
KU963992_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtttacgtccc
KU963996_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtttacgtccc
KU963997_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtttacgtccc
KU964002_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtttacgtccc
KC774241_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ787445_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
GQ377579_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774359_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963937_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386639_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881814_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttatgtccc
KY881813_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY881802_X_P-C      atggctgctagggtgtgctgccaactagatcctgcgcgggacgtcctttgtttacgtccc
GQ377546_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB014397_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
LC279259_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279260_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279261_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC279262_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916210_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ562261_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MT426106_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC875263_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774293_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB026811_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB026812_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB026813_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AB026814_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY470896_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY470905_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY470895_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY470899_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY470903_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
JX504546_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF461357_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
AF461363_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KC774239_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY470894_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY470897_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY470900_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY470901_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY470902_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY470904_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
FJ386609_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY881811_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttatgtccc
KY881806_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY881810_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY881815_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY881819_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY881817_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY881803_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
KY881804_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171535_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418497_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014369_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171513_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386651_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171553_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386628_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173291_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173303_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173292_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171489_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
JX661493_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173395_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173396_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774310_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX661492_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgagacgtcctttgtctacgtccc
MK171524_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT284755_X_P-C      atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtccc
AB288026_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB050018_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC373511_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
LC373512_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367434_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB367397_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562293_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013869_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JQ040168_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB642097_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774318_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171628_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645040_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171354_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171575_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939584_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014006_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KR014002_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013998_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013827_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014007_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR014000_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
JQ040154_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173431_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173432_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899772_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ899773_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JN418538_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939655_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939656_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939555_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171434_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF355785_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY028299_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
D28880_X_P-C        atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
S75184_X_P-C        atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
D23681_X_P-C        atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014362_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU796069_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB246345_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB670289_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB014378_X_P-C      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939543_X_P-C      atggctggtaggctgtgctgccaaatggatcctgcgcgggacgtcctttgtctacgtccc
KJ410521_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ980551_X_P-C      atggctgctaggatgtgctaccaactggatcctgcgcgggacgtcctttgtcaacgtccc
AB670249_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173317_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173318_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470977_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470967_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470968_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470965_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470969_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470970_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470971_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470972_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470973_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470974_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470975_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470976_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470978_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470979_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY470966_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU439015_X_P-C      atggctgctagggtgtgctgccacctggatcctgcgcgggacgtcctttgtctacgtccc
JX429906_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AF458665_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KC774290_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ032334_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcggggcgtcctttgtctacgtccc
JX429907_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173309_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173310_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173337_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173338_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG893558_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
AY251132_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173288_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KJ598748_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598687_X_P-C      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774281_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX429904_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562239_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916217_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB642099_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774268_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774276_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598740_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598749_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598751_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598752_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598743_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386653_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598746_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598753_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598747_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598754_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598745_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598741_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598744_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598742_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598750_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB471849_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774314_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MK171612_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598718_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598715_X_P-C      atggctgctagggtgcgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598712_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598711_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtccc
KJ598707_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598681_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598705_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598706_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598708_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598709_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598710_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598713_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598714_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598716_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598717_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598719_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774248_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013832_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562270_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB471848_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB471850_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013828_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013831_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AF458664_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013830_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013833_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013834_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013829_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774327_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU871982_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939604_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GU434374_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787448_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB300365_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787447_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB198083_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774360_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX026884_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KJ173293_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KJ173294_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KJ173315_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KJ173443_X_P-C      atggctgctaggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KJ173444_X_P-C      atggctgctaggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MG893553_X_P-C      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173281_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KJ173282_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
KJ173427_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173428_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173435_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173436_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598693_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ980547_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377521_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598689_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774249_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774347_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598694_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598698_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598702_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ598703_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963894_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963893_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963886_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963888_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963889_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963890_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963891_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963892_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963895_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963896_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963897_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963898_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963899_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU963887_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ975272_X_P-C      atgactgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY022423_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KT284753_X_P-C      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtccc
MK171350_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964065_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013772_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013776_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013773_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgcctacgtccc
KR013771_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013909_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KR013774_X_P-C      atggctgctggggcgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ562329_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KR014099_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KR013876_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KR013874_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KR013877_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacatcctttgtctacgtccc
KR013872_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KR013875_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KR014098_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KR013873_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
JX429916_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964076_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964064_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964066_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964067_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964068_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964069_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964070_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964071_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964072_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964073_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964074_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964075_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964077_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964078_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964334_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964336_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964337_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964338_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964340_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964342_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964343_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964345_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964346_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964347_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964348_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964339_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964344_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM750140_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964182_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964179_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964184_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964169_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964170_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964171_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964174_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964178_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964181_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964183_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964176_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964173_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964172_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964175_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964180_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964177_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881736_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881737_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881738_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881739_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881742_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881743_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881744_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881748_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881749_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881750_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881751_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881754_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881755_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881758_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881762_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881763_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881764_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881765_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881766_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881767_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881768_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881769_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881770_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881771_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881772_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881773_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881774_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881775_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881776_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881777_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AY206384_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU939561_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KC774237_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
EU916218_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
JX504545_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB640730_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171276_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MH488810_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881988_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881875_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ872210_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881962_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881990_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AB033550_X_P-C      atggctgctcgggtgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
AB670267_X_P-C      atggctgctcgggtgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
KC875261_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881880_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881873_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964185_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964186_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964187_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964188_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964193_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964194_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964195_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964196_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964197_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964198_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964189_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964190_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964191_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964192_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KU964199_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173307_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173308_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881979_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881891_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881877_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
GQ377524_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787454_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ386574_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881876_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881882_X_P-C      atggctgctagggtgtgctgccaactgggtcctgcgcgggacgtcctttgtctacgtccc
KY881961_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881892_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881883_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881973_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881978_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881872_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MK171456_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
FJ787453_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173304_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881993_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881980_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881874_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881981_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881989_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ993691_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
DQ993692_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
AP011098_X_P-C      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173441_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KJ173442_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MT645034_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881987_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881972_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881881_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881887_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881879_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881888_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY882003_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881878_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881886_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY882002_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgcccc
KY882001_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881997_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcggtacgtcctttgtctacgtccc
KY881890_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881889_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881884_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881960_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881871_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881870_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881885_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881966_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881971_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881974_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881984_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881991_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KY881994_X_P-C      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc

KC774351_X_P-C      atcggcggtgaaacccgcggagggcccgtttcgggcccgtccggccctttcccgtcccgc
KC774357_X_P-C      gtcggcgtcgaatcccgcggaagacccgtctcggggccgtttgggcatctaccgtccctt
KC774180_X_P-C      gtcggccctgaatcccgcggaccacccgtctcgcggccgttggggcctctatggtcccct
KC774196_X_P-C      gtcgccgttgaatcccgcggacgacccgtgtcggggccggttggggctttacggtcccct
KC774336_X_P-C      gtcgccgttgaatcccgcggacgacccgtgtcggggccggttggggctttacggtcccct
MF115871_X_P-C      gtcagcgctgaatcccgcggacgacccctcgcgcggtcgcttgggactctatcgtcccct
MF115873_X_P-C      gtcagcgctgaatcccgcggacgacccctcgcgcggtcgcttgggactctctcgtcccct
EF594767_X_P-C      gtcggcgctgaatcccgcggacgacccctcccgaggccgctggggactgtatcgtcccct
EF594769_X_P-C      gtcggcgctgaatcccgcggaagagccctcgcgaggccgcttggggctgtatcgtcccct
EF594768_X_P-C      gtcggcgctgaatcccgcggacgagccctcgcgaggccgcttggggctgtatcgtcccct
KT235618_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactgtatcgtcccct
JN574721_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactgtatcgtcccct
EF594764_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactgtatcgtcccct
EF594766_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctatatcgtcccct
EF594763_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876192_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876229_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876191_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876246_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876251_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876202_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876205_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876252_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876239_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876238_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876206_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876230_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876204_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876203_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
FJ876190_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
EF594758_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
EF594760_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcccct
KC774244_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactttacggtcccat
KC774292_X_P-C      gtgggcgctgaatcccgcggacgacccgtctcggggcagtttgggcctctaccgtccctt
KR811467_X_P-C      ttcggcgctgaatcccgcggacgacccatctcggggccgtttgggaatctaccgtcccct
KC774264_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttggggctttacggtcccct
MK171580_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggtcgtttgggactctaccgtcccct
KC774191_X_P-C      gtcggcgttgaatcccgcggacgacccgtctcggggccgtttggggcttttccgtcccct
KC774227_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811476_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgcttggggatctaccgtcccct
KC814901_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
X75665_X_P-C        gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttggggctctaccgtcccct
MF925403_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgattggggatctaccgtcctct
KU679951_X_P-C      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggkctctaycgtcccct
FJ023677_X_P-C      gtcggcgctgaatccagcggacgacccctctcggggccgcttggggatctaccgtcccct
MH488824_X_P-C      gtcgacgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774200_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctttaccgtcccct
AB493844_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtcccct
GQ358157_X_P-C      gtcagcgctgaatcccgcggacgatccgtctcggggccgcttggggttgtaccgtcccct
HQ700516_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgcttggggatctatcgtcccct
KC774229_X_P-C      gttggcgctgaatcccgcggacgacccgtctcggggccgtttgggggtctaccgtcccct
MG826137_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF059688_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctct
KJ173316_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JX429912_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctct
KC774265_X_P-C      gtccgcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK171517_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggtcgtttgggactctaccgtcccct
KC774335_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgattggggatctaccgtcccct
KC774197_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtgtggggctctgccgtcccct
DQ536410_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
DQ536412_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
DQ536414_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
DQ536411_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
DQ536413_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
KC774334_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtcccct
EU939542_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ899767_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JN104440_X_P-C      gtcggcgctgaatcccgcggacgacccgtcccggggccgtttgggactctatcgtcccct
EU939541_X_P-C      gtcggcgctgaatcgcgcggacggcccgtctcggggccgttgggggctctaccgtcccct
KC774184_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
HM750131_X_P-C      gtcggcgctgaatcccgcagacgacccatctcggggccgtttgggtctctaccgtcccct
EU939548_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KC774220_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AY028303_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgaggacgtttggggctctaccgtcccct
MK171404_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctttaccgtcccct
MK171341_X_P-C      gtcggcactgaatcccgcggacgacccgtcccgcggccgtttgggactctaccgtcccct
KJ410508_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774345_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
HM750136_X_P-C      gtcggcgctgaatcccgcggacgacccctctcgggggcgtttggggatctaccgtcccct
MK171351_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgtttggggctctaccgtcccct
FJ386611_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
AB642100_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
JQ040152_X_P-C      ctcggcgctgaatccggcggacgacccgtctcggggccgtttgggtctctaccgtccgct
EU916229_X_P-C      ctcggcgctgaatcccgcggacgacccctctcggggccgtttgggcctctaccgtcccct
EU670263_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU547562_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MK171627_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MG893560_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtcccct
GQ475356_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggmtctaccgtcccct
EU589344_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774199_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774274_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
FJ386605_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
DQ089797_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774316_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774338_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MK171438_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939537_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774217_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggtctctaccgtcccct
KC774189_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttggggatctaccgtcccct
JX026888_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctatcgtcccct
FJ562255_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtcccct
FJ386678_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtcccct
EU939582_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
AB300362_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgcttgggcctctaccgtcccct
FJ386603_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774242_X_P-C      gtcagcgctgaatcccgcggacgatccttctcggggccgtttggggctctatcgtcccct
JX026878_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggggtataccgtcccct
FJ562326_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU589345_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MH094411_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
EF536065_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
EF536066_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KR013761_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
KR013763_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
KR013764_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
KR013767_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
KR013768_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
KR013895_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
KR013766_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
KR013769_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
KR013915_X_P-C      gtcggcgctgaatcccgcggacaacccgtctcggggtcgcttgggactctaccgtcccct
KR013919_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttgggactctaccgtcccct
KR013923_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
KJ173393_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ173394_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774261_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggacgtttggggctctaccgtcccct
KC774262_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggacgtttggggctctaccgtcccct
KC774194_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
EU939617_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU939558_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939557_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KC774337_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttggggctctaccgtcccct
KC774342_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttggggctctaccgtcccct
AF384366_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
AF384365_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
AF384364_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
AF384367_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MK534674_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
LC279245_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ803762_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774192_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB670308_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
FJ562282_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
GQ377528_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KF214655_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU916212_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
EU916211_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
EU916213_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
EU916214_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MH887433_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
KR013778_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctactgtcccct
KM213037_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774278_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774187_X_P-C      gtcggcgctgaatcccgcggacgacccttctcggggccgtttggggctctaccgtcccct
HM750141_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
FJ386576_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB675677_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtcccct
MK171493_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttgggactctaccgtcccct
KC774270_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774214_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774181_X_P-C      gtcggcgctgaatcccgcggacgacccgtcccggggtcgtttgggtctctaccgtcccct
GU357845_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactttatcgtcccct
KJ173327_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ173328_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774224_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
FJ386616_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
LC279250_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171602_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgccccct
JX429905_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctatcgtcccct
MN683729_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggtctctaccgtcccct
KX276835_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggmtctaccgtcccct
KC774356_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774232_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtcccct
FJ562319_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggcctctaccgtcccct
KR013786_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013779_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013781_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013782_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013783_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013784_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013785_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013780_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013792_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013795_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013794_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013793_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013796_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ410505_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774348_X_P-C      gtcggcgctgaatcccgcagacgacccgtctcggggccgtttgggtctctaccgtcccct
KC774295_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctttcgtcccct
MK171388_X_P-C      ctcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MK171265_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC814882_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ173313_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ173314_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MN683726_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
LC279258_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KP027477_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774284_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtcccct
KC774185_X_P-C      gtcggcgctgaatcccgcggacgacccgtcccggggccgtttgggtctctaccgtcccct
JX661488_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctttaccgtcccct
JX429913_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
JN418535_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
JN104434_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
HM750137_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ475349_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475316_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ377517_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ787449_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtctgggactctaccgtcccct
FJ562332_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
FJ386575_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
EU939569_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
AY251142_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AF326586_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU570068_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU570067_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU554537_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU554539_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU554538_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ787470_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ787471_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774309_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JN418560_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KJ410510_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtcccct
MK171387_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
JN104432_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JN104433_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MN683727_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774289_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ377631_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164089_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164086_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccact
EU306673_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164087_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164088_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164100_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164101_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164102_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164103_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164104_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164105_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164106_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164107_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164108_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164109_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164110_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164111_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164112_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164113_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164114_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164115_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164116_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164117_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164118_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164085_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU306676_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU916223_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
JX560520_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
FJ562218_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MN683728_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
HM011489_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
MK171279_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
OK106255_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774250_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ377533_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttggggctctaccgtcccct
LC279246_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
LC279247_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
LC279248_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
LC279249_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
AB111124_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
AB111125_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
AB246344_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KM359441_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KR013797_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KR013798_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KR013961_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JN315779_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgggrccgtttgggcctctaccgtcccct
GQ475328_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB697490_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggcctctaccgtcccct
GQ475339_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggcctctaccgtcccct
KC774213_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
FJ562280_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AY167096_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AF326585_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF326587_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171512_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK171446_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK171314_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggrctctaccgtcccct
KC814894_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC814925_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JX661491_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
HM011465_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctttaccgtcccct
MG893557_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ173446_X_P-C      gtcggcgctgaatcccgcagacgacccgtctcggggccgtttgggactctaccgtcccct
KJ173437_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KJ173438_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KJ173296_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KJ173287_X_P-C      atcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KF485389_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggmctctaccgtcccct
KC774346_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774277_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774275_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774272_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774252_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774233_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KC774206_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JX661489_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
JN104435_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ475307_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ377551_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ377538_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttgggactctaccgtcccct
GQ377527_X_P-C      atcggcgctgaatcccgcggacgacccgtctcggggccgtctgggtctctaccgtcccct
FJ787474_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562291_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
DQ478900_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB362932_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB198078_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MG893556_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774216_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
KC774215_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
JQ341872_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK534588_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774209_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ924633_X_P-C      ctcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
FJ386588_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
AB198081_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
DQ993690_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KJ790199_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC814912_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC814911_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774223_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774257_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774259_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774182_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ377531_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
DQ478899_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU916237_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU916238_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK171281_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
DQ478885_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC814893_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ475321_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MT426108_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ173445_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactcttccgtcccct
KC774247_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013762_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
KR013765_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
FJ562297_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774287_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171509_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562233_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ386587_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KC774339_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU306719_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU306720_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU306721_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171311_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171390_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
LC279254_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
LC279255_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
LC279256_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
LC279257_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774255_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171367_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtcccct
GQ377523_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774190_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
HM750138_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ688404_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ173426_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KF873544_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgcttggggatctaccgtcccct
KC814919_X_P-C      gtcggcgttgaatcttgcggacgacccatttcggggccgtttgggactctaccgtcccct
MK171608_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggtcgcttggggctctatcgtcccct
JQ027317_X_P-C      gtcagcgctgaatcccgcggacgacccstctcggggccgtttgggactctatcgtcccct
KM875412_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggtcgcttggggctctaccgtcccct
KJ803790_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggtcgcttggggctctatcgtcccct
MZ671249_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ671250_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ675792_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
KR013870_X_P-C      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggatctaccgtcccct
KR013871_X_P-C      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggatctaccgtcccct
KR014077_X_P-C      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggatctaccgtcccct
KR014078_X_P-C      gtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggatctaccgtcccct
KR014082_X_P-C      gtcggcgctgaatcccgcggacgacccatcccggggtcgcttggggatctaccgtcccct
KR014079_X_P-C      gtcggcgctgaatcccgcggacgacccatcccggggtcgcttggggatctaccgtcccct
KR014083_X_P-C      gtcggcgctgaatcccgcggacgacccatcccggggtcgcttggggatctaccgtcccct
MT644997_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MT645008_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttgggactctaccgtcccct
MT645013_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctatcgtcccct
MT645020_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
EU410079_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MZ439310_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439326_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
GQ924622_X_P-C      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttggggatctatcgtcccct
AB241112_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgggggcgcttggggatctatcgtcccct
AB241113_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgggggcgcttggggatctatcgtcccct
AB241111_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgggggcgcttggggatctatcgtcccct
AB241110_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgggggcgcttggggatctatcgtcccct
EU410081_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgggggcgcttggggatctatcgtcccct
AP011099_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgggggcgcttggggatctatcgtcccct
AP011101_X_P-C      gtcggcgctgaatccagcggacgacccgtctcgggggcgcttggggatctatcgtcccct
MT645009_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggtcgcttggggatatatcgtcccct
AP011100_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggtcgcttggggatctatcgtcccct
EU410080_X_P-C      gtcggmgctgaatcccgcggacgacccgtcgcggggtcgcttggggatctatcgtcccct
MZ439307_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439308_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439309_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439311_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439312_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439314_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439318_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439319_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439325_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439327_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439315_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439316_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439317_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439320_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439321_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439322_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439323_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439328_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439329_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439330_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439331_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MZ439313_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MT644996_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatgtatcgtcccct
MZ439324_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
GQ924620_X_C-C      gtcggcgctgaatcctgcggacgacccctctcggggtcgcttggggctctaccgtcccct
MZ439629_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggtcgcttggggatctaccgtcccct
MZ439631_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggtcgcttggggatctaccgtcccct
MZ439637_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggtcgcttggggatctaccgtcccct
MK534677_X_P-C      gtcggcgctgaatcccgcggacgacccctcacgggggcgcttggggctttaccgtcccct
MK534638_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgggggcgcttggggctttaccgtcccct
JN827414_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgggggcgcttggggctctatcgtcccct
JN827415_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgggggcgcttggggctctaccgtcccct
MT645011_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatcttccgtcccct
MK534636_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MK534640_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ675793_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctatcgtcccct
KJ173335_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
KJ173336_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MT644999_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439613_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgctaggggctctaccgtcccct
MT645010_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatctaccgtcccct
MZ439602_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatctaccgtcccct
MZ439625_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439632_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439633_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439635_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439634_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439638_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439624_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439601_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439603_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439604_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439605_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439607_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439608_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439609_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439610_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439611_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439612_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439614_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439615_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439618_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439619_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439620_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439621_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439616_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439606_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439617_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439622_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439623_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MT645007_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggatctaccgtcccct
MZ439626_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439627_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439628_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439639_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439630_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ439636_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MT645019_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
AF241410_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ671248_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MZ675791_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MT645021_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtcccct
MT645014_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB112472_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB112066_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341878_X_P-C      gtcggcgctgaatcccgcggacgacccrtctcggggccgtttgggactctaycgtcccct
GQ855543_X_P-C      ctcgacgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
FJ904423_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KX276850_X_P-C      gtcrgcgctgaatccagcggacgacccmtctcggggccgtttggggctctaccgtcccct
HM011488_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaycgtcccct
AB112065_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
HM011472_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MK818227_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KJ803818_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ478901_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcagggccgtttgggactctaccgtccccc
AB112348_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089768_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AP011097_X_P-C      ctcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JQ801505_X_P-C      gtcagcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
GQ377536_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ671245_X_P-C      gtcggcgctgaatcctgcagacgacccgtctcggggccgtttgggactctaccgtcccct
MZ675787_X_P-C      gtcggcgctgaatcctgcagacgacccgtctcggggccgtttgggactctaccgtcccct
AB246346_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB117758_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ803826_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
JQ341875_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggrctctaccgtcccct
DQ089771_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
MZ671234_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ671246_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ675790_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
MK171635_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtcccct
JQ341891_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KM875428_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
GQ924655_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctct
KJ410493_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MK171537_X_P-C      atcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341896_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgtttgggactctaccgtcccct
JQ341863_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
MG571345_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
MF674429_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ410496_X_P-C      gtcggcgctgaatcctgcggacgacccttctcggggccgtttgggtctctaccgtcccct
JQ341886_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JX507214_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089758_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ410518_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JX870000_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ801495_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
AB105174_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171417_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB111946_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341885_X_P-C      gtcggcgctgaatcccgcggacgacccmtctcggggccgtttgggactctaccgtcccct
LC592171_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
LC592172_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MG571332_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KX276852_X_P-C      gtcggcgctgaatccmgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ801517_X_P-C      gtcgacgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ924636_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
EF494379_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtcccct
DQ089766_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089763_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089762_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaycgtcccct
DQ089761_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AY167099_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674475_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
AF223958_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674402_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ801481_X_P-C      gtcggcgctgaatccagcggacgacccctctcggggccgtttggggctctaccgtcccct
JQ801483_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtcccct
MZ671241_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MG725248_X_P-C      gtcggcgctgaatccagcggacgacccctctcggggccgtttgggactctaccgtcccct
MF674435_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674398_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341902_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171633_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089759_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EF594748_X_P-C      gtcggcgctgaatccagcggacgacccctctcggggccgtttggggctctaccgtcccct
MF925410_X_P-C      gtcggcgctgaatccagcggacgacccctctcggggccgtttgggactctaccgtcccct
GQ855525_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674502_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ924612_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ924613_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ924649_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ803793_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK628732_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF925369_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtcccct
MF925387_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtcccct
MF925398_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtcccct
MF925405_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtcccct
MF925374_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtcccct
MK171465_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171368_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341890_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
JQ341868_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341859_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU305540_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JQ341860_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MT645006_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MT645012_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtcccct
MF925375_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674514_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
MF674457_X_P-C      gtcgacgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MF674386_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KX276851_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013927_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ173324_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ027318_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
JN104437_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EF594753_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089767_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089765_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AY251140_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AB105173_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ173323_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ023646_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AJ748098_X_P-C      gtcagcgctgaatcccgcggacgacccgtcgcggggccgtttgggactctaccgtcccct
AF223961_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089760_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013787_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KJ410504_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089769_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK534650_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK534656_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089770_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KX765824_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU305542_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU305541_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JQ341898_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MF674454_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
MF674472_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KJ410501_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KJ410513_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF473543_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811748_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811763_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811756_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811754_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811749_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811747_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ023653_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ023650_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF223957_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811746_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811750_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811762_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK534628_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811760_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811758_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171472_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439575_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674494_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674486_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674468_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KC875269_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ023655_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF223960_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089773_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ688403_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439552_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439554_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439555_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439556_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439557_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439558_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439559_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439560_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439561_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439562_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439563_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439566_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439567_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439568_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439569_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439570_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439573_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439574_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439576_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439578_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089790_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtctgggactctaccgtcccct
KX276846_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtcccct
KR811755_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
KJ803774_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ027322_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgtctggggctctaccgtcccct
KM875406_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactcttccgtcccct
EU717214_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU872005_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341865_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KX276840_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ803810_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KJ410514_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013900_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ027320_X_P-C      gtcggcgctgaatcctgcggacgacccmtctcggggccgtttgggactctaccgtcccct
MZ439685_X_P-C      gtcgacgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013903_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ027321_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MT426107_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KR013826_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013823_X_P-C      gccggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013820_X_P-C      gtcggcgctgaatcccacggacgacccgtctcggggccgtttgggactctaccgtcccct
EF688062_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089787_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
DQ089783_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtcccct
DQ089780_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089784_X_P-C      gtcggcgctgaatcccgcggacgacccttcccggggccgtttgggactctaccgtcccct
DQ089781_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089779_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013821_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013996_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013822_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013825_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013824_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674442_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ246215_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171301_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341895_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013902_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013856_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013857_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013855_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013854_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ377632_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939554_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089789_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AY862869_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtcccct
JQ341883_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013904_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ410519_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089786_X_P-C      gtcggcgctgaatcccgcggacgacccrtctcggggccgtttgggactctaccgtcccct
AF223955_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089782_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013770_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013899_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013905_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341877_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF223956_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF223959_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KX276849_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggamtctaccgtcctct
AB074047_X_P-C      gtcggcgctgaatcccgcggacgacccctcgcggggccgtttgggactctaccgtcccct
JX507211_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaycgtcccct
KJ803770_X_P-C      gtcggcgctgaatcccgcggacgacccctctcgaggccgtttgggactctaccgtcccct
JX026880_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013849_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
KR013844_X_P-C      gtcagcgctgaatcccgcggacgacccgtttcggggccgtttgggcctctaccgtcccct
KR013846_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
KR013848_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
KR013847_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
KR013842_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
KR013845_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgttccct
MG571359_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtcccct
MN066399_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JQ341887_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaycgtcccct
KJ997796_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ997801_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ997906_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ997840_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ997841_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ997846_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgagactctaccgtcccct
DQ089778_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674430_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
JQ040165_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
FJ023648_X_P-C      gtcggcgctgaatcccgcggacgacccttctcggggccgtttgggactttaccgtcccct
DQ089764_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgtttggggctctaccgtcccct
KJ803766_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgtttggggctctaccgtcccct
DQ089775_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AY167092_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439392_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgtctggggctctaccgtcccct
MZ439393_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgtctggggctctaccgtcccct
MZ439400_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgtctggggctctaccgtcccct
MZ439402_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgtctggggctctaccgtcccct
MZ439406_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgtctggggctctaccgtcccct
MZ439396_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439399_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439403_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MF674403_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
EU498227_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtcccct
KJ803757_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439571_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439577_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC875265_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC875268_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439598_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439596_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgccccct
MZ439590_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439580_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439581_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439582_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439583_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439584_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439585_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439586_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439587_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439588_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439589_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439591_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439592_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439593_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439594_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439595_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439597_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439599_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439600_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC875272_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ027333_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439386_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439553_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439564_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439565_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674504_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtcccct
JX504535_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439385_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439338_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439343_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439341_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439345_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439332_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439333_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439335_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439337_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439339_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439340_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439342_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439344_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439346_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439347_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439348_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439349_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439350_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439352_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439353_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439354_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439355_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439356_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439357_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439358_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439359_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439360_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439336_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439382_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439398_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439401_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439405_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439387_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439369_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439372_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439391_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439394_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439395_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439397_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439404_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439376_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439378_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MF674501_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439371_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439366_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439381_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439390_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439364_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439334_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439351_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439361_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439362_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439365_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439367_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439368_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439370_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439373_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439374_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439375_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439377_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439379_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439380_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439383_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439388_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439389_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439363_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439384_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JQ707768_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ707769_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ707770_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ707771_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ707772_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ707774_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ707773_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171324_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KX276841_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171527_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ040133_X_P-C      gtcggcgctgaatcccgccgacgacccgtctcggggccgtctgggactctaccgtcccct
KJ410498_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KR811745_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811730_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KF214669_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674489_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811752_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811744_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811742_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811728_X_P-C      gtcggcgctgaatcccgcagacgacccgtctcggggccgtttgggactctaccgtcccct
KR811725_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811723_X_P-C      gtcggcgctgaatcccgcagacgacccgtctcggggccgtttgggactctaccgtcccct
KR811740_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341888_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811459_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811757_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811751_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811743_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811733_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KR811734_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KR811726_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811739_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811753_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811736_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KR811729_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811741_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811764_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811737_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811722_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811727_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR811732_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774179_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774297_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK171648_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK534586_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK171274_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK171405_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171406_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF488701_X_P-C      gtcggcgctgaatcccgcggacgacccttctcggggccgtttgggtctctaccgtcccct
DQ089772_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674425_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674458_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674471_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341855_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ410511_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089756_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EF197911_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU547559_X_P-C      gtcggcgctgaayccagcggacgacccgtctcggggccgtttgggaatctaccgtcccct
MG826143_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgtttgggactctaccgtcccct
MK171315_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggcctctatcgtcccct
EF594755_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MT645003_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ027324_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtctgggactctaccgtcccct
MK171496_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgtttgggtctctaccgtcccct
DQ089785_X_P-C      ctcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB112408_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341893_X_P-C      ctcggcgctgaatcccgcggacgacccctctcggggccgtttgggmctctaccgtcccct
MF925367_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggtctctaccgtcccct
KJ410515_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtcccct
KF214675_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
EF594751_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactgtaccgtcccct
KJ803780_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KJ410489_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtcccct
KJ410499_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtcccct
KJ410494_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtcccct
KJ410495_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtcccct
KJ410491_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtcccct
KJ410492_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtcccct
MF488703_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JQ341899_X_P-C      ctcggcgctgaatcccgcggacgacccctctcggggccggttgggactctaccgtcccct
KM875430_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcatctaccgtcccct
DQ089792_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtcccct
MF674484_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674411_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674388_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ997856_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KJ803760_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
KF214676_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtcccct
KF214672_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
JQ801498_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccact
DQ089803_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK534671_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KF214673_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KT347089_X_P-C      gtcagcgctgaatcccgcggacgacccctcccggggccgtttgggactctaccgtcccct
MF115898_X_P-C      gtcagcgctgaatcccgcggacgacccctcccggggccgtttgggactctaccgtcccct
MF115897_X_P-C      gtcagcgctgaatcccgcggacgacccctcccggggccgtttgggactctaccgtcccct
MF115899_X_P-C      gtcagcgctgaatcccgcggacgacccctcccggggccgtttgggactctaccgtcccct
GQ184326_X_P-C      gtcagcgctgaatcccgcggacgacccctcccggggccgtttgggactctaccgtcccct
GQ222210_X_P-C      gtcagcgctgaatcccgcggacgacccctcccggggccgtttgggactctaccgtcccct
GQ222211_X_P-C      gtcagcgctgaatcccgcggacgacccctcccggggccgtttgggactctaccgtcccct
GQ222212_X_P-C      gtcagcgctgaatcccgcggacgacccctcccggggccgtttgggactctaccgtcccct
JX507212_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674428_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JQ801482_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JQ801515_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KM875424_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KM875425_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC315399_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
JQ801509_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
MT644995_X_P-C      gtcggcgctgaatccagcggacgacccatctcggggccgtttgggactctaccgtcccct
MT114171_X_P-C      gtcagcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
MK534595_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MG826123_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
MF925394_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctatcgtcccct
MF925376_X_P-C      gtcgacgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MF674408_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctct
KX765839_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KX429617_X_P-C      gtcggcgctgaatcctgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148563_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JQ801521_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JQ801518_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ801472_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctaccgtcccct
GQ855541_X_P-C      ctcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ023652_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
DQ315782_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
DQ089791_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgcttgggactctaccgtcccct
DQ089777_X_P-C      gtccgcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AB112063_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgggggcgtttgggactctaccgtcccct
AB074756_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MK534652_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674418_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KX276853_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ855537_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK534557_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF925409_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
MF674444_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtcccct
KX765828_X_P-C      gtcggcgctgaatcccgcggacgacccctcccggggccgtttgggactctaccgtcccct
EF594752_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggtctctaccgtcccct
KT366464_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
KX765822_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KX765842_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JN827422_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ801502_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MZ439270_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439271_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439272_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439273_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439274_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439275_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439276_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439277_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439278_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439279_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439280_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439281_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439282_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439283_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439284_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439285_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439286_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439288_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439289_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439290_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439291_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439292_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439293_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439294_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439296_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439297_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439298_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439299_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439300_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439301_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439302_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439303_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439304_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439305_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439306_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439287_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MZ439295_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KJ803776_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
FJ023645_X_P-C      atcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
DQ089757_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK534619_X_P-C      gtcagcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
MK534645_X_P-C      gtcagcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KX765820_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KJ803823_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ801489_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
HM011468_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MK534593_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KP148560_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KP148547_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148545_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148532_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148513_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148512_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148473_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148471_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148468_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148466_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JQ801501_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148570_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148558_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148549_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148546_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148493_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148480_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148472_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148315_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148462_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148464_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148469_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148477_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148479_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148481_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148482_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148488_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148540_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148561_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148564_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148571_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148463_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148551_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148572_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148575_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148538_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148535_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148525_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148514_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148520_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148523_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148537_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148517_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148519_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148521_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148524_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148526_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148529_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148530_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148531_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148534_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148566_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148548_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148555_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148574_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggtctctaccgtcccct
KP148568_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148543_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148470_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148474_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148475_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148476_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148552_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148554_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148557_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KP148562_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MZ439720_X_P-C      gtcggcgctgaatgccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439710_X_P-C      gtcggcgctgaatcccgcagacgacccttctcggggccgtttgggactctaccgtcccct
MZ439644_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK534649_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MK534596_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF925365_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactttaccgtcccct
MF674390_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY470917_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY470916_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KY470915_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY470913_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY470911_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY470909_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggaccctaccgtcccct
JQ801499_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ801497_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggcctctatcgtcccct
JN574724_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EF594750_X_P-C      gtcagcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
DQ089788_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089776_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AB205125_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439678_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF925359_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EF384201_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
EF384205_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
EF394328_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KY470914_X_P-C      gtcggcactgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY470906_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY470907_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY470908_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY470918_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY470920_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY470912_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JN418553_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY470910_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171640_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK534597_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439671_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KF214671_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MF925395_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JQ801503_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
EF594749_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
EF594754_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JN827423_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
DQ315781_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
DQ315783_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
JQ801522_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341892_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
JQ518364_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
GQ924616_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ429078_X_P-C      gtcagcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
JQ801490_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ855521_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674417_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674467_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MT645000_X_P-C      gtcggcgctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439730_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgaaactctaccgtcccct
MZ439728_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439727_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439704_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439686_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439692_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439677_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439672_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439668_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439682_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439683_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439688_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439640_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439641_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439642_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439643_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439645_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439647_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439648_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439649_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439650_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439651_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439653_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439654_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439655_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439656_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439657_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439658_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439659_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439660_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439661_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439662_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439663_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439664_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439665_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439666_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439667_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439669_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439670_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439675_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439676_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439679_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439680_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439681_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439684_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439689_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439690_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439691_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439694_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439695_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439696_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439697_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439698_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439699_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439700_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439701_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439702_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439703_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439705_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439706_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439707_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439708_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439709_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439711_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439712_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439713_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439714_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439715_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439717_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439718_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439719_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439729_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439732_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439736_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439652_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439687_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JN418536_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC875270_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439733_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439734_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439735_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439737_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439716_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439721_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439722_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439723_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439724_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439725_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439726_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC875273_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC875274_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ997766_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ997785_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ997786_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674463_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ439572_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163865_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163868_X_P-C      gtcagccctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163875_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163874_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163872_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163869_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163866_X_P-C      gtcggcgctgaatcccgcggacgacccgtcctggggccgtttgggactctaccgtcccct
KC163867_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgattgggactcttccgtcccct
KC163879_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163880_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163886_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163884_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163883_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163873_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163871_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163881_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttagaactctaccgtcccct
KC163904_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163897_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactcttccgtcccct
KC163895_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163882_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163876_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163877_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163896_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163898_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163899_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163900_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163901_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC163887_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KC163888_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KC163890_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgccccct
KC163889_X_P-C      gtcagcgctgaatcccgcggacgacccgtcgcggggccgtttgggactctaccgtcccct
KC163892_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KX276848_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KJ803754_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
GQ924658_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
GQ924604_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
GQ924623_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KJ803792_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
GQ855531_X_P-C      gtcagcgctgaatcccgcggacgacccgtcgcggggccgtttgggtctctaccgtcccct
FJ023643_X_P-C      gtcagcgctgaatcccgcggacgacccgtcgcggggccgtttgggtctctaccgtcccct
FJ023644_X_P-C      gtcagcgctgaatcccgcggacgacccgtcgcggggccgtttgggtctctaccgtcccct
GQ855528_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgtttgggtctctaccgtcccct
KX765855_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgtttaggtctctaccgtcccct
KX765819_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgtttgggtctctaccgtcccct
KX765847_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgtttgggtctctaccgtcccct
JN418527_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KJ173285_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ173286_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ803779_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ924642_X_P-C      gtccgcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KX765852_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggcctctaccgtccact
HM011491_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KJ803794_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ349225_X_P-C      ctcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KR013839_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
KR013836_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
KR014021_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
KR013841_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
KR013835_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
KR013837_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
KR013838_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
KR013840_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
KX276847_X_P-C      gtcggcgctgaatcccgcggacgacccrtctcggggccgtttgggrctctaccgtcccct
KX276844_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KU051423_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggtcgtttgggactctatcgtcccct
DQ361534_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctatcgtcccct
KX765829_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KT987426_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
JQ341889_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
JQ801500_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
GQ855534_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
GQ358154_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgtttgggactctaccgtcccct
DQ089804_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtcccct
KX765845_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KT235627_X_P-C      gtcggcgctgaatcccgcggacgacccatcccggggccgtttgggactataccgtcccct
KT235628_X_P-C      gtcggcgctgaatcccgcggacgacccatcccggggccgtttgggactataccgtcccct
JQ801488_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggcctctaccgtccact
GQ924643_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
KX765838_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
JN418519_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggtctctaccgtcccct
MZ439486_X_P-C      gtcggcgctgaatcctgcggacgaccagtctcggggccgtttgggcctctaacgtcccct
MZ439451_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggtcgtttgggcctctaccgtcccct
MZ439456_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439472_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439479_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439482_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439492_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439493_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439495_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439497_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439498_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439500_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439502_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439503_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439504_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439505_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439506_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439507_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439508_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439509_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439510_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439513_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439515_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439516_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439419_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439437_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439438_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439439_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439440_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439441_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439442_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439443_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439445_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439446_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439447_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439448_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439449_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439450_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439452_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439453_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439454_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439463_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439466_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439467_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439478_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439483_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439496_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439461_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439464_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439481_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439484_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439485_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439488_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439459_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439465_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439489_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439455_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439457_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439458_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439460_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439462_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439468_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439469_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439470_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439471_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439473_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439474_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439475_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439476_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439477_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439480_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439487_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439490_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439491_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439494_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439499_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439501_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439511_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439512_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439514_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439407_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439408_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439409_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439410_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439411_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439414_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439415_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439416_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439417_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439418_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439420_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439422_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439423_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439424_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439425_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439426_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439427_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439429_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439431_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439432_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439433_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439434_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439435_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439436_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439412_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439413_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439421_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439428_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439430_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MZ439444_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
KC164038_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164037_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164036_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164044_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164042_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164041_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164040_X_P-C      gtcagcgccgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164046_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164047_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164048_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164049_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164050_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164051_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164052_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164053_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164054_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164055_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164056_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164057_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164058_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164059_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164060_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164061_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164062_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164063_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164065_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164066_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164067_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164068_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164069_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164070_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164071_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC164072_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KX765836_X_P-C      gtcagcgctgaatcctgcggacgacccctctcggggccgtttgggactctaccgtcccct
KF214668_X_P-C      gtcagcgctgaatcccgcggacgacccctccaggggccgcttgggactctaccgtcccct
JQ801523_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
JQ801491_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgattgggactctaccgtcccct
MF674412_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
MZ671247_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctatcgtcccct
MZ675789_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
MK534657_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggtcgtttgggactctaccgtcccct
KX765851_X_P-C      gtcggcgctaaatcccgcggacgacccctctcgaggccgtttgggactctaccgtcccct
KX765834_X_P-C      gtcggcgctgaatcccgcggacgacccatctcgaggccgtttgggactctaccgtcccct
FJ023654_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ023651_X_P-C      gtccgcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KX276854_X_P-C      gtcggcgctgaatcctgcggacgacccatctcggggccgtttgggactctaccgtcccct
MF925378_X_P-C      gtcggcgctgaatcccgcggacgacccatcccggggccgtttgggactctaccgtcccct
GQ924615_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KC164127_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164126_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164125_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164123_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164122_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164120_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164124_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164128_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164129_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164130_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164131_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164132_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164133_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164134_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164135_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164136_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164137_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164138_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164139_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164140_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164141_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164142_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164143_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164144_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164145_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164146_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164147_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164148_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164149_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164150_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164151_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC164121_X_P-C      gtctgcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JF899336_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU306690_X_P-C      gtcagcgctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtcccct
EU306685_X_P-C      gtcagcgctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtcccct
EU306687_X_P-C      gtcagcgctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtcccct
EU306688_X_P-C      gtcagcgctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtcccct
EU306689_X_P-C      gtcagcgctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtcccct
EU306691_X_P-C      gtcagcgctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtcccct
MK534644_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774228_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK534622_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MG826122_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KT987423_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctct
KU051427_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KJ997811_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggcgccgtttgggactctaccgtcccct
KJ997816_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggcgccgtttgggactctaccgtcccct
KJ997815_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggcgccgtttgggactctaccgtcccct
GQ855533_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ023656_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC875264_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC875271_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC875267_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ997826_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ997830_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ997831_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ997829_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KX765823_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
AF223954_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341857_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ801473_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
FJ023647_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JQ801504_X_P-C      gtcagcgctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KX765827_X_P-C      gtcagcgctgaatcctgcggacgacccatctcggggccgtttgggactctaccgtcccct
MK534678_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MF674474_X_P-C      gtcagcgctgaatccagcggacgacccatctcggggccgtttgggcctctaccgtcccct
KY470936_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
KX765825_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KT366463_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KT364718_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccggttgggactctaccgtcccct
KJ803812_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774236_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggtctctaccgtcccct
JQ801510_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgtttgggactctaccgtcccct
JQ801496_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JQ801480_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
FJ023658_X_P-C      gtccgcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
AB300363_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
JQ801478_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
GQ924650_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
AB031262_X_P-C      ctcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY470937_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
KX765849_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KT307718_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KT364721_X_P-C      gtcggcgctgaatcccgcggacgacccctcccggggccgtttgggactctaccgtcccct
MK534647_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KX765821_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KJ803759_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KJ803761_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
GQ924619_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KX765830_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
AB074755_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
AB112471_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KJ803800_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JN827424_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JN827425_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KT364719_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctatcgtcccct
KT364720_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctatcgtcccct
KX765843_X_P-C      gtcggcgctgaatcccgcggacgacccctcccggggccgtttgggactctatcgtcccct
MK534605_X_P-C      gtcggcgctgaatccagcggacgacccatctcggggccgtttgggactctaccgtcccct
MK534604_X_P-C      gtcggcgctgaatccagcggacgacccatctcggggccgtttgggactctaccgtcccct
MK534720_X_P-C      gtcggcgctgaatccagcggacgacccatctcggggccgtttgggactctaccgtcccct
MK534667_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MF925377_X_P-C      gtcagcgctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtcccct
KX765844_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KX765837_X_P-C      gtcggcgctgaatcctgcggacgacccatctcggggccgtttgggactctaccgtcccct
KU051425_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KT307719_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JQ801519_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JQ801513_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
JQ801475_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
GQ924629_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ855530_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggtctctaccgtcccct
GQ358153_X_P-C      gtcagcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
FJ023642_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
FJ023640_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ023639_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
AF068756_X_P-C      ttcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
MK534642_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KT987425_X_P-C      gtcggcgctgaatccagcggacgacccatctcggggccgtttgggactctaccgtcccct
KU051424_X_P-C      gtcggcgctgaatcccgcggacgacccttctcggggccgtttgggactctaccgtcccct
KU051426_X_P-C      gtcggcgctgaatcccgcggacgacccttctcggggccgtttgggactctaccgtcccct
KJ803799_X_P-C      gtcggcgctgaatcccgcggacgacccttcacggggccgtttgggactctaccgtcccct
KX765832_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
KX765826_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctatcgtcccct
JQ801493_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
JQ801511_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
GU563561_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
JQ801470_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggtctctaccgtcccct
KX765853_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JQ801520_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KX765840_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JN418500_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggtctctaccgtcccct
GQ855523_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ023641_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
GQ855548_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JN827416_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MT111596_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
FJ023657_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
FJ023649_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
AB247916_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JQ801508_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KX765833_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KX765846_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
GQ924609_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MF925406_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MF925408_X_P-C      gtcagcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MK534643_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MK534624_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MK534666_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KX765848_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KX765831_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KT235617_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JQ801486_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JN827421_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
JN827418_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
JN827417_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtcccct
JN827420_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KT987424_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KX765818_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KX765850_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MK534631_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
HQ700522_X_P-C      gtcagcgctgaatccggcggacgatccgtctcggggccgcctggggatctaccgtcccct
HQ700543_X_P-C      gtcagcgctgaatccggcggacgatccgtctcggggccgcctggggatctaccgtcccct
AB115418_X_P-C      gtcggcgctgaatcctgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
MH488859_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
EU522071_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcatctatcgtcccct
MK171325_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcgcggccgcttgggactctatcgtcccct
MK171339_X_P-C      gtcggcgctgaatcccgcggacgacccstcycgsggccgtttgggcctctatcgtcccct
AB115417_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
EF494377_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KJ803809_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcgcggccgcttgggtctctatcgtcccct
AY206386_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctctcgtcccct
KX276836_X_P-C      gtcggcgmtgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtcccct
KJ803777_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
EU882005_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtcccct
KX276833_X_P-C      gtcggcgctgaatccmgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
JN418509_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtcccct
JQ027332_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
AB931170_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtcccct
AB931171_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtcccct
AB900113_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
JN418505_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
AB368297_X_P-C      gtcggcgctgaatcccgcggacgacccatctcgcggccgtttgggcctctatcgtcccct
AB049610_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtcccct
AB900109_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcatctatcgtcccct
MK171454_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
MK171361_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtcccct
MK171340_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
JN418546_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttggggctctatcgtcccct
KU964049_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964050_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964051_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964052_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964053_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964054_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964055_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964056_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964057_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964058_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964059_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964060_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964061_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964062_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964063_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
MG826125_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
AY206385_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
AB367431_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
MK171533_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
MK171329_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
DQ089801_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964028_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964020_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964021_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964022_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964023_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964024_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964025_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964026_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964029_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964030_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964031_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964032_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964033_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KU964027_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
FJ562298_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggacgtttgggcctctatcgtcccct
MK171289_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtcccct
KC774203_X_P-C      gtcggcgttgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
KF873539_X_P-C      gtcggcgctgaaccccgcggacgacccgtctcgcggccgcttggggatctaccgtcccct
KF873541_X_P-C      gtcggcgctgaaccccgcggacgacccgtctcgcggccgcttggggmtctaccgtcccct
KU679937_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgcttggggatrtaccgtcccct
HQ700577_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaycgtcccct
HQ700575_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggmtctatcgtcccct
HQ700457_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgcttggggmtctaycgtcccct
HQ700570_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctatcgtcccct
HQ700562_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctatcgtcccct
HQ700556_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctatcgtcccct
HQ700563_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggggtctatcgtcccct
HQ700564_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctatcgtcccct
HQ700565_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctatcgtcccct
HQ700504_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctatcgtcccct
HQ700568_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctatcgtcccct
HQ700573_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctatcgtcccct
HQ700502_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctatcgtcccct
HQ700574_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctatcgtcccct
HQ700529_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgcttggggatctaccgtcccct
HQ700576_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatstaccgtcccct
HQ700572_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtcccct
HQ700569_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtcccct
HQ700567_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtcccct
HQ700475_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtcccct
HQ700578_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgattgggactctaccgtcccct
HQ700476_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtcccct
HQ700571_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgcttggggatctaccgtcccct
HQ700456_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtcccct
HQ700555_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtcccct
HQ700490_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtcccct
HQ700495_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgcttggggatctaccgtcccct
HQ700496_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgcttggggatctaccgtcccct
HQ700559_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggmtctaccgtcccct
HQ700566_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
HQ700558_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtcccct
HQ700561_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtcccct
KF873536_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgcttggggatctrccgtcccct
KU679960_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgcctggggatctaccgtcccct
MH488821_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KU679947_X_P-C      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactttaccgtcccct
KU679957_X_P-C      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactttaccgtcccct
KF873526_X_P-C      gtcggcgctgaatcccgccgacgacccttctcggggccgcttgggactttaccgtcccct
KF873528_X_P-C      gtcggcgctgaatcccgccgacgacccttctcggggccgcttgggactttaccgtcccct
KF873529_X_P-C      gtcggcgctgaatcccgccgacgacccttctcggggccgcttgggactttaccgtcccct
KF873525_X_P-C      gtcggcgctgaatcccgccgacgacccttctcggggccgcttgggrstktaccgtcccct
KU679936_X_P-C      gtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtcccct
KU679949_X_P-C      gtcgrcgctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtcccct
KF873514_X_P-C      gtcggcgctgaaccccgcggacgacccttctcggggccgcttggggctctaccgtcccct
KF873516_X_P-C      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtcccct
KF873520_X_P-C      gtcggcgctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtcccct
EU939586_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB900115_X_P-C      gtcggcgatgaatcccgcggacgacccgtcgcggggccgtttgggcctctatcgtcccct
MK171646_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccggttgggggtctatcgtcccct
AB493839_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgcttgggggtctaccgtcccct
MK171345_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtcccct
JQ040149_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggmctctaycgtcccct
MT645027_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctttatcgtcccct
MK171637_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggacgtttgggtctctaccgtcccct
MK171617_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MT645022_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
HQ700517_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactgtaccgtcccct
MK171382_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939553_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171322_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtcccct
MK171630_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtcccct
MK171449_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB300373_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
MH488831_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgttaggggctctaccgtcccct
KC774319_X_P-C      gtcggcgctgaatcccgcggacgacccgtcccggggccgtttgggtctctaccgtcccct
FJ562310_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB670311_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB300368_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctttaccgtcccct
KR013777_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgcttgggactctaccgtcccct
KX429625_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcctct
MK171564_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
AB670253_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctttcgtcccct
EU939579_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
FJ899774_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MZ671240_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactcttccgtcccct
MZ675788_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactcttccgtcccct
MZ671242_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactcttccgtcccct
MK171500_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171457_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
MK171394_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK171318_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtcccct
KC774279_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctttaccgtcccct
JQ040151_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
MT644998_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JN418552_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU916226_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggcctctatcgtcccct
DQ089796_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccct
AY206388_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MZ671243_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactcttccgtcccct
FJ787488_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
JQ040143_X_P-C      gtcggcgctgaatcccgcggacgacccgtcccggggccgtttgggtctctaccgtcccct
MK171258_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171259_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MG826140_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598769_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598762_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KJ598778_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598772_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KJ598770_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KJ598775_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KJ598768_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598767_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598773_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598776_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598777_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598766_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598771_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598774_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598779_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598780_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598756_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598757_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598760_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598765_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ598761_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171473_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
MT645028_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171471_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttgggactctaccgtcccct
MT645017_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171621_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KC875262_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JN418542_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctct
GQ377593_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ377518_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ386689_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcatttatcgtcccct
EU939594_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU939592_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939583_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttgggtctctaccgtcccct
AB300360_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ341870_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU916224_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
MK171363_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ040166_X_P-C      gtcggcgctgaatcccgcggacgacccgtcccggggccgtttggggctctaccgtcccct
MK171299_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562306_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggtctctaccgtcccct
EU919168_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggacgtttgggactctaccgtcccct
JQ341903_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
EU562215_X_P-C      gtcggcgctgaatcccgcggacgacccgtcccggggccgtttgggcctctatcgtcccct
EU562216_X_P-C      gtcggcgctgaatcccgcggacgacccgtcccggggccgtttgggcctctatcgtcccct
EU562217_X_P-C      gtcggcgctgaatcccgcggacgacccgtcccggagccgtttgggcctctatcgtcccct
FJ787457_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
FJ787458_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
GQ227692_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ227697_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ227693_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ227694_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ227695_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ259588_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ227696_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
HM750134_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
HM750135_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171411_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MK171435_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK171415_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171353_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JQ341879_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939647_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MT645026_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171583_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KJ803765_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JN418498_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtcccct
FJ899768_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562264_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
AY206378_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AB014390_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
AB971714_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AB971715_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AB485809_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB485810_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171582_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
FJ787489_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AY206382_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
FJ787442_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
FJ787443_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
FJ562243_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KC774355_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171355_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171330_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB367417_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939587_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
HM011500_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939536_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
GQ377540_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
EU939571_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
EU939643_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171590_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KY470886_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KY470888_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KY470880_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
GQ377617_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ377605_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939570_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KY470889_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KY470883_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KY470873_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctactgtcccct
KY470876_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KY470878_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KY470879_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KY470884_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KY470892_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KY470891_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttaggtctctaccgtcccct
KY470890_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttaggtctctaccgtcccct
KY470887_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttaggtctctaccgtcccct
KY470885_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttaggtctctaccgtcccct
KY470874_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttaggtctctaccgtcccct
KY470875_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttaggtctctaccgtcccct
KY470877_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttaggtctctaccgtcccct
KY470882_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttaggtctctaccgtcccct
FJ386626_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KY470881_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
EU560440_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
EU579442_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
FJ562244_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MF059674_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MK171591_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KC774340_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ386685_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ089795_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171362_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ027319_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
HM011481_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KX276839_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU919165_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU939651_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774243_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
FJ032355_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ032356_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939616_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562288_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JN418496_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171320_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggggtctaccgtcccct
MK171433_X_P-C      gtcagcgctgaatcccgcggacgatccgtctcggggccgtttgggactctaccgtcccct
MG826131_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KC163906_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MG826138_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
EU306671_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU306672_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KX276855_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MG826132_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171554_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AY251141_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MG826139_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MG826128_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MG826129_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MG826136_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctct
MG826134_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MG826133_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MG826135_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgtttggggctctaccgtcccct
AP011106_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AP011107_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KX429658_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171459_X_P-C      gtcggcgctgaatcccgcggacgacccgtcycggggccgcttggggatctaccgycccct
AB113878_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtctgggactctatcgtcccct
AB195930_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtctgggactctatcgtcccct
AB195931_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtctgggactctatcgtcccct
AB195932_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtctgggactctatcgtcccct
AB697502_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AB670298_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcatctatcgtcccct
GQ377623_X_P-C      gtcgacgctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtcccct
AB042285_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
FJ787490_X_P-C      gtcggcgctgaatcccgcagacaatccgtctcggggccgtttgggcctctaccgtcccct
AB014360_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
MK171347_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctttatcgtcccct
AB670268_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB670304_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171540_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttggggctctatcgtcccct
GQ475357_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AB367405_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggcctctaccgtcccct
AB014386_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
FJ386624_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtcccct
GQ372968_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtcccct
JN418558_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475343_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ377601_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttggggctctatcgtcccct
AB367426_X_P-C      gtccgcgctgaatcccgcggacgacccgtctcggggtcgtttgggcctctaccgtcccct
AB367801_X_P-C      gtccgcgctgaatcccgcggacgacccgtctcggggtcgtttgggcctctaccgtcccct
HM011479_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KX276837_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JF828937_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgttcgggcctctatcgtcccct
AB670292_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AB670265_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AB367392_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AB014368_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
JF828925_X_P-C      gtcggcactgaatcctgcggacgacccctctcggggccgtttgggcctctaccgtcccct
JF828921_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggtcgtttgggcctctaccgtcccct
JF828922_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgtttgggcctctaccgtcccct
JF828923_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgtttgggcctctaccgtcccct
JF828926_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgtttgggcctctaccgtcccct
JF828928_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgtttgggcctctaccgtcccct
JF828930_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgtttgggcctctaccgtcccct
JF828924_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgtttgggcctctaccgtcccct
JF828929_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgtttgggcctctaccgtcccct
JF828931_X_P-C      gtcggcgctgaatcctgcggacgacccctctcggggccgtttgggcctctaccgtcccct
MH488850_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JQ027323_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ377577_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttggggctctatcgtcccct
GQ377576_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
FJ899788_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtcccct
AB670278_X_P-C      gtcggcgatgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670262_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
DQ683578_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AY641558_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
JN400087_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
JN400088_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
JN400089_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MT645054_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KY363257_X_P-C      gtcggcgttgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367432_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367804_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670272_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670246_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggcctctaccgtcccct
MZ671244_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactcttccgtcccct
MK171641_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgaacctctaccgtcccct
KY363264_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB367409_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367399_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB104892_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB471853_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB471851_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB471852_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
KY363266_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggcctctaccgtcccct
KY363267_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggcctctaccgtcccct
KR013791_X_P-C      gtcggcgctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtcccct
GQ377620_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562299_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtcccct
KY363282_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY363283_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171268_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ032346_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ032347_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB014374_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
MK171442_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
AB042284_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ386621_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
AB670266_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctcttccgtcccct
AB670301_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctcttccgtcccct
AY206389_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
FJ151413_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK171574_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctct
MH488809_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KY363275_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
JX504534_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctcccgtcccct
FJ562304_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
AB670290_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367423_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AB367412_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB106895_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AB367401_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
KY363268_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
JN418512_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ377572_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
AB014363_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475330_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactttaccgtcccct
JN418506_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
EU570073_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU570074_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AB014371_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562340_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ386597_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ386667_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562269_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171514_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU570072_X_P-C      gtcggcgctgaatcccgcggacgatccgtttcggggccgtttgggtctctatcgtcccct
EU560438_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttgggtctctatcgtcccct
EU560439_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttgggtctctatcgtcccct
JN418539_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctct
KY363278_X_P-C      gtcggcgctgaatcccgcggacgacccttcccggggccgtttgggcctctaccgtcccct
KY363279_X_P-C      gtcggcgctgaatcccgcggacgacccttcccggggccgtttgggcctctaccgtcccct
MK171412_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctttaccgtcccct
MK171445_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctttaccgtcccct
AB485808_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367402_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367403_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MH891502_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
AB670239_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
AB670240_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
KY363287_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
AB367420_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
AB367425_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctatcgtcccct
KC774225_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtcccct
AB367406_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
MT645046_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtctgggactctatcgtcccct
AB222714_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB222715_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MK171317_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
FJ386629_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
GQ475326_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
EU939572_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
JQ040156_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AY247032_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
FJ899765_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ899764_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ899763_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ899775_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939538_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ899761_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU916219_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtcccct
FJ899789_X_P-C      gtcagcgctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtcccct
FJ562232_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
EU939615_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtcccct
FJ386671_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtcccct
EU916222_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtcccct
MK171431_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtcccct
FJ386647_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
EU939550_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AY641560_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367433_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctct
AB367413_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB014394_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB365451_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367427_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB014376_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcatctaccgtcccct
AB670243_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcatctaccgtcccct
AB195942_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AB195943_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AB195944_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AB670242_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670256_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MK171338_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctttaccgtcccct
JQ341900_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KY363284_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
KY363260_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
KF214651_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774245_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JN418504_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ872211_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475355_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
GQ475353_X_P-C      atcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ475333_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475324_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
EU881996_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
D12980_X_P-C        gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670295_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670277_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AB670241_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB642095_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367422_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367421_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtcccct
AB300361_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AB195946_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB195945_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB176642_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB298720_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB298721_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ040135_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
JQ040161_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AB670288_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367435_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367398_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475319_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670291_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
LC279252_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AB205124_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670247_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670283_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
LC279251_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
LC279253_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AB670260_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB182589_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367394_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475317_X_P-C      gtcggcgctgaatcctgccgacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670310_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
JN418494_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB195947_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB195948_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670255_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MK171302_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctttaccgtcccct
AB670297_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
D50517_X_P-C        gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
D50518_X_P-C        gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475354_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MK171629_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtcccct
MK171578_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KY363274_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
KJ803769_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
FJ386607_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
GQ475327_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475334_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
KY363285_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475341_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
GQ475342_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475351_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
EU919164_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
FJ562284_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK171358_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK171610_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JN418507_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475332_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475315_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475312_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475314_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ475336_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670302_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU306726_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
MK171597_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AB670252_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670300_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367411_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB202071_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB202072_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670306_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MH818373_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
AY311588_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
D50519_X_P-C        gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367408_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
D50520_X_P-C        gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ377618_X_P-C      gtcggcgctgaatcccgcggacgacccctctcggggccgtttgggtctctaccgtccgct
MT645051_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggaatctatcgtcccct
KC814871_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ386644_X_P-C      gtcggcgctgaatcccgcggacgatccgtctcggggccgtttgggactctaccgtcccct
DQ089800_X_P-C      gtcgacactgaatcctgcggacgacccctcacggggccgcttgggactctaccgtcccct
MH488822_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccct
GQ377636_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562266_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtctgggtctctaccgtcccct
EU939556_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ787485_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtcccct
FJ787482_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtcccct
FJ787483_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtcccct
MK171344_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY363254_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC774210_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ890381_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
GQ377526_X_P-C      gtcggcgatgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171300_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtcccct
KC774283_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgttggggactctaccgtcccct
EU939595_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KC774326_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactcttccgtcccct
JX429918_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcccct
EU919169_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggacgtttgggactctaccgtcccct
MK171559_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtcccct
KF485390_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
GQ377580_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171327_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctcttccgtcccct
KC774301_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccatttgggactctaccgtcccct
EU916227_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171391_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtcccct
MK171312_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
MK171267_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KY881805_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgcttgggactctaccgtcccct
KU964014_X_P-C      gtcagcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
JN418540_X_P-C      gtcggcgctgaatcccgcggacgacccatctcggggccgtttgggcctctaccgtcccct
GQ475352_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
EU939642_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgattgggtctctaccgtcccct
AY206392_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF182804_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB195949_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC814903_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC814927_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MT645055_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JX661497_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JN418515_X_P-C      gtcggcgctgaatcccgcggacgacccgtcacggggccgtttgggtctctaccgtcccct
GQ377584_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU872012_X_P-C      gtcggcgctgaatcccgcggacgacccgtcgcggggccgtttgggactctaccgtcccct
MK171393_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
AF324347_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JN418555_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939560_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
LC279275_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
LC279276_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ032336_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtcccct
FJ032338_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtcccct
LC279274_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
LC318702_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562252_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939580_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AY028298_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF325701_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF325199_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF325700_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AY028597_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JQ040162_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ386670_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU871975_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU871977_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU872008_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtcccct
DQ986376_X_P-C      gtcggcgctgaatcccgcggacgacccgtcccggggccgtttgggaatctaccgtcccct
EU871978_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtcccct
EU871979_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtcccct
EU522069_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU871970_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939614_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562331_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF182805_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ151414_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF182803_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU871969_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU871974_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU871973_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU871971_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ788835_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF182802_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU871972_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR014005_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB111115_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
AB111116_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
AB111117_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
GQ475306_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB367418_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB670309_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
JN418503_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
FJ518810_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
FJ386662_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC814902_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC814899_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC814926_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB042282_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB042283_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AF461358_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF461359_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171487_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171423_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939564_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY363252_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
GQ475310_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
FJ787462_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562337_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562313_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ386661_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtctgggactctaccgtcccct
FJ386619_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939545_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcgcggccgtttgggaatctaccgtcccct
AY641561_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AY220699_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU872003_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU872002_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactataccgtcccct
EU872000_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU872001_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU872004_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC814866_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JF828911_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JF828906_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
JF828907_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
EU939610_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ386595_X_P-C      gtcggcgctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtcccct
JQ040163_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562308_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ386632_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
JF436920_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171346_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AB111121_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB111122_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
AB111123_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccct
MK171586_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtcccct
MK171262_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171626_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KY363253_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcccct
KR013975_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactccaccgtcccct
JQ040145_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ787463_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctct
FJ386579_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtcccct
FJ032351_X_P-C      gtcggagctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ032350_X_P-C      gtcggagctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939567_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU522068_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
DQ993693_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcccct
KR013790_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013788_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctct
KR013937_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctct
KR013789_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctct
KC814887_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC814923_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC814854_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KC814855_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AY167090_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
EU939645_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562251_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ386594_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AF363961_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
AY596108_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171430_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
MK171291_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KU964360_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KU964358_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctgccgtcccct
KU964352_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KU964349_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KU964363_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KU964364_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
KR013801_X_P-C      gtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccct
FJ562283_X_P-C      gtcggcgctgaatcccgcggacgacccg