HBVdb

Dataset for nucleotide sequence X of genotype C

[Download (right click)] [Alignment] [Repertoires]

3552 sequence(s)

>gnl|hbvcds|AB014360_X_P-C Feature FT:CDS AB014360_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01D01HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
gccaccgtgaacgcccaccaggtcttgcccaagctcttgtataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014361_X_P-C Feature FT:CDS AB014361_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 02D02HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactattggactctcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014362_X_P-C Feature FT:CDS AB014362_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 03D03HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
acctccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014363_X_P-C Feature FT:CDS AB014363_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 04D04HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014364_X_P-C Feature FT:CDS AB014364_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 05D05HCC). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014365_X_P-C Feature FT:CDS AB014365_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01D06HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcttgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014367_X_P-C Feature FT:CDS AB014367_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 08D08HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014368_X_P-C Feature FT:CDS AB014368_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 09D09HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaattggatcctgcgcgggacgtcctttgtytacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014369_X_P-C Feature FT:CDS AB014369_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10D10HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcacagaatcccgcgg
acgacccgtctcgcggccgtttgggactctatcgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014371_X_P-C Feature FT:CDS AB014371_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 12D12HCC). Complete genome. [Hepadnaviridae] (length=471 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatgggc
atggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaac
gaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagtctaggttaatgatct
ttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014372_X_P-C Feature FT:CDS AB014372_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 13D13HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtytacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014374_X_P-C Feature FT:CDS AB014374_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 15D15HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014376_X_P-C Feature FT:CDS AB014376_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 17T02HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcatctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014377_X_P-C Feature FT:CDS AB014377_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18T03HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttayataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaaaactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014378_X_P-C Feature FT:CDS AB014378_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 19Y01HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgactctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttatataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014379_X_P-C Feature FT:CDS AB014379_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 20Y02HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014380_X_P-C Feature FT:CDS AB014380_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 21Y03HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014381_X_P-C Feature FT:CDS AB014381_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 22Y04HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014382_X_P-C Feature FT:CDS AB014382_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23Y05HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014383_X_P-C Feature FT:CDS AB014383_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 24Y06HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccattcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagaktaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014384_X_P-C Feature FT:CDS AB014384_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 25Y07HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014385_X_P-C Feature FT:CDS AB014385_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26Y08HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|AB014386_X_P-C Feature FT:CDS AB014386_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 27Y09HCC). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggttgaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014387_X_P-C Feature FT:CDS AB014387_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 28Y10HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggcatctatcgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtgttgcccaaggtcttatataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggaacttaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014388_X_P-C Feature FT:CDS AB014388_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 29Y11HCC). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggaatcaggggaggagattaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014389_X_P-C Feature FT:CDS AB014389_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 30Y12HCC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccattccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactytcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014390_X_P-C Feature FT:CDS AB014390_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 31Y13HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcaactgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014391_X_P-C Feature FT:CDS AB014391_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 32Y14HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggtctctaccgtcccctccttcatctgccgttccggccgcccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014392_X_P-C Feature FT:CDS AB014392_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 33Y15HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014393_X_P-C Feature FT:CDS AB014393_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 34Y16HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagaaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014394_X_P-C Feature FT:CDS AB014394_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 35Y17HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtytacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|AB014395_X_P-C Feature FT:CDS AB014395_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 36Y18HCC). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagtttaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014396_X_P-C Feature FT:CDS AB014396_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 37Y19HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaataggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014397_X_P-C Feature FT:CDS AB014397_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 38Y20HCC). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccagctcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014398_X_P-C Feature FT:CDS AB014398_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 39Y21HCC). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttgaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB014399_X_P-C Feature FT:CDS AB014399_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 40Y22HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB026811_X_P-C Feature FT:CDS AB026811_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;97.Feb.). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB026812_X_P-C Feature FT:CDS AB026812_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;98.May). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB026813_X_P-C Feature FT:CDS AB026813_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;97.Sep.). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB026814_X_P-C Feature FT:CDS AB026814_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Donor 3;98.May). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB026815_X_P-C Feature FT:CDS AB026815_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 2:full). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgcaaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB031262_X_P-C Feature FT:CDS AB031262_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV VietA-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB033550_X_P-C Feature FT:CDS AB033550_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NDR260). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB033551_X_P-C Feature FT:CDS AB033551_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK300). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgcccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB033552_X_P-C Feature FT:CDS AB033552_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK494). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacacccacctggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB033553_X_P-C Feature FT:CDS AB033553_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK619). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB033556_X_P-C Feature FT:CDS AB033556_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AK66). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB042282_X_P-C Feature FT:CDS AB042282_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB042283_X_P-C Feature FT:CDS AB042283_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB042284_X_P-C Feature FT:CDS AB042284_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggca
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB042285_X_P-C Feature FT:CDS AB042285_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-4). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagaatgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccacgcaactttttcacctctgcctaa
>gnl|hbvcds|AB049610_X_P-C Feature FT:CDS AB049610_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV AN29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctatcgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctgtacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcgatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaataggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB050018_X_P-C Feature FT:CDS AB050018_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcactgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB074047_X_P-C Feature FT:CDS AB074047_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgactacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB074755_X_P-C Feature FT:CDS AB074755_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattcggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB074756_X_P-C Feature FT:CDS AB074756_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th55). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtatttacagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB104892_X_P-C Feature FT:CDS AB104892_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtaa
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB105173_X_P-C Feature FT:CDS AB105173_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hawaii 16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB105174_X_P-C Feature FT:CDS AB105174_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hawaii 60). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgacaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagattaatgatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB106895_X_P-C Feature FT:CDS AB106895_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate pHB4-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattcgtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111112_X_P-C Feature FT:CDS AB111112_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111113_X_P-C Feature FT:CDS AB111113_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcatttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttccaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111114_X_P-C Feature FT:CDS AB111114_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111115_X_P-C Feature FT:CDS AB111115_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacatccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111116_X_P-C Feature FT:CDS AB111116_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacatccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111117_X_P-C Feature FT:CDS AB111117_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacatccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111118_X_P-C Feature FT:CDS AB111118_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111119_X_P-C Feature FT:CDS AB111119_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111120_X_P-C Feature FT:CDS AB111120_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111121_X_P-C Feature FT:CDS AB111121_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111122_X_P-C Feature FT:CDS AB111122_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111123_X_P-C Feature FT:CDS AB111123_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111124_X_P-C Feature FT:CDS AB111124_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111125_X_P-C Feature FT:CDS AB111125_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB111946_X_P-C Feature FT:CDS AB111946_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT103). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
gcttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB112063_X_P-C Feature FT:CDS AB112063_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT101). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgggggcgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagaccgtgtatttaaagactgggaggagctgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB112065_X_P-C Feature FT:CDS AB112065_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT140). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttgttcgtctgccgttccggccgaccacggggtgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgctttaccactgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB112066_X_P-C Feature FT:CDS AB112066_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY624). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctat
ctttacgcggtatccccgtctgtgcctgctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgattcttgtac
tgagaggctgtaggcataaattggcctgttcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB112348_X_P-C Feature FT:CDS AB112348_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY656). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgacctcggggcgcaccacg
atttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctccgcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB112408_X_P-C Feature FT:CDS AB112408_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY683). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgacctcggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaagtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagctgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttgaattcttcctaa
>gnl|hbvcds|AB112471_X_P-C Feature FT:CDS AB112471_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TH123). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB112472_X_P-C Feature FT:CDS AB112472_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TH124). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgggggcacttcgctacacctctgcacgaggcatggag
accaccgtgaacgcccgccaggtcttgcccaaggccttacataagaggactctgggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagatgggggaggagactagattaaagatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB113875_X_P-C Feature FT:CDS AB113875_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB113876_X_P-C Feature FT:CDS AB113876_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB113877_X_P-C Feature FT:CDS AB113877_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctatcgtccccttctacatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB113878_X_P-C Feature FT:CDS AB113878_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtctgggactctatcgtccccttcttcatctgccattccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcacctgcaccatgctactttttcacctttgcctaa
>gnl|hbvcds|AB113879_X_P-C Feature FT:CDS AB113879_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcagctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB115417_X_P-C Feature FT:CDS AB115417_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-O47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggcctctatcgtccccttcttggtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagcggactcttggactcccagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttgaattctgcctaa
>gnl|hbvcds|AB115418_X_P-C Feature FT:CDS AB115418_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-O55). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccgtctcgcggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagcggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgcggaaggagataaggttaaagatctttgtat
taggaggctgtaggcataaattgtactgttcacaagcaccatgcaactttttcccctctgcctaa
>gnl|hbvcds|AB117758_X_P-C Feature FT:CDS AB117758_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CB10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgaccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggatgatggtctttgtac
tgggagggtgtacgcatacattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB176642_X_P-C Feature FT:CDS AB176642_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-115). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggrtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctrcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB182589_X_P-C Feature FT:CDS AB182589_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CH:Mat-Ko). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195930_X_P-C Feature FT:CDS AB195930_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtctgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgtacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcacctgcaccatgctactttttcacctctgcctaa
>gnl|hbvcds|AB195931_X_P-C Feature FT:CDS AB195931_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtctgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccatctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgtacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcacctgcaccatgctactttttcacctctgcctaa
>gnl|hbvcds|AB195932_X_P-C Feature FT:CDS AB195932_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtctgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccatctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgtacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcacctgcaccatgctactttttcacctctgcctaa
>gnl|hbvcds|AB195936_X_P-C Feature FT:CDS AB195936_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195937_X_P-C Feature FT:CDS AB195937_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaagtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195938_X_P-C Feature FT:CDS AB195938_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaagtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195942_X_P-C Feature FT:CDS AB195942_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195943_X_P-C Feature FT:CDS AB195943_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195944_X_P-C Feature FT:CDS AB195944_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195945_X_P-C Feature FT:CDS AB195945_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgacgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccaccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195946_X_P-C Feature FT:CDS AB195946_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgacgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccaggaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195947_X_P-C Feature FT:CDS AB195947_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195948_X_P-C Feature FT:CDS AB195948_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195949_X_P-C Feature FT:CDS AB195949_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtagcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195952_X_P-C Feature FT:CDS AB195952_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttgctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195953_X_P-C Feature FT:CDS AB195953_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttgctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195954_X_P-C Feature FT:CDS AB195954_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttgctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB198076_X_P-C Feature FT:CDS AB198076_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtcgcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB198077_X_P-C Feature FT:CDS AB198077_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtgttgcccaaggtcttacataaaaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|AB198078_X_P-C Feature FT:CDS AB198078_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB198079_X_P-C Feature FT:CDS AB198079_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB198080_X_P-C Feature FT:CDS AB198080_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtgttgcccaaggtcttacataaaaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB198081_X_P-C Feature FT:CDS AB198081_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB198082_X_P-C Feature FT:CDS AB198082_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttggggctctatcgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB198083_X_P-C Feature FT:CDS AB198083_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB202071_X_P-C Feature FT:CDS AB202071_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
gccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB202072_X_P-C Feature FT:CDS AB202072_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
gccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB205123_X_P-C Feature FT:CDS AB205123_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CN578-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctataccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtgttgcccaaggtcttacataaaaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB205124_X_P-C Feature FT:CDS AB205124_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TJ3-1-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB205125_X_P-C Feature FT:CDS AB205125_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VH34-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatccagcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB222714_X_P-C Feature FT:CDS AB222714_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UZNVC7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcctaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB222715_X_P-C Feature FT:CDS AB222715_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UZNVC7M). Complete genome. [Hepadnaviridae] (length=465 residues).
catgctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcctaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB241110_X_P-C Feature FT:CDS AB241110_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhLC03). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgggggcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagtaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB241111_X_P-C Feature FT:CDS AB241111_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhLC14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgggggcgcttggggatctatcgtccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB241112_X_P-C Feature FT:CDS AB241112_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhHCC15). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgggggcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB241113_X_P-C Feature FT:CDS AB241113_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhHCC13). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgggggcgcttggggatctatcgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB246344_X_P-C Feature FT:CDS AB246344_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB246345_X_P-C Feature FT:CDS AB246345_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB246346_X_P-C Feature FT:CDS AB246346_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaagtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagtcgggggaggagtttaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|AB247916_X_P-C Feature FT:CDS AB247916_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB250109_X_P-C Feature FT:CDS AB250109_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IH030213). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtcccctccttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB288026_X_P-C Feature FT:CDS AB288026_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcactgaatcccgcgg
acgacccgtctcggggccgtttgggaatttaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB298720_X_P-C Feature FT:CDS AB298720_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BAJT2006-1S). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
gccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB298721_X_P-C Feature FT:CDS AB298721_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BAJT2006-1C). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
gccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB299858_X_P-C Feature FT:CDS AB299858_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB300359_X_P-C Feature FT:CDS AB300359_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB300360_X_P-C Feature FT:CDS AB300360_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB300361_X_P-C Feature FT:CDS AB300361_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB300362_X_P-C Feature FT:CDS AB300362_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatccagcgg
acgacccgtctcggggccgcttgggcctctaccgtcccctacttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB300363_X_P-C Feature FT:CDS AB300363_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB300365_X_P-C Feature FT:CDS AB300365_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB300368_X_P-C Feature FT:CDS AB300368_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctttaccgtccccttcttcgcctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccagttcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB300372_X_P-C Feature FT:CDS AB300372_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient14). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcagctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctttttgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB300373_X_P-C Feature FT:CDS AB300373_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient15). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
gccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggctaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB362932_X_P-C Feature FT:CDS AB362932_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB365451_X_P-C Feature FT:CDS AB365451_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BOL196). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367392_X_P-C Feature FT:CDS AB367392_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtactgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtatccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367394_X_P-C Feature FT:CDS AB367394_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 3/Adefovir-treated Pt. 8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367395_X_P-C Feature FT:CDS AB367395_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367396_X_P-C Feature FT:CDS AB367396_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367397_X_P-C Feature FT:CDS AB367397_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcactgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367398_X_P-C Feature FT:CDS AB367398_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 7/Adefovir-treated Pt. 20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367399_X_P-C Feature FT:CDS AB367399_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 8/Adefovir-treated Pt. 29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttgctctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367401_X_P-C Feature FT:CDS AB367401_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 10/Adefovir-treated Pt. 9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367402_X_P-C Feature FT:CDS AB367402_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcctaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367403_X_P-C Feature FT:CDS AB367403_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 12/Adefovir-treated Pt. 17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367404_X_P-C Feature FT:CDS AB367404_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 13/Adefovir-treated Pt. 22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367405_X_P-C Feature FT:CDS AB367405_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 14/Adefovir-treated Pt. 25). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctccgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggcctctaccgtccccttcttcgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367406_X_P-C Feature FT:CDS AB367406_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 15/Adefovir-treated Pt. 7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggatactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367407_X_P-C Feature FT:CDS AB367407_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 16/Adefovir-treated Pt. 11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttaggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367408_X_P-C Feature FT:CDS AB367408_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 17/Adefovir-treated Pt. 14). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367409_X_P-C Feature FT:CDS AB367409_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 18). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgggggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctttctctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaatgactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367410_X_P-C Feature FT:CDS AB367410_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 19/Adefovir-treated Pt. 19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggcctccccgtctgtgccttgtcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367411_X_P-C Feature FT:CDS AB367411_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367412_X_P-C Feature FT:CDS AB367412_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgctttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367413_X_P-C Feature FT:CDS AB367413_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 22/Adefovir-treated Pt. 4). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatctggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtttatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367414_X_P-C Feature FT:CDS AB367414_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 23/Adefovir-treated Pt. 3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttaggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367416_X_P-C Feature FT:CDS AB367416_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttaggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367417_X_P-C Feature FT:CDS AB367417_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367418_X_P-C Feature FT:CDS AB367418_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 27/Adefovir-treated Pt. 21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacatccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367420_X_P-C Feature FT:CDS AB367420_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367421_X_P-C Feature FT:CDS AB367421_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 30). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367422_X_P-C Feature FT:CDS AB367422_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 31/Adefovir-treated Pt. 12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367423_X_P-C Feature FT:CDS AB367423_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 32/Adefovir-treated Pt. 28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367424_X_P-C Feature FT:CDS AB367424_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367425_X_P-C Feature FT:CDS AB367425_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 34/Adefovir-treated Pt. 15). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367426_X_P-C Feature FT:CDS AB367426_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 35). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtccgcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaagctcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagattgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367427_X_P-C Feature FT:CDS AB367427_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 36/Adefovir-treated Pt. 18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcgtttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367428_X_P-C Feature FT:CDS AB367428_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 37/Adefovir-treated Pt. 10). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccatcggcgttgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgcctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttaggagaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367429_X_P-C Feature FT:CDS AB367429_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 38). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggaacttaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367430_X_P-C Feature FT:CDS AB367430_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 39/Adefovir-treated Pt. 5). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367431_X_P-C Feature FT:CDS AB367431_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggcctctatcgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367432_X_P-C Feature FT:CDS AB367432_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctacgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367433_X_P-C Feature FT:CDS AB367433_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 42/Adefovir-treated Pt. 27). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtcctcttcttcatctgccgtaccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367434_X_P-C Feature FT:CDS AB367434_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 43/Adefovir-treated Pt. 26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcactgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggcattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367435_X_P-C Feature FT:CDS AB367435_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 44/Adefovir-treated Pt. 23). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367801_X_P-C Feature FT:CDS AB367801_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 30). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtccgcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaagctcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagattgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367802_X_P-C Feature FT:CDS AB367802_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 16). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatactacaaagactgtttgtttaaagactgggaggagttgggggaggaacttaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367803_X_P-C Feature FT:CDS AB367803_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttaggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB367804_X_P-C Feature FT:CDS AB367804_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctacgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB368297_X_P-C Feature FT:CDS AB368297_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcgcggccgtttgggcctctatcgtccccttctacgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcgatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB426467_X_P-C Feature FT:CDS AB426467_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB471848_X_P-C Feature FT:CDS AB471848_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-F). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactcttccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB471849_X_P-C Feature FT:CDS AB471849_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-C2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactcttccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB471850_X_P-C Feature FT:CDS AB471850_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-C1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactcttccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB471851_X_P-C Feature FT:CDS AB471851_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2NK-F). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaagctcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgcttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB471852_X_P-C Feature FT:CDS AB471852_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2S-C2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgcttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB471853_X_P-C Feature FT:CDS AB471853_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2S-C3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgcttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtttgttcaccggcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB485808_X_P-C Feature FT:CDS AB485808_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-IT). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgactctgccgttccaaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB485809_X_P-C Feature FT:CDS AB485809_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FEP1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB485810_X_P-C Feature FT:CDS AB485810_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FEP2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB493839_X_P-C Feature FT:CDS AB493839_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 08UC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgcttgggggtctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacttggtcttgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggagtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB493844_X_P-C Feature FT:CDS AB493844_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 43UC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctaccgtccccttcttcgtctgccgttccggccaactacggggcgcacctct
ctttacgcggtctccccgtctgtgccttttcatctgccgacccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtgttgcctaaggtcttgcataagaggactcttggactctctgcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB640730_X_P-C Feature FT:CDS AB640730_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ehime-EPCH-HBV-C1-HN). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctacgtctgccgttccggccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB642095_X_P-C Feature FT:CDS AB642095_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2000-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattcggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB642097_X_P-C Feature FT:CDS AB642097_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2003-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagtaccttgcaactttttcacctctgcctaa
>gnl|hbvcds|AB642099_X_P-C Feature FT:CDS AB642099_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2005-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB642100_X_P-C Feature FT:CDS AB642100_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2006-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcg
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaagactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttgaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670237_X_P-C Feature FT:CDS AB670237_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670238_X_P-C Feature FT:CDS AB670238_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttctacatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670239_X_P-C Feature FT:CDS AB670239_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtay
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670240_X_P-C Feature FT:CDS AB670240_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtay
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670241_X_P-C Feature FT:CDS AB670241_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670242_X_P-C Feature FT:CDS AB670242_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctkccggrccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttatttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670243_X_P-C Feature FT:CDS AB670243_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.7). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcatctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670246_X_P-C Feature FT:CDS AB670246_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.10). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
rccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggattgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670247_X_P-C Feature FT:CDS AB670247_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670249_X_P-C Feature FT:CDS AB670249_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcntctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggaatgggaggagttgggggaggagattaggttaaagatttatgtaa
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670252_X_P-C Feature FT:CDS AB670252_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670253_X_P-C Feature FT:CDS AB670253_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctttcgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggaattgggggaggagrwtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670254_X_P-C Feature FT:CDS AB670254_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.18). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaytaggttaatgatctttgtac
tcggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670255_X_P-C Feature FT:CDS AB670255_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.19). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670256_X_P-C Feature FT:CDS AB670256_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctrccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttatttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670258_X_P-C Feature FT:CDS AB670258_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctggtattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttgaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670259_X_P-C Feature FT:CDS AB670259_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccagtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgaacatctaccgtccccttctgcgtctgcccttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670260_X_P-C Feature FT:CDS AB670260_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670261_X_P-C Feature FT:CDS AB670261_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670262_X_P-C Feature FT:CDS AB670262_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcactgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670263_X_P-C Feature FT:CDS AB670263_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcatctaccgtccccttctacrtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaawgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670264_X_P-C Feature FT:CDS AB670264_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttctacgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670265_X_P-C Feature FT:CDS AB670265_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtcccctccttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggatcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgatcga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670266_X_P-C Feature FT:CDS AB670266_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctcttccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttatataagaggactcttggactctcagcaatgtcaacgaccta
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtaa
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670267_X_P-C Feature FT:CDS AB670267_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670268_X_P-C Feature FT:CDS AB670268_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.32). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtctygcctaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccytgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670269_X_P-C Feature FT:CDS AB670269_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttaggggaggagattaggtttaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670270_X_P-C Feature FT:CDS AB670270_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670272_X_P-C Feature FT:CDS AB670272_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|AB670273_X_P-C Feature FT:CDS AB670273_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670274_X_P-C Feature FT:CDS AB670274_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670276_X_P-C Feature FT:CDS AB670276_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagrtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670277_X_P-C Feature FT:CDS AB670277_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670278_X_P-C Feature FT:CDS AB670278_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgatgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatatttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670279_X_P-C Feature FT:CDS AB670279_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatccttcgcgggacgtcatttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaycgtccccttcttcrtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670281_X_P-C Feature FT:CDS AB670281_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttayataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670282_X_P-C Feature FT:CDS AB670282_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgattcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670283_X_P-C Feature FT:CDS AB670283_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670287_X_P-C Feature FT:CDS AB670287_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttggggctctaccgtccccttctgcgtctaccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670288_X_P-C Feature FT:CDS AB670288_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.15). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670289_X_P-C Feature FT:CDS AB670289_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670290_X_P-C Feature FT:CDS AB670290_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaagcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgacctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670291_X_P-C Feature FT:CDS AB670291_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670292_X_P-C Feature FT:CDS AB670292_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtatccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
acccccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttatttaaagactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670294_X_P-C Feature FT:CDS AB670294_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.21). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttggggctctaccgtccccttctgcgtctaccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670295_X_P-C Feature FT:CDS AB670295_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcacctgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670297_X_P-C Feature FT:CDS AB670297_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670298_X_P-C Feature FT:CDS AB670298_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcatctatcgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtagaatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagagaactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcacaaacaccattcaactttttcacctctgcctaa
>gnl|hbvcds|AB670300_X_P-C Feature FT:CDS AB670300_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgcctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670301_X_P-C Feature FT:CDS AB670301_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctcttccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgaccta
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtaa
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670302_X_P-C Feature FT:CDS AB670302_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670304_X_P-C Feature FT:CDS AB670304_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.31). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtatacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcctaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670305_X_P-C Feature FT:CDS AB670305_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccntctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtgttgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggaacttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670306_X_P-C Feature FT:CDS AB670306_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaargactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670307_X_P-C Feature FT:CDS AB670307_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.34). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670308_X_P-C Feature FT:CDS AB670308_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.35). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattccgttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670309_X_P-C Feature FT:CDS AB670309_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.36). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacatccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670310_X_P-C Feature FT:CDS AB670310_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttatttaaggactgggaggagttgggggaggagtttaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB670311_X_P-C Feature FT:CDS AB670311_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcccctccttcagctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB675674_X_P-C Feature FT:CDS AB675674_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttggggctctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB675675_X_P-C Feature FT:CDS AB675675_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttggggctctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB675677_X_P-C Feature FT:CDS AB675677_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A39). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggatctaccgtccccttcttcacctgccgttccggccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697490_X_P-C Feature FT:CDS AB697490_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697494_X_P-C Feature FT:CDS AB697494_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No9). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgtacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccacaaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697500_X_P-C Feature FT:CDS AB697500_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcacctgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697502_X_P-C Feature FT:CDS AB697502_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgtacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcycagcaatgtcaacgaccga
ccttgaggcatatttcaaagactgtttgtttaaggactgggaggagttrggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697510_X_P-C Feature FT:CDS AB697510_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgcygggccgtgtgcacttcgcttcacctctgcacgtcgaatggcg
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccattcaactttttcacctctgcctaa
>gnl|hbvcds|AB900099_X_P-C Feature FT:CDS AB900099_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcag
acgacccgtctcggggccgtttgggactcttccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggaattgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB900109_X_P-C Feature FT:CDS AB900109_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggcatctatcgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB900113_X_P-C Feature FT:CDS AB900113_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggcctctatcgtccccttctacatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacatacgcggactcttggactctcagcgatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB900115_X_P-C Feature FT:CDS AB900115_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgatgaatcccgcgg
acgacccgtcgcggggccgtttgggcctctatcgtccccttcttcagctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttaggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtccgttcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB900116_X_P-C Feature FT:CDS AB900116_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB931170_X_P-C Feature FT:CDS AB931170_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2P_HB11-0921). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctatcgtccccttctacatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcaacgatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttgaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB931171_X_P-C Feature FT:CDS AB931171_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2S_HB11-0922). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctatcgtccccttctacatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcaacgatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttgaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB971714_X_P-C Feature FT:CDS AB971714_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB11-1026). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagccatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB971715_X_P-C Feature FT:CDS AB971715_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB11-1027). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagccatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF068756_X_P-C Feature FT:CDS AF068756_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccttcggcgctgaatcccgcgg
acgacccatctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattcggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF182802_X_P-C Feature FT:CDS AF182802_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttggac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF182803_X_P-C Feature FT:CDS AF182803_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtggtgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcacagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF182804_X_P-C Feature FT:CDS AF182804_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgtctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcgatgtcaacgaccga
ccttgaggcatacttcagagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF182805_X_P-C Feature FT:CDS AF182805_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF223954_X_P-C Feature FT:CDS AF223954_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagtcgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF223955_X_P-C Feature FT:CDS AF223955_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF223956_X_P-C Feature FT:CDS AF223956_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggaatgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF223957_X_P-C Feature FT:CDS AF223957_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF223958_X_P-C Feature FT:CDS AF223958_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaatgactga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF223959_X_P-C Feature FT:CDS AF223959_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF223960_X_P-C Feature FT:CDS AF223960_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF223961_X_P-C Feature FT:CDS AF223961_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagrttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF241410_X_P-C Feature FT:CDS AF241410_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 3270). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccaaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcactgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF241411_X_P-C Feature FT:CDS AF241411_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8290). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgcttgggactctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccaatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tcggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF286594_X_P-C Feature FT:CDS AF286594_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggagaagattaggttaaaggtctttggac
taggaggctgtaggcataaattggtctgtgccccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF324347_X_P-C Feature FT:CDS AF324347_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF325199_X_P-C Feature FT:CDS AF325199_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF325700_X_P-C Feature FT:CDS AF325700_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF325701_X_P-C Feature FT:CDS AF325701_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgcac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF326585_X_P-C Feature FT:CDS AF326585_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtcattgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF326586_X_P-C Feature FT:CDS AF326586_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtcggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF326587_X_P-C Feature FT:CDS AF326587_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgttgaaagactgggaggagttgggggaggagattaggctaaaggtcattgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF355779_X_P-C Feature FT:CDS AF355779_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgactga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF355785_X_P-C Feature FT:CDS AF355785_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgttcgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF363961_X_P-C Feature FT:CDS AF363961_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF384364_X_P-C Feature FT:CDS AF384364_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate XC-86-3). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccagctggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF384365_X_P-C Feature FT:CDS AF384365_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate XC-86-4). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtggacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF384366_X_P-C Feature FT:CDS AF384366_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate XC-86-5). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggctgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF384367_X_P-C Feature FT:CDS AF384367_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate XC-86-6). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaccaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF384371_X_P-C Feature FT:CDS AF384371_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G376-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF384372_X_P-C Feature FT:CDS AF384372_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G376-A6). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcag
acgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttggggggggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF411408_X_P-C Feature FT:CDS AF411408_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcccaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF411410_X_P-C Feature FT:CDS AF411410_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttggggctctaccgtccccttcttcgtctgccgttccacccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacctggtattgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaaggctgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AF411411_X_P-C Feature FT:CDS AF411411_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcccaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF411412_X_P-C Feature FT:CDS AF411412_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactttcccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF458664_X_P-C Feature FT:CDS AF458664_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C84). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF458665_X_P-C Feature FT:CDS AF458665_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C733). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagtctaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF461357_X_P-C Feature FT:CDS AF461357_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF461358_X_P-C Feature FT:CDS AF461358_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH8). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgcctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF461359_X_P-C Feature FT:CDS AF461359_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate c16). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF461363_X_P-C Feature FT:CDS AF461363_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF473543_X_P-C Feature FT:CDS AF473543_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2e). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttggggaaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF533983_X_P-C Feature FT:CDS AF533983_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ748098_X_P-C Feature FT:CDS AJ748098_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient Z1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtcgcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011097_X_P-C Feature FT:CDS AP011097_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011098_X_P-C Feature FT:CDS AP011098_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011099_X_P-C Feature FT:CDS AP011099_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgggggcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011100_X_P-C Feature FT:CDS AP011100_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011101_X_P-C Feature FT:CDS AP011101_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgacccgtctcgggggcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011106_X_P-C Feature FT:CDS AP011106_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtattcaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011107_X_P-C Feature FT:CDS AP011107_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY028298_X_P-C Feature FT:CDS AY028298_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate X845-6). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY028299_X_P-C Feature FT:CDS AY028299_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate X845-5). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY028303_X_P-C Feature FT:CDS AY028303_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate XX16-3). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgaggacgtttggggctctaccgtccccttctgtgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY028593_X_P-C Feature FT:CDS AY028593_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate X30-7). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctatcgtccccctctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttagactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY028597_X_P-C Feature FT:CDS AY028597_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate X30-9). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY057947_X_P-C Feature FT:CDS AY057947_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Tibet705). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggca
accaccgtgaacacccgccaggtcttgcccaaggtcttacataagaggactcttgcactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctgtgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY066028_X_P-C Feature FT:CDS AY066028_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggactttaccgtccccttcttcatctgccgttccggcccaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY167090_X_P-C Feature FT:CDS AY167090_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattatgttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY167092_X_P-C Feature FT:CDS AY167092_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Id). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtcttcgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY167096_X_P-C Feature FT:CDS AY167096_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IIIa). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY167099_X_P-C Feature FT:CDS AY167099_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IVb). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatccagcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatggtctttgtac
tgggaggctgtacgcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206376_X_P-C Feature FT:CDS AY206376_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttggggctctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206378_X_P-C Feature FT:CDS AY206378_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206379_X_P-C Feature FT:CDS AY206379_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttggggctctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206381_X_P-C Feature FT:CDS AY206381_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206382_X_P-C Feature FT:CDS AY206382_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206384_X_P-C Feature FT:CDS AY206384_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206385_X_P-C Feature FT:CDS AY206385_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggcctctatcgtccccttctgcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206386_X_P-C Feature FT:CDS AY206386_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggcctctctcgtccccttctgcatctgccgttccggccgcccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206388_X_P-C Feature FT:CDS AY206388_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctggggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206389_X_P-C Feature FT:CDS AY206389_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcttctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgcaggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206392_X_P-C Feature FT:CDS AY206392_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaataggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY220699_X_P-C Feature FT:CDS AY220699_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY220700_X_P-C Feature FT:CDS AY220700_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY220701_X_P-C Feature FT:CDS AY220701_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtcctcttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY220702_X_P-C Feature FT:CDS AY220702_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY247031_X_P-C Feature FT:CDS AY247031_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUHB84). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgcttgggactctaccgtccccttcttctactgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY247032_X_P-C Feature FT:CDS AY247032_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUHB95). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcgccaggtcttgcccaaggtcttacataagaggactcttggactctcagccatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcacctgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY251132_X_P-C Feature FT:CDS AY251132_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate mutant 470). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgccctccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY251134_X_P-C Feature FT:CDS AY251134_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate mutant 473). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggggtctaccgtccccttctttgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY251135_X_P-C Feature FT:CDS AY251135_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate mutant 474). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctatgctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggatctaccgtccccttctttgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY251137_X_P-C Feature FT:CDS AY251137_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate mutant 477). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttggggctctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgtccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaacttttttacctctgcctaa
>gnl|hbvcds|AY251140_X_P-C Feature FT:CDS AY251140_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate mutant 480). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagactaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY251141_X_P-C Feature FT:CDS AY251141_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate mutant 482). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacaggtcttgcccaaggtcttgcataagaggactcttggactctcggcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtattcaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY251142_X_P-C Feature FT:CDS AY251142_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate mutant 483). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggaaattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY306136_X_P-C Feature FT:CDS AY306136_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H85). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgtacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY308741_X_P-C Feature FT:CDS AY308741_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagctgggggaggagattaggttaaagatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY311588_X_P-C Feature FT:CDS AY311588_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC-isolate 11). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgaatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY596107_X_P-C Feature FT:CDS AY596107_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib-1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactgtgagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY596108_X_P-C Feature FT:CDS AY596108_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY641558_X_P-C Feature FT:CDS AY641558_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He74). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgcaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY641559_X_P-C Feature FT:CDS AY641559_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He53). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccatccggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY641560_X_P-C Feature FT:CDS AY641560_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He100). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcactgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaccaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY641561_X_P-C Feature FT:CDS AY641561_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He127). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgactacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY641562_X_P-C Feature FT:CDS AY641562_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He82). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY641563_X_P-C Feature FT:CDS AY641563_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He52). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY862869_X_P-C Feature FT:CDS AY862869_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H8). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgtctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D00630_X_P-C Feature FT:CDS D00630_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcgcctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatatttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D12980_X_P-C Feature FT:CDS D12980_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcctaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D23681_X_P-C Feature FT:CDS D23681_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C4-HBVST2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
acctccgtgaacgcccaccaagtcttgcccaaggtcttatataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D23682_X_P-C Feature FT:CDS D23682_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B5-HBVKO1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D23683_X_P-C Feature FT:CDS D23683_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C5-HBVKO2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatcccggggtcgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D23684_X_P-C Feature FT:CDS D23684_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C6-TKB588). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttaggtctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatactttaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D28880_X_P-C Feature FT:CDS D28880_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Plasma 1992-085-9434). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acaacccgtctcggggccgtttgggactctaccgtccccttcttcgcctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D50517_X_P-C Feature FT:CDS D50517_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D50518_X_P-C Feature FT:CDS D50518_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D50519_X_P-C Feature FT:CDS D50519_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgaatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D50520_X_P-C Feature FT:CDS D50520_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089756_X_P-C Feature FT:CDS DQ089756_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK75). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|DQ089757_X_P-C Feature FT:CDS DQ089757_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2342). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaataggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089758_X_P-C Feature FT:CDS DQ089758_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1733). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaagtcttgcccaaggtcttacataagaggactcttggactctcaacaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|DQ089759_X_P-C Feature FT:CDS DQ089759_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1512). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
tgggaggctgtagttataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089760_X_P-C Feature FT:CDS DQ089760_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK454). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089761_X_P-C Feature FT:CDS DQ089761_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK515). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgcccactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgacaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089762_X_P-C Feature FT:CDS DQ089762_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1644). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaycgtccccttcttcgtctgccgttccgsccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089763_X_P-C Feature FT:CDS DQ089763_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1048). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089764_X_P-C Feature FT:CDS DQ089764_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK967). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccagacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089765_X_P-C Feature FT:CDS DQ089765_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK428). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgactacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089766_X_P-C Feature FT:CDS DQ089766_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK553). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagcttagattaaagacctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089767_X_P-C Feature FT:CDS DQ089767_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1663). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgtttcggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089768_X_P-C Feature FT:CDS DQ089768_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1814). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccgacaagtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaagatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagaaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089769_X_P-C Feature FT:CDS DQ089769_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK430). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089770_X_P-C Feature FT:CDS DQ089770_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1272). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089771_X_P-C Feature FT:CDS DQ089771_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1629). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgtccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089772_X_P-C Feature FT:CDS DQ089772_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK910). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089773_X_P-C Feature FT:CDS DQ089773_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1193). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089775_X_P-C Feature FT:CDS DQ089775_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK290). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggccttgcctaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089776_X_P-C Feature FT:CDS DQ089776_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK884). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089777_X_P-C Feature FT:CDS DQ089777_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1159). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtccgcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcctggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggarttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089778_X_P-C Feature FT:CDS DQ089778_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1442). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggatgataagagattaatgatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089779_X_P-C Feature FT:CDS DQ089779_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK554). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttkgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089780_X_P-C Feature FT:CDS DQ089780_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK947). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataaaaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089781_X_P-C Feature FT:CDS DQ089781_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1476). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|DQ089782_X_P-C Feature FT:CDS DQ089782_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2032). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089783_X_P-C Feature FT:CDS DQ089783_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1402). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggactctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089784_X_P-C Feature FT:CDS DQ089784_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1285). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactcggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089785_X_P-C Feature FT:CDS DQ089785_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1386). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctcaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089786_X_P-C Feature FT:CDS DQ089786_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2074). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccrtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089787_X_P-C Feature FT:CDS DQ089787_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK352). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttgtactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089788_X_P-C Feature FT:CDS DQ089788_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK820). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089789_X_P-C Feature FT:CDS DQ089789_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK926). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaawgatctatgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089790_X_P-C Feature FT:CDS DQ089790_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1248). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatmctgcgcgggacgtcctttgtytacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtctgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccgccaggtcttgcctaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggatttgggggaggagattagcttaatgatctttgtac
taggagactgtaggcataaattgttctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089791_X_P-C Feature FT:CDS DQ089791_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1205). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089792_X_P-C Feature FT:CDS DQ089792_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK870). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagtctaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089793_X_P-C Feature FT:CDS DQ089793_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK343). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtcctcttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089794_X_P-C Feature FT:CDS DQ089794_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1896). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcctcttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttcacatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggaattgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089795_X_P-C Feature FT:CDS DQ089795_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1465). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089796_X_P-C Feature FT:CDS DQ089796_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK751). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089797_X_P-C Feature FT:CDS DQ089797_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1169). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctggtagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcccctccttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagagggctcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089799_X_P-C Feature FT:CDS DQ089799_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK734). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089800_X_P-C Feature FT:CDS DQ089800_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK741). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcgacactgaatcctgcgg
acgacccctcacggggccgcttgggactctaccgtccccttcttcatctgccgttccggccgtccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089801_X_P-C Feature FT:CDS DQ089801_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2100). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggcctctatcgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcccgtcgcatggcg
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccascaccatgcaactttttcacctctggctaa
>gnl|hbvcds|DQ089802_X_P-C Feature FT:CDS DQ089802_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1371). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccgcggccgtttgggcctctatcgtccccttctacatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089803_X_P-C Feature FT:CDS DQ089803_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK931). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattcggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ089804_X_P-C Feature FT:CDS DQ089804_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK262). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttggggctctaccgtccccttctgcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttactgactgggaggagttgggggaggagatgaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ246215_X_P-C Feature FT:CDS DQ246215_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GZ-DYH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaagtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcactcctgcctaa
>gnl|hbvcds|DQ315781_X_P-C Feature FT:CDS DQ315781_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI0398). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ315782_X_P-C Feature FT:CDS DQ315782_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI0423). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ315783_X_P-C Feature FT:CDS DQ315783_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI03188). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ361534_X_P-C Feature FT:CDS DQ361534_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CR-081). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactctcggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggaaaccaggttaatgatttttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ377160_X_P-C Feature FT:CDS DQ377160_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT16). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttctggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgcgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ377161_X_P-C Feature FT:CDS DQ377161_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ377162_X_P-C Feature FT:CDS DQ377162_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ377163_X_P-C Feature FT:CDS DQ377163_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ377164_X_P-C Feature FT:CDS DQ377164_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ377165_X_P-C Feature FT:CDS DQ377165_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ478885_X_P-C Feature FT:CDS DQ478885_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-D12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ478899_X_P-C Feature FT:CDS DQ478899_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-D20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ478900_X_P-C Feature FT:CDS DQ478900_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-H172). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ478901_X_P-C Feature FT:CDS DQ478901_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-H155). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccgtctcagggccgtttgggactctaccgtccccctcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ536410_X_P-C Feature FT:CDS DQ536410_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtcccctgctccatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccatgaacgcccatctggtcttgcccaaggtcttacatcagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ536411_X_P-C Feature FT:CDS DQ536411_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtcccctgctccatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccatgaacgcccatctggtcttgcccaaggtcttacatcagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ536412_X_P-C Feature FT:CDS DQ536412_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtcccctgctccatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccatgaacgcccatctggtcttgcccaaggtcttacatcagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ536413_X_P-C Feature FT:CDS DQ536413_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtcccctgctccatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccatgaacgcccatctggtcttgcccaaggtcttacatcagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcacctttttcacctctgcctaa
>gnl|hbvcds|DQ536414_X_P-C Feature FT:CDS DQ536414_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtcccctgctccatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccatgaacgcccatctggtcttgcccaaggtcttacatcagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcacctttttcacctctgcctaa
>gnl|hbvcds|DQ683578_X_P-C Feature FT:CDS DQ683578_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccatcaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ788835_X_P-C Feature FT:CDS DQ788835_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ890381_X_P-C Feature FT:CDS DQ890381_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctggggtgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccacccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ922649_X_P-C Feature FT:CDS DQ922649_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggagctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcacagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ922650_X_P-C Feature FT:CDS DQ922650_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtccgctctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ922651_X_P-C Feature FT:CDS DQ922651_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgggggcgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcg
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ975272_X_P-C Feature FT:CDS DQ975272_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atgactgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactttaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttcacatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
gccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ975273_X_P-C Feature FT:CDS DQ975273_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accgccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ975274_X_P-C Feature FT:CDS DQ975274_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccggggccgtttgggactctaccgtccccttcttcatttgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ980547_X_P-C Feature FT:CDS DQ980547_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggagctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtagcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ980549_X_P-C Feature FT:CDS DQ980549_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggctaaaggtctctgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ980550_X_P-C Feature FT:CDS DQ980550_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accgccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ980551_X_P-C Feature FT:CDS DQ980551_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctaccaactggatcctgcgcgggacgtcctttgtcaacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttactctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ986375_X_P-C Feature FT:CDS DQ986375_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggtcggttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ986376_X_P-C Feature FT:CDS DQ986376_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccggggccgtttgggaatctaccgtccccttcttcgtctgccgtaccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaccaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993181_X_P-C Feature FT:CDS DQ993181_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtcctcttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatggaactttttcacctctgcctaa
>gnl|hbvcds|DQ993690_X_P-C Feature FT:CDS DQ993690_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 204-1113-Nature1.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993691_X_P-C Feature FT:CDS DQ993691_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4007-0803-Nature2.2-unSero). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993692_X_P-C Feature FT:CDS DQ993692_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4007-0810-Nature2.1-unSero). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993693_X_P-C Feature FT:CDS DQ993693_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 232-1125-Nature1.1-unSero). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF137802_X_P-C Feature FT:CDS EF137802_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accgccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF137803_X_P-C Feature FT:CDS EF137803_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accgccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF197911_X_P-C Feature FT:CDS EF197911_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgacaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF384201_X_P-C Feature FT:CDS EF384201_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CUIT-02). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcycagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF384205_X_P-C Feature FT:CDS EF384205_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CUIT-06). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF394328_X_P-C Feature FT:CDS EF394328_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CUIT-8). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF494377_X_P-C Feature FT:CDS EF494377_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TW1138). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggcctctatcgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgaatggcg
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF494379_X_P-C Feature FT:CDS EF494379_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TW8585). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttacagactgggaggagttgggggaggagactagattaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF536065_X_P-C Feature FT:CDS EF536065_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF536066_X_P-C Feature FT:CDS EF536066_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccgggcgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594748_X_P-C Feature FT:CDS EF594748_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01343). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatccagcgg
acgacccctctcggggccgtttggggctctaccgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594749_X_P-C Feature FT:CDS EF594749_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 02460). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594750_X_P-C Feature FT:CDS EF594750_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 02461). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctaccgtccccttcttcatctgccgtttcgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594751_X_P-C Feature FT:CDS EF594751_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 04240). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactgtaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594752_X_P-C Feature FT:CDS EF594752_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 02469). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594753_X_P-C Feature FT:CDS EF594753_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 0334). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtctttcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594754_X_P-C Feature FT:CDS EF594754_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 0340). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594755_X_P-C Feature FT:CDS EF594755_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 0339). Partial genome (Contains: HBe, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccacttcttgcccaaggtcttacataagaggactcttggactctcagcaatgtaaacgaccga
ccttgaggcatacttccaagactgtttatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594758_X_P-C Feature FT:CDS EF594758_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 03184). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594760_X_P-C Feature FT:CDS EF594760_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 04703). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594763_X_P-C Feature FT:CDS EF594763_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 05147). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594764_X_P-C Feature FT:CDS EF594764_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 04721). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctacacggtgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594766_X_P-C Feature FT:CDS EF594766_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 0319). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctatatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594767_X_P-C Feature FT:CDS EF594767_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 0329). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atgtctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccgaggccgctggggactgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccttcaggtcttgcccaaggtcttacataagaagactcttggactctcagcaatgtcaacgaccga
ccttgaagcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggaaactagtttaatgatctttgtat
tgggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594768_X_P-C Feature FT:CDS EF594768_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 04717). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgagccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF594769_X_P-C Feature FT:CDS EF594769_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 04718). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
aagagccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaagttcttacataagaggactcttggactctcagcgatgtcaaagaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF688062_X_P-C Feature FT:CDS EF688062_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GZ28-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU305540_X_P-C Feature FT:CDS EU305540_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-123). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcacggag
accaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcctggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU305541_X_P-C Feature FT:CDS EU305541_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-190). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tggggggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU305542_X_P-C Feature FT:CDS EU305542_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-1251). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306671_X_P-C Feature FT:CDS EU306671_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttctccgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcggcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttacagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306672_X_P-C Feature FT:CDS EU306672_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttctccgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaggtctcgcccaaggtcttgcataagaggactcttggactctcggcgacgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttacagactgggaggagttgggggaggagtttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306673_X_P-C Feature FT:CDS EU306673_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306676_X_P-C Feature FT:CDS EU306676_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctcttctttc
>gnl|hbvcds|EU306685_X_P-C Feature FT:CDS EU306685_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306687_X_P-C Feature FT:CDS EU306687_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306688_X_P-C Feature FT:CDS EU306688_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306689_X_P-C Feature FT:CDS EU306689_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306690_X_P-C Feature FT:CDS EU306690_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggccgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306691_X_P-C Feature FT:CDS EU306691_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306713_X_P-C Feature FT:CDS EU306713_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcaactgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306714_X_P-C Feature FT:CDS EU306714_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306719_X_P-C Feature FT:CDS EU306719_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306720_X_P-C Feature FT:CDS EU306720_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306721_X_P-C Feature FT:CDS EU306721_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306722_X_P-C Feature FT:CDS EU306722_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306724_X_P-C Feature FT:CDS EU306724_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306725_X_P-C Feature FT:CDS EU306725_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttggggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306726_X_P-C Feature FT:CDS EU306726_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306727_X_P-C Feature FT:CDS EU306727_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306728_X_P-C Feature FT:CDS EU306728_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306729_X_P-C Feature FT:CDS EU306729_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU410079_X_P-C Feature FT:CDS EU410079_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph109). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataaacggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcwactttttcacctctgcctaa
>gnl|hbvcds|EU410080_X_P-C Feature FT:CDS EU410080_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph76). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggmgctgaatcccgcgg
acgacccgtcgcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU410081_X_P-C Feature FT:CDS EU410081_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph80). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgggggcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagtaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU439005_X_P-C Feature FT:CDS EU439005_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttggggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU439009_X_P-C Feature FT:CDS EU439009_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
cttcacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU439010_X_P-C Feature FT:CDS EU439010_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtggacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU439011_X_P-C Feature FT:CDS EU439011_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU439012_X_P-C Feature FT:CDS EU439012_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU439013_X_P-C Feature FT:CDS EU439013_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU439014_X_P-C Feature FT:CDS EU439014_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU439015_X_P-C Feature FT:CDS EU439015_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccacctggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctgccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU439016_X_P-C Feature FT:CDS EU439016_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccaggcaactttttcacctctgcctaa
>gnl|hbvcds|EU439025_X_P-C Feature FT:CDS EU439025_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgttcgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU498227_X_P-C Feature FT:CDS EU498227_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JL). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactttaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcagagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU522068_X_P-C Feature FT:CDS EU522068_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 5N). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU522069_X_P-C Feature FT:CDS EU522069_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 5T). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacatccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU522071_X_P-C Feature FT:CDS EU522071_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 7T). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggcatctatcgtccccttctgtctctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccgg
ccttgaggcgtacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU547559_X_P-C Feature FT:CDS EU547559_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MC02). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaayccagcgg
acgacccgtctcggggccgtttgggaatctaccgtccccttcttygtctgccgttccggccgaccacgggacgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcg
accaccgtgaacgcccaccaggtattgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttctcccccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU547562_X_P-C Feature FT:CDS EU547562_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MC05). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtcccctccttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU554535_X_P-C Feature FT:CDS EU554535_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S472-20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgacccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatttgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggacccttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU554536_X_P-C Feature FT:CDS EU554536_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S472-24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgagcgcccaccaggtcttgcccaaggtcttacataagaggacccttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU554537_X_P-C Feature FT:CDS EU554537_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU554538_X_P-C Feature FT:CDS EU554538_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctccatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU554539_X_P-C Feature FT:CDS EU554539_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU554540_X_P-C Feature FT:CDS EU554540_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S304-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU554541_X_P-C Feature FT:CDS EU554541_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S696-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatacaagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagatcaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU554542_X_P-C Feature FT:CDS EU554542_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S696-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatacaagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagatcaggttaatgatttttgtac
tagggggctgtaggcataaattggtctgttcgccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU560438_X_P-C Feature FT:CDS EU560438_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2-B74). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctaccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttgggtctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgcgtttaaagactgggaggagtcgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU560439_X_P-C Feature FT:CDS EU560439_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7-B74). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttgggtctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU560440_X_P-C Feature FT:CDS EU560440_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1-S869). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctccgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU560441_X_P-C Feature FT:CDS EU560441_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4-S869). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU562215_X_P-C Feature FT:CDS EU562215_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccggggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU562216_X_P-C Feature FT:CDS EU562216_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 13). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccggggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU562217_X_P-C Feature FT:CDS EU562217_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccggagccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU562218_X_P-C Feature FT:CDS EU562218_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU570067_X_P-C Feature FT:CDS EU570067_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18-S541). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgctccacctctgcacgtcgcatggag
accaccgtgaacacccgcctggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU570068_X_P-C Feature FT:CDS EU570068_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26-S541). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcctggag
accaccgtgaacacccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU570072_X_P-C Feature FT:CDS EU570072_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1-B74). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggaccctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtttcggggccgtttgggtctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU570073_X_P-C Feature FT:CDS EU570073_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8-S698). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU570074_X_P-C Feature FT:CDS EU570074_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 11-S698). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU579442_X_P-C Feature FT:CDS EU579442_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU579443_X_P-C Feature FT:CDS EU579443_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcag
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataaaaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU589336_X_P-C Feature FT:CDS EU589336_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1175-1). Complete genome. [Hepadnaviridae] (length=462 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU589340_X_P-C Feature FT:CDS EU589340_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S852-7). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgatccctctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU589341_X_P-C Feature FT:CDS EU589341_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S852-10). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgatccctctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctcttcctaa
>gnl|hbvcds|EU589342_X_P-C Feature FT:CDS EU589342_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S852-13). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgatccctctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU589344_X_P-C Feature FT:CDS EU589344_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S624-1). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctatcaggtgttgcccaaggtcttacataagaggactcttggactcccagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaaaactgaaaagagttgggggaggagattaggttaaaggtctttgtac
taagaggctataggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU589345_X_P-C Feature FT:CDS EU589345_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S624-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtgttgcccaaggtcttacataagaggactcttggactcccagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU670263_X_P-C Feature FT:CDS EU670263_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph105). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttcacatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU717212_X_P-C Feature FT:CDS EU717212_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D26K-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU717214_X_P-C Feature FT:CDS EU717214_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G62K-8). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcctgccaggtcttgcctaaggtcttatataagaggactctcggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU717215_X_P-C Feature FT:CDS EU717215_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Q67K-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgttgaatcccgcgg
acgacccgtctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgcgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU717217_X_P-C Feature FT:CDS EU717217_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Q53K-4). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgcctgccgtttcggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgactga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU717218_X_P-C Feature FT:CDS EU717218_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 107-3/C8). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU796069_X_P-C Feature FT:CDS EU796069_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU796070_X_P-C Feature FT:CDS EU796070_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgcccccttcttcatctgccgttccggcccaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactaggtcttgcccaaggtcttatataaggggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU796072_X_P-C Feature FT:CDS EU796072_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgcccccttcttcatctgccgttccggcccaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactaggtcttgcccaaggtcttatataaggggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871969_X_P-C Feature FT:CDS EU871969_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcacagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871970_X_P-C Feature FT:CDS EU871970_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccgcggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgtcggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871971_X_P-C Feature FT:CDS EU871971_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871972_X_P-C Feature FT:CDS EU871972_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871973_X_P-C Feature FT:CDS EU871973_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-99-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871974_X_P-C Feature FT:CDS EU871974_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024A-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggaccgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871975_X_P-C Feature FT:CDS EU871975_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024A-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgtaccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaccaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871976_X_P-C Feature FT:CDS EU871976_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 179-04-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871977_X_P-C Feature FT:CDS EU871977_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgtaccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaccaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871978_X_P-C Feature FT:CDS EU871978_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-95-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggaatctaccgtccccttcttcgtctgccgtaccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaccaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871979_X_P-C Feature FT:CDS EU871979_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-95-4). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggaatctaccgtccccttcttcgtctgccgtaccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accgccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaccaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871980_X_P-C Feature FT:CDS EU871980_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-01-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871982_X_P-C Feature FT:CDS EU871982_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-96-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU871998_X_P-C Feature FT:CDS EU871998_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-00-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU872000_X_P-C Feature FT:CDS EU872000_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-92-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccatctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU872001_X_P-C Feature FT:CDS EU872001_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-92-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU872002_X_P-C Feature FT:CDS EU872002_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-97-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactataccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU872003_X_P-C Feature FT:CDS EU872003_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-97-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgatcga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU872004_X_P-C Feature FT:CDS EU872004_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-97-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU872005_X_P-C Feature FT:CDS EU872005_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 179-96-1). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcctgccaggtcttgcctaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU872008_X_P-C Feature FT:CDS EU872008_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252A-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggaatctaccgtccccttcttcgtctgccgtaccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaggactgtttgtttaaggactgggaggagttgggggaggagaccaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU872012_X_P-C Feature FT:CDS EU872012_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-99-5). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatactccaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU872013_X_P-C Feature FT:CDS EU872013_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-99-6). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactggggggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU881996_X_P-C Feature FT:CDS EU881996_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU881999_X_P-C Feature FT:CDS EU881999_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient19). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU882000_X_P-C Feature FT:CDS EU882000_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient19). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU882005_X_P-C Feature FT:CDS EU882005_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient22). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctatcgtccccttctgcttctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactcccagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttagagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916210_X_P-C Feature FT:CDS EU916210_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S2.4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggagcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916211_X_P-C Feature FT:CDS EU916211_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3.1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916212_X_P-C Feature FT:CDS EU916212_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3.2). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcctcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916213_X_P-C Feature FT:CDS EU916213_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3.3). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916214_X_P-C Feature FT:CDS EU916214_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3.4). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtggtgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916215_X_P-C Feature FT:CDS EU916215_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S4.1). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcctcttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgagcgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916216_X_P-C Feature FT:CDS EU916216_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S4.2). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916217_X_P-C Feature FT:CDS EU916217_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S4.3). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggagctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916218_X_P-C Feature FT:CDS EU916218_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S4.4). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccatcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916219_X_P-C Feature FT:CDS EU916219_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S5.1). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactttgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagatttggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916222_X_P-C Feature FT:CDS EU916222_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S5.4). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
gccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916223_X_P-C Feature FT:CDS EU916223_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S6.1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916224_X_P-C Feature FT:CDS EU916224_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S6.2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccagatcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916225_X_P-C Feature FT:CDS EU916225_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S6.3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacagggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcacggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916226_X_P-C Feature FT:CDS EU916226_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S7.1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916227_X_P-C Feature FT:CDS EU916227_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S7.2). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaaaggtcttagtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916229_X_P-C Feature FT:CDS EU916229_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S7.4). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916233_X_P-C Feature FT:CDS EU916233_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT1.1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggccttacataagcggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttatttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916234_X_P-C Feature FT:CDS EU916234_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT1.2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcctcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttatttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916237_X_P-C Feature FT:CDS EU916237_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT2.2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU916238_X_P-C Feature FT:CDS EU916238_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT2.3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU919164_X_P-C Feature FT:CDS EU919164_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient24). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU919165_X_P-C Feature FT:CDS EU919165_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient24). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU919168_X_P-C Feature FT:CDS EU919168_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggacgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgacccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU919169_X_P-C Feature FT:CDS EU919169_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggacgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatacaagaggactcttggactcccaggaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939536_X_P-C Feature FT:CDS EU939536_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtaa
taggaggctgtaggcataaattggtctgttcaccagcaccatggaactttttcacctctgcctaa
>gnl|hbvcds|EU939537_X_P-C Feature FT:CDS EU939537_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C8). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|EU939538_X_P-C Feature FT:CDS EU939538_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939539_X_P-C Feature FT:CDS EU939539_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtcctcttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939540_X_P-C Feature FT:CDS EU939540_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939541_X_P-C Feature FT:CDS EU939541_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatccttcgcgggacgtcctttgtatacgtcccgtcggcgctgaatcgcgcgg
acggcccgtctcggggccgttgggggctctaccgtccccttcttcctcggccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctccacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939542_X_P-C Feature FT:CDS EU939542_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccatgaacgcccaccgggccttgcccaaggtcttacataagaggactcttggactcccagcactgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939543_X_P-C Feature FT:CDS EU939543_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctggtaggctgtgctgccaaatggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgatgaatcccgcgg
acgaccggtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939544_X_P-C Feature FT:CDS EU939544_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C39). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgccg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939545_X_P-C Feature FT:CDS EU939545_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggaatctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939546_X_P-C Feature FT:CDS EU939546_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctggtagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgatgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttcttcgccgttccggccaacctcggggcgcacctct
ctttacgcggtctccccgtctgtgccttgtcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939548_X_P-C Feature FT:CDS EU939548_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C46). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgaccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtaaagaatttatgtac
taggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939549_X_P-C Feature FT:CDS EU939549_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C49). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939550_X_P-C Feature FT:CDS EU939550_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C55). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggagggattgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939552_X_P-C Feature FT:CDS EU939552_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C57). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939553_X_P-C Feature FT:CDS EU939553_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C60). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagtaatgtcaacaaccga
ccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcactcctgcctaa
>gnl|hbvcds|EU939554_X_P-C Feature FT:CDS EU939554_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C61). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaagtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgctactttttcacctctgcctaa
>gnl|hbvcds|EU939555_X_P-C Feature FT:CDS EU939555_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C63). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939556_X_P-C Feature FT:CDS EU939556_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C64). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactattggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggaggagctgggggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939557_X_P-C Feature FT:CDS EU939557_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C65). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctgtgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939558_X_P-C Feature FT:CDS EU939558_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C66). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactattggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtcggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|EU939560_X_P-C Feature FT:CDS EU939560_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C69). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgttcattgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939561_X_P-C Feature FT:CDS EU939561_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C70). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939562_X_P-C Feature FT:CDS EU939562_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C75). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939563_X_P-C Feature FT:CDS EU939563_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939564_X_P-C Feature FT:CDS EU939564_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C77). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggtgtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939566_X_P-C Feature FT:CDS EU939566_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C88). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcctcttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939567_X_P-C Feature FT:CDS EU939567_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C91). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939568_X_P-C Feature FT:CDS EU939568_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C93). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggrctctaccgtccccttcttcatctgccgttccggccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccaggtgttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939569_X_P-C Feature FT:CDS EU939569_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C102). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939570_X_P-C Feature FT:CDS EU939570_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C103). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939571_X_P-C Feature FT:CDS EU939571_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C104). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939572_X_P-C Feature FT:CDS EU939572_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C105). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtgc
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939573_X_P-C Feature FT:CDS EU939573_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C106). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggtcgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939574_X_P-C Feature FT:CDS EU939574_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C109). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939576_X_P-C Feature FT:CDS EU939576_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C115). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939578_X_P-C Feature FT:CDS EU939578_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C119). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactttaccgtccccttcttcatctgccgttccgaccgtccacggggagaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939579_X_P-C Feature FT:CDS EU939579_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C120). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcatttgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcgacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939580_X_P-C Feature FT:CDS EU939580_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939582_X_P-C Feature FT:CDS EU939582_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939583_X_P-C Feature FT:CDS EU939583_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B31). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939584_X_P-C Feature FT:CDS EU939584_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B107). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccaacccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttcaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939585_X_P-C Feature FT:CDS EU939585_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B126). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939586_X_P-C Feature FT:CDS EU939586_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B142). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactatttatttaaaaactaagagaagttgagagaagagattaggttaataatctttatac
taagagactgtagacataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939587_X_P-C Feature FT:CDS EU939587_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939588_X_P-C Feature FT:CDS EU939588_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C173). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccgtctcggggccggttggggctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939590_X_P-C Feature FT:CDS EU939590_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C127). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939591_X_P-C Feature FT:CDS EU939591_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C131). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939592_X_P-C Feature FT:CDS EU939592_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C141). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctatgtac
taggaggctgtcggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939593_X_P-C Feature FT:CDS EU939593_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C144). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939594_X_P-C Feature FT:CDS EU939594_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C146). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
acccccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939595_X_P-C Feature FT:CDS EU939595_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C147). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttctgtctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgtccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939596_X_P-C Feature FT:CDS EU939596_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C149). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccatctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939597_X_P-C Feature FT:CDS EU939597_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C151). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttgggtctctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgttgaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tcggaggctgtaggcataaattggtctgttcaccagttccatgcaactttttcacctctgcctga
>gnl|hbvcds|EU939599_X_P-C Feature FT:CDS EU939599_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C172). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939600_X_P-C Feature FT:CDS EU939600_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C176). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939601_X_P-C Feature FT:CDS EU939601_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C177). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaagtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939603_X_P-C Feature FT:CDS EU939603_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C183). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggacgtttgggactctrccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggcattgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939604_X_P-C Feature FT:CDS EU939604_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C192). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939605_X_P-C Feature FT:CDS EU939605_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C200). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939607_X_P-C Feature FT:CDS EU939607_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C207). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttctacgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939609_X_P-C Feature FT:CDS EU939609_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C209). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactttaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactctcagccatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939610_X_P-C Feature FT:CDS EU939610_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C211). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacatcagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939611_X_P-C Feature FT:CDS EU939611_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C212). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctacatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939612_X_P-C Feature FT:CDS EU939612_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C213). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939613_X_P-C Feature FT:CDS EU939613_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C214). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939614_X_P-C Feature FT:CDS EU939614_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C217). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939615_X_P-C Feature FT:CDS EU939615_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C226). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939616_X_P-C Feature FT:CDS EU939616_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C228). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatytgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939617_X_P-C Feature FT:CDS EU939617_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C229). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccatgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939618_X_P-C Feature FT:CDS EU939618_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C230). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggtctttaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939619_X_P-C Feature FT:CDS EU939619_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C233). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccatgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939625_X_P-C Feature FT:CDS EU939625_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C167). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgtccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939626_X_P-C Feature FT:CDS EU939626_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D158). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgtccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgaaactttttcacctctgcctaa
>gnl|hbvcds|EU939640_X_P-C Feature FT:CDS EU939640_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C239). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939641_X_P-C Feature FT:CDS EU939641_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D18). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939642_X_P-C Feature FT:CDS EU939642_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D20). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgattgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939643_X_P-C Feature FT:CDS EU939643_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D32). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgtctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939644_X_P-C Feature FT:CDS EU939644_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939645_X_P-C Feature FT:CDS EU939645_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D38). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939646_X_P-C Feature FT:CDS EU939646_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D88). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccgaccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgcccaccaggtgttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|EU939647_X_P-C Feature FT:CDS EU939647_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D90). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939648_X_P-C Feature FT:CDS EU939648_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D96). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939649_X_P-C Feature FT:CDS EU939649_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D98). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcctcttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939651_X_P-C Feature FT:CDS EU939651_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D104). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939652_X_P-C Feature FT:CDS EU939652_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D107). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcctcttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939653_X_P-C Feature FT:CDS EU939653_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D109). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttggggctctaccgtccccttctgcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939654_X_P-C Feature FT:CDS EU939654_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D115). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcctcttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939655_X_P-C Feature FT:CDS EU939655_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D116). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccaccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939656_X_P-C Feature FT:CDS EU939656_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D117). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939657_X_P-C Feature FT:CDS EU939657_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D139). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939658_X_P-C Feature FT:CDS EU939658_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D142). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939659_X_P-C Feature FT:CDS EU939659_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D165). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccatcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagcggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023639_X_P-C Feature FT:CDS FJ023639_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-0968). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023640_X_P-C Feature FT:CDS FJ023640_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1206). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
trggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023641_X_P-C Feature FT:CDS FJ023641_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1237). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgcccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023642_X_P-C Feature FT:CDS FJ023642_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1257). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgcccgactacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023643_X_P-C Feature FT:CDS FJ023643_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1306). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtcgcggggccgtttgggtctctaccgtccccttcttcatctaccattccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023644_X_P-C Feature FT:CDS FJ023644_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1318). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtcgcggggccgtttgggtctctaccgtccccttcttcatctaccattccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023645_X_P-C Feature FT:CDS FJ023645_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0071). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccatcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|FJ023646_X_P-C Feature FT:CDS FJ023646_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0201). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccagccaggtcttgcccaaggtcttacataagaggactcttggactctcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023647_X_P-C Feature FT:CDS FJ023647_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0214). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023648_X_P-C Feature FT:CDS FJ023648_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0273). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactttaccgtccccttctgcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023649_X_P-C Feature FT:CDS FJ023649_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0289). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023650_X_P-C Feature FT:CDS FJ023650_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0341). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023651_X_P-C Feature FT:CDS FJ023651_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0391). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtccgcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgcccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagaatgggaggagttgggggaggagactaggttgaaggtctttgtac
tgggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023652_X_P-C Feature FT:CDS FJ023652_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0648). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttggggctctaccgtccccttctgcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtattcaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023653_X_P-C Feature FT:CDS FJ023653_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0909). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023654_X_P-C Feature FT:CDS FJ023654_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1412). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023655_X_P-C Feature FT:CDS FJ023655_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0754). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023656_X_P-C Feature FT:CDS FJ023656_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0938). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023657_X_P-C Feature FT:CDS FJ023657_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0987). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgactga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023658_X_P-C Feature FT:CDS FJ023658_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-1116). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtccgcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgcccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023677_X_P-C Feature FT:CDS FJ023677_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I1/I2_M04-0309). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacatcctttgtctacgtcccgtcggcgctgaatccagcgg
acgacccctctcggggccgcttggggatctaccgtccccttcttcgtctgccgttccggccatccacggggcgcacctct
ctttacgcggcctccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccacctgaccttgcccaaggtattgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032331_X_P-C Feature FT:CDS FJ032331_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S193-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactctttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032332_X_P-C Feature FT:CDS FJ032332_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S265-10). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032333_X_P-C Feature FT:CDS FJ032333_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S359-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagccatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032334_X_P-C Feature FT:CDS FJ032334_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S445-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcggggcgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
gcgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032336_X_P-C Feature FT:CDS FJ032336_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S462-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggaatctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032338_X_P-C Feature FT:CDS FJ032338_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S462-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggaatctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032339_X_P-C Feature FT:CDS FJ032339_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S462-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032340_X_P-C Feature FT:CDS FJ032340_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S529-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgttgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032341_X_P-C Feature FT:CDS FJ032341_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S529-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgttgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032345_X_P-C Feature FT:CDS FJ032345_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S696-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatacaagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagatcaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032346_X_P-C Feature FT:CDS FJ032346_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S732-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccggccgacctcggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032347_X_P-C Feature FT:CDS FJ032347_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S732-7). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032350_X_P-C Feature FT:CDS FJ032350_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S943-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggagctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032351_X_P-C Feature FT:CDS FJ032351_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S943-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggagctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032355_X_P-C Feature FT:CDS FJ032355_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1030-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032356_X_P-C Feature FT:CDS FJ032356_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1030-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032359_X_P-C Feature FT:CDS FJ032359_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1634-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032360_X_P-C Feature FT:CDS FJ032360_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1634-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttggggggggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032361_X_P-C Feature FT:CDS FJ032361_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1634-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggctgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ151413_X_P-C Feature FT:CDS FJ151413_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcttctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ151414_X_P-C Feature FT:CDS FJ151414_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgatgacaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349225_X_P-C Feature FT:CDS FJ349225_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H94). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattcgggtaaatgtctttgtac
tgggaggttgtccgcataaattggtctgtttaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386574_X_P-C Feature FT:CDS FJ386574_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1743). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|FJ386575_X_P-C Feature FT:CDS FJ386575_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1745). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggcccaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386576_X_P-C Feature FT:CDS FJ386576_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1746). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
acctccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386577_X_P-C Feature FT:CDS FJ386577_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1747). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386579_X_P-C Feature FT:CDS FJ386579_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1762). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactttaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactctcggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386587_X_P-C Feature FT:CDS FJ386587_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1812). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386588_X_P-C Feature FT:CDS FJ386588_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1828). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386589_X_P-C Feature FT:CDS FJ386589_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1830). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcagcgctgaacccagcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386591_X_P-C Feature FT:CDS FJ386591_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1869). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386592_X_P-C Feature FT:CDS FJ386592_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1870). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386594_X_P-C Feature FT:CDS FJ386594_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1878). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386595_X_P-C Feature FT:CDS FJ386595_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1879). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386596_X_P-C Feature FT:CDS FJ386596_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1887). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386597_X_P-C Feature FT:CDS FJ386597_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1888). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386598_X_P-C Feature FT:CDS FJ386598_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1889). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggacttgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386601_X_P-C Feature FT:CDS FJ386601_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1912). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggacccttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386602_X_P-C Feature FT:CDS FJ386602_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1914). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386603_X_P-C Feature FT:CDS FJ386603_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1949). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattatgctgtgcaccagcaccttgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386604_X_P-C Feature FT:CDS FJ386604_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1950). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaagaactgggaggagttaggggaggagagtaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386605_X_P-C Feature FT:CDS FJ386605_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1965). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtcccctcctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagaatgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386607_X_P-C Feature FT:CDS FJ386607_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1967). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386609_X_P-C Feature FT:CDS FJ386609_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1999). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
tcggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386611_X_P-C Feature FT:CDS FJ386611_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2018). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccttctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgttgaaagactgggaggagttgggggaggagaatagggcaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386612_X_P-C Feature FT:CDS FJ386612_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2019). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcctcttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcactgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386613_X_P-C Feature FT:CDS FJ386613_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2039). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttactgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386614_X_P-C Feature FT:CDS FJ386614_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2040). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386616_X_P-C Feature FT:CDS FJ386616_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2064). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcccctccttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagagtgggaggagttgggggaggagattaggctaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386617_X_P-C Feature FT:CDS FJ386617_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2093). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagccccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386618_X_P-C Feature FT:CDS FJ386618_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2111). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagagaactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattacgttaatactctgtggac
taagaggctgtaggaataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386619_X_P-C Feature FT:CDS FJ386619_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2119). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagagaactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386620_X_P-C Feature FT:CDS FJ386620_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2121). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386621_X_P-C Feature FT:CDS FJ386621_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2123). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggca
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386623_X_P-C Feature FT:CDS FJ386623_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2165). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386624_X_P-C Feature FT:CDS FJ386624_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2187). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttggggctctatcgtcccctgcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagaatgggaggagttgggggaggagattaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386625_X_P-C Feature FT:CDS FJ386625_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2190). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386626_X_P-C Feature FT:CDS FJ386626_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2205). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386627_X_P-C Feature FT:CDS FJ386627_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2242). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgrccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacmaggtcttgcccaaggtcttayataagaggactcttggactctccacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386628_X_P-C Feature FT:CDS FJ386628_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2255). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcactgaatcccgcgg
acgacccgtctcgcggccgtttgggactctaccgtccccttctgcacctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386629_X_P-C Feature FT:CDS FJ386629_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2286). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386630_X_P-C Feature FT:CDS FJ386630_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2336). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386631_X_P-C Feature FT:CDS FJ386631_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2359). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttryataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386632_X_P-C Feature FT:CDS FJ386632_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2370). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttacggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386637_X_P-C Feature FT:CDS FJ386637_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2151). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcccctccttcttctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386638_X_P-C Feature FT:CDS FJ386638_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2015). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtcctcttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggwctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386639_X_P-C Feature FT:CDS FJ386639_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1929). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaawgrtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386640_X_P-C Feature FT:CDS FJ386640_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2168). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctaccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggatgttgcccaaggtcttatataatcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386641_X_P-C Feature FT:CDS FJ386641_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2236). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386644_X_P-C Feature FT:CDS FJ386644_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S737). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtga
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaaatttttcacctttgcttaa
>gnl|hbvcds|FJ386645_X_P-C Feature FT:CDS FJ386645_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S897). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386647_X_P-C Feature FT:CDS FJ386647_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2400). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgccctccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386650_X_P-C Feature FT:CDS FJ386650_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2468). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtgttgcccaaggtcttacataaaaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttttgtac
taggagactgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctac
>gnl|hbvcds|FJ386651_X_P-C Feature FT:CDS FJ386651_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2476). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggccctgaatcccgcgg
acgacccgtcccgcggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386652_X_P-C Feature FT:CDS FJ386652_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2518). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386653_X_P-C Feature FT:CDS FJ386653_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386657_X_P-C Feature FT:CDS FJ386657_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S165). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386659_X_P-C Feature FT:CDS FJ386659_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S219). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386661_X_P-C Feature FT:CDS FJ386661_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S251). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386662_X_P-C Feature FT:CDS FJ386662_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S269). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcacctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactctcggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386663_X_P-C Feature FT:CDS FJ386663_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S307). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386664_X_P-C Feature FT:CDS FJ386664_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S310). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtctgggactctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaagatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386665_X_P-C Feature FT:CDS FJ386665_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S359). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagccatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386667_X_P-C Feature FT:CDS FJ386667_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S379). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386670_X_P-C Feature FT:CDS FJ386670_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S454). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaccaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386671_X_P-C Feature FT:CDS FJ386671_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S586). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtgc
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386672_X_P-C Feature FT:CDS FJ386672_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S606). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccttctcggggccgtttgggcctctatcgtccccttctgcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386673_X_P-C Feature FT:CDS FJ386673_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S633). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386677_X_P-C Feature FT:CDS FJ386677_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1104). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataataggactcttggactcccagcaatgtcaacgaccga
ccttgasgcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386678_X_P-C Feature FT:CDS FJ386678_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1147). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttggggctctatcgtccccttcttcctctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386679_X_P-C Feature FT:CDS FJ386679_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1217). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactttaccgtcctcttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386685_X_P-C Feature FT:CDS FJ386685_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1568). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386687_X_P-C Feature FT:CDS FJ386687_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1600). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggwctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386689_X_P-C Feature FT:CDS FJ386689_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1649). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcatttatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggttaatgatctwtgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ518810_X_P-C Feature FT:CDS FJ518810_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttctacatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccctccaggtcttgcccaaggtcttacataagaggactctcggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ518813_X_P-C Feature FT:CDS FJ518813_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562218_X_P-C Feature FT:CDS FJ562218_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttctgcttctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562220_X_P-C Feature FT:CDS FJ562220_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I12). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctaccgtccccttctgcatctaccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagagractcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562221_X_P-C Feature FT:CDS FJ562221_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggaattgggggaggagaataggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562225_X_P-C Feature FT:CDS FJ562225_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562228_X_P-C Feature FT:CDS FJ562228_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctgtatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562232_X_P-C Feature FT:CDS FJ562232_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562233_X_P-C Feature FT:CDS FJ562233_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562235_X_P-C Feature FT:CDS FJ562235_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I50). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcgtcgctgaatcccgcgg
acgacccatcgcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562238_X_P-C Feature FT:CDS FJ562238_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I62). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgatgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactgtcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562239_X_P-C Feature FT:CDS FJ562239_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I64). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562241_X_P-C Feature FT:CDS FJ562241_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I67). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaacgactgggaggagttgggggaggagattaggttacaggtctttggac
tatcaggctgtaggcatacattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562242_X_P-C Feature FT:CDS FJ562242_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I68). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactcttccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562243_X_P-C Feature FT:CDS FJ562243_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I71). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562244_X_P-C Feature FT:CDS FJ562244_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I72). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562245_X_P-C Feature FT:CDS FJ562245_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I73). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctgccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgcctgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562248_X_P-C Feature FT:CDS FJ562248_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I76). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562249_X_P-C Feature FT:CDS FJ562249_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I79). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|FJ562250_X_P-C Feature FT:CDS FJ562250_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I83). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggtctctaccgtccccttcttcgtctgccgttccgaccgacgacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcaacgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562251_X_P-C Feature FT:CDS FJ562251_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I84). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562252_X_P-C Feature FT:CDS FJ562252_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I85). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562255_X_P-C Feature FT:CDS FJ562255_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I92). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactttaccgtccccttcttcgtctgccgttccgaccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgtccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562256_X_P-C Feature FT:CDS FJ562256_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I95). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacacccgccaggtcttgcctaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562258_X_P-C Feature FT:CDS FJ562258_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I97). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562261_X_P-C Feature FT:CDS FJ562261_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I109). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttatgtaa
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562264_X_P-C Feature FT:CDS FJ562264_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I114). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacatcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562265_X_P-C Feature FT:CDS FJ562265_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I116). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccgaccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggmccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccaggtgttgcccaaggtcttacataaaaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562266_X_P-C Feature FT:CDS FJ562266_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I118). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtctgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcycagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcagaaattggtctgttcaccagcaccatgcaactttttcacctatgcctaa
>gnl|hbvcds|FJ562268_X_P-C Feature FT:CDS FJ562268_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I121). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgcccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggacccttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562269_X_P-C Feature FT:CDS FJ562269_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I122). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562270_X_P-C Feature FT:CDS FJ562270_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I123). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562272_X_P-C Feature FT:CDS FJ562272_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I125). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562273_X_P-C Feature FT:CDS FJ562273_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I127). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttgggtctctaccgtccccttctgcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggttaaagatctatgtac
tcggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562274_X_P-C Feature FT:CDS FJ562274_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I128). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562275_X_P-C Feature FT:CDS FJ562275_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I129). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatggtctttgtac
taggaggctgtacgcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562276_X_P-C Feature FT:CDS FJ562276_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I130). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgatccctctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562279_X_P-C Feature FT:CDS FJ562279_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I140). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctttaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562280_X_P-C Feature FT:CDS FJ562280_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I141). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgtctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562281_X_P-C Feature FT:CDS FJ562281_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I143). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataaaaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562282_X_P-C Feature FT:CDS FJ562282_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I144). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttctcctctgcctaa
>gnl|hbvcds|FJ562283_X_P-C Feature FT:CDS FJ562283_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I145). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562284_X_P-C Feature FT:CDS FJ562284_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I146). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562285_X_P-C Feature FT:CDS FJ562285_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I147). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcag
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562288_X_P-C Feature FT:CDS FJ562288_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I153). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562290_X_P-C Feature FT:CDS FJ562290_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I162). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtktgtttaargactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562291_X_P-C Feature FT:CDS FJ562291_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I163). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562292_X_P-C Feature FT:CDS FJ562292_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I164). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562293_X_P-C Feature FT:CDS FJ562293_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I167). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcactgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562295_X_P-C Feature FT:CDS FJ562295_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I169). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcctcttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562297_X_P-C Feature FT:CDS FJ562297_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I172). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562298_X_P-C Feature FT:CDS FJ562298_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I174). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggacgtttgggcctctatcgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcg
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcgaactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562299_X_P-C Feature FT:CDS FJ562299_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I175). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562300_X_P-C Feature FT:CDS FJ562300_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I182). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttgggggtctaccgtccccttctttgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtattgcccaaggtcttatataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562301_X_P-C Feature FT:CDS FJ562301_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I185). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttgaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562304_X_P-C Feature FT:CDS FJ562304_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I190). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcg
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562306_X_P-C Feature FT:CDS FJ562306_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I196). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggtctctaccgtccccttctgactctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562307_X_P-C Feature FT:CDS FJ562307_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I197). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttgggcctctatcgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562308_X_P-C Feature FT:CDS FJ562308_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I199). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactctcggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562310_X_P-C Feature FT:CDS FJ562310_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I201). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcccctccttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttcacatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagtttggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562313_X_P-C Feature FT:CDS FJ562313_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I204). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggycttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562315_X_P-C Feature FT:CDS FJ562315_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I207). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562318_X_P-C Feature FT:CDS FJ562318_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I211). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562319_X_P-C Feature FT:CDS FJ562319_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I212). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggcctctaccgtccccttctttatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562320_X_P-C Feature FT:CDS FJ562320_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I213). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggattgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562323_X_P-C Feature FT:CDS FJ562323_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I217). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562324_X_P-C Feature FT:CDS FJ562324_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I219). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562325_X_P-C Feature FT:CDS FJ562325_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I223). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctatctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562326_X_P-C Feature FT:CDS FJ562326_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I227). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttacagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562327_X_P-C Feature FT:CDS FJ562327_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I228). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgcccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcactcctgcctaa
>gnl|hbvcds|FJ562329_X_P-C Feature FT:CDS FJ562329_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I230). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtttgttccccagccccaagcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562330_X_P-C Feature FT:CDS FJ562330_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I231). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562331_X_P-C Feature FT:CDS FJ562331_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I9). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562332_X_P-C Feature FT:CDS FJ562332_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccwggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttctcacctctgcctaa
>gnl|hbvcds|FJ562333_X_P-C Feature FT:CDS FJ562333_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I78). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaagtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562334_X_P-C Feature FT:CDS FJ562334_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I82). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggacccttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562335_X_P-C Feature FT:CDS FJ562335_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I108). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccatccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562337_X_P-C Feature FT:CDS FJ562337_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I173). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggycttgcccaaggtcttacataagaggactctcggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggwctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562339_X_P-C Feature FT:CDS FJ562339_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I205). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562340_X_P-C Feature FT:CDS FJ562340_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I220). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ751770_X_P-C Feature FT:CDS FJ751770_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787437_X_P-C Feature FT:CDS FJ787437_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S129-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaagaactgggaggagttaggggaggagagtaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787439_X_P-C Feature FT:CDS FJ787439_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S157-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggagcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787441_X_P-C Feature FT:CDS FJ787441_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S157-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgccctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcgcctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataaggggactcttggactctcagcaatatcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787442_X_P-C Feature FT:CDS FJ787442_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S171-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787443_X_P-C Feature FT:CDS FJ787443_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S171-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787445_X_P-C Feature FT:CDS FJ787445_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S425-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgaaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787447_X_P-C Feature FT:CDS FJ787447_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S461-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787448_X_P-C Feature FT:CDS FJ787448_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S461-3). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787449_X_P-C Feature FT:CDS FJ787449_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S567-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787450_X_P-C Feature FT:CDS FJ787450_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S627-2). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcctaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787451_X_P-C Feature FT:CDS FJ787451_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S627-3). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttggggctctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcctaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggggttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787452_X_P-C Feature FT:CDS FJ787452_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S955-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787453_X_P-C Feature FT:CDS FJ787453_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1049-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787454_X_P-C Feature FT:CDS FJ787454_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1049-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatttgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaaccttttcacctctgcctaa
>gnl|hbvcds|FJ787455_X_P-C Feature FT:CDS FJ787455_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1092-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgttcacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttggggctctaccgtccccttcttcatctgccgttccgaccggccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtgttgcccaaggtcttacataaaaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggagaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787456_X_P-C Feature FT:CDS FJ787456_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1092-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttggggctctaccgtccccttcttcatctgccgttccgaccgaccacggggtgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcgcgtcgcatggag
accaccgtgaacgcccaccaggtgttgcccaaggtcttacataaaaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787457_X_P-C Feature FT:CDS FJ787457_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1248-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787458_X_P-C Feature FT:CDS FJ787458_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1248-9). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgagaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787459_X_P-C Feature FT:CDS FJ787459_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1348-1). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccatcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgttcaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787461_X_P-C Feature FT:CDS FJ787461_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1357-2). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787462_X_P-C Feature FT:CDS FJ787462_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1357-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccctgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787463_X_P-C Feature FT:CDS FJ787463_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1357-6). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcctcttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787464_X_P-C Feature FT:CDS FJ787464_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787465_X_P-C Feature FT:CDS FJ787465_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-5). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787466_X_P-C Feature FT:CDS FJ787466_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787467_X_P-C Feature FT:CDS FJ787467_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787468_X_P-C Feature FT:CDS FJ787468_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1426-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787469_X_P-C Feature FT:CDS FJ787469_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1426-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787470_X_P-C Feature FT:CDS FJ787470_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1538-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactgggtcctgcgcgggacgtcctttatctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787471_X_P-C Feature FT:CDS FJ787471_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1538-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787474_X_P-C Feature FT:CDS FJ787474_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1732-6). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787479_X_P-C Feature FT:CDS FJ787479_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S157-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787481_X_P-C Feature FT:CDS FJ787481_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S852-2). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgatccctctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787482_X_P-C Feature FT:CDS FJ787482_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1158-7). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagatcaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787483_X_P-C Feature FT:CDS FJ787483_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1158-8). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcatgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagatcaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787484_X_P-C Feature FT:CDS FJ787484_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1348-3). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccatcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgttcaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787485_X_P-C Feature FT:CDS FJ787485_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1656-8). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaacgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagatcaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787486_X_P-C Feature FT:CDS FJ787486_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S2235-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787487_X_P-C Feature FT:CDS FJ787487_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate DMY-1). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctgccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787488_X_P-C Feature FT:CDS FJ787488_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate DMY-5). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgcctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787489_X_P-C Feature FT:CDS FJ787489_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate DMY-6). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatcttcgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787490_X_P-C Feature FT:CDS FJ787490_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LHZ-1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atagctactagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcag
acaatccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctccgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaagttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876190_X_P-C Feature FT:CDS FJ876190_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCCMX5). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccgtcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876191_X_P-C Feature FT:CDS FJ876191_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCCMX9). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctccttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876192_X_P-C Feature FT:CDS FJ876192_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCCMX17). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctccttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876202_X_P-C Feature FT:CDS FJ876202_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCCNX2). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgttgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876203_X_P-C Feature FT:CDS FJ876203_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCCNX13). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccgtcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876204_X_P-C Feature FT:CDS FJ876204_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCCNX21). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876205_X_P-C Feature FT:CDS FJ876205_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCCNX36). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgttgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876206_X_P-C Feature FT:CDS FJ876206_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCCNX79). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccgtcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagagtaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876229_X_P-C Feature FT:CDS FJ876229_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LCMX19). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctccttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876230_X_P-C Feature FT:CDS FJ876230_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LCMX26). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccgtcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagagtaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876238_X_P-C Feature FT:CDS FJ876238_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LCNX13). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttatccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876239_X_P-C Feature FT:CDS FJ876239_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LCNX29). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccgtcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876246_X_P-C Feature FT:CDS FJ876246_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHMX58). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctccttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876251_X_P-C Feature FT:CDS FJ876251_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHNX59). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttatccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggacgataggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ876252_X_P-C Feature FT:CDS FJ876252_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHNX87). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899761_X_P-C Feature FT:CDS FJ899761_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899763_X_P-C Feature FT:CDS FJ899763_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatcagccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899764_X_P-C Feature FT:CDS FJ899764_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttcccatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899765_X_P-C Feature FT:CDS FJ899765_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9-13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgccagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtatgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899767_X_P-C Feature FT:CDS FJ899767_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C26-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccatgaacgcccaccgggccttgcccaaggtcttacataagaggactcttggactcccagcactgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccggcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899768_X_P-C Feature FT:CDS FJ899768_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C56-7). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899769_X_P-C Feature FT:CDS FJ899769_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899770_X_P-C Feature FT:CDS FJ899770_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76-4). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaaaactgtttgtttaaagactgagagaagttaggggaggagactaggttaataatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899771_X_P-C Feature FT:CDS FJ899771_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899772_X_P-C Feature FT:CDS FJ899772_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C113-3). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899773_X_P-C Feature FT:CDS FJ899773_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C113-6). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgttgaatcccgcgg
acgacccctctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899774_X_P-C Feature FT:CDS FJ899774_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C120-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcatttgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcgacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899775_X_P-C Feature FT:CDS FJ899775_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C120-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatcagccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899776_X_P-C Feature FT:CDS FJ899776_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C122-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899777_X_P-C Feature FT:CDS FJ899777_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C127-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcaacaatgtcaacgaccga
ccttgaggcatacttcatagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899778_X_P-C Feature FT:CDS FJ899778_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C173-1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccgtctcggggccggttggggctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgcgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899783_X_P-C Feature FT:CDS FJ899783_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C207-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899788_X_P-C Feature FT:CDS FJ899788_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C226-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggcagctagggtgtgctgccaactggatcctgcgcgggacgtcttttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgtcccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagagaactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899789_X_P-C Feature FT:CDS FJ899789_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C226-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgatccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899793_X_P-C Feature FT:CDS FJ899793_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C122-2). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgtccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899794_X_P-C Feature FT:CDS FJ899794_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C122-3). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgtccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899795_X_P-C Feature FT:CDS FJ899795_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C122-9). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904423_X_P-C Feature FT:CDS FJ904423_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate A78). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgtccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtattcaaagactgggaggagttgggggaggagtctagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ184326_X_P-C Feature FT:CDS GQ184326_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ZADGM501). Complete genome. [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgccagtcttacataagaggactcttggactctcggcaatgtcaacgaccgacct
tgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaatgatctttgtactgg
gaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ222210_X_P-C Feature FT:CDS GQ222210_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ZADGM601). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ222211_X_P-C Feature FT:CDS GQ222211_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ZADGM602). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ222212_X_P-C Feature FT:CDS GQ222212_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ZADGM502). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagaccaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ227692_X_P-C Feature FT:CDS GQ227692_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z3-1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcgtcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ227693_X_P-C Feature FT:CDS GQ227693_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ227694_X_P-C Feature FT:CDS GQ227694_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ227695_X_P-C Feature FT:CDS GQ227695_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-5). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ227696_X_P-C Feature FT:CDS GQ227696_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-6). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttgggctctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ227697_X_P-C Feature FT:CDS GQ227697_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z3-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ259588_X_P-C Feature FT:CDS GQ259588_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358153_X_P-C Feature FT:CDS GQ358153_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EIHB006). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358154_X_P-C Feature FT:CDS GQ358154_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SLK126). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgtttgggactctaccgtccccttcttcgtctgccattccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaagtcttgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358157_X_P-C Feature FT:CDS GQ358157_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M007). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgatccgtctcggggccgcttggggttgtaccgtccccttctccgtctgccgttccggccgcccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358158_X_C-C Feature FT:CDS GQ358158_X_C-C of [Viruses] Hepatitis B Virus genotype C (isolate M154). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccatcggcgctgaatcccgcgg
acgacccgtctcgcggtcgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ372968_X_P-C Feature FT:CDS GQ372968_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6380-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttggggctctatcgtcccctgcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagaatgggaggagttgggggaggagattaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377514_X_P-C Feature FT:CDS GQ377514_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J8). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377515_X_P-C Feature FT:CDS GQ377515_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377517_X_P-C Feature FT:CDS GQ377517_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctacatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377518_X_P-C Feature FT:CDS GQ377518_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatcygccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgrccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctataggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377521_X_P-C Feature FT:CDS GQ377521_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgttgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377523_X_P-C Feature FT:CDS GQ377523_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377524_X_P-C Feature FT:CDS GQ377524_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377526_X_P-C Feature FT:CDS GQ377526_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgatgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcagctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggatgagactaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377527_X_P-C Feature FT:CDS GQ377527_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccatcggcgctgaatcccgcgg
acgacccgtctcggggccgtctgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377528_X_P-C Feature FT:CDS GQ377528_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377529_X_P-C Feature FT:CDS GQ377529_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttggggctataccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgtccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377530_X_P-C Feature FT:CDS GQ377530_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J35). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377531_X_P-C Feature FT:CDS GQ377531_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J36). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
tcggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377533_X_P-C Feature FT:CDS GQ377533_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J39). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttggggctctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377535_X_P-C Feature FT:CDS GQ377535_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J45). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377536_X_P-C Feature FT:CDS GQ377536_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccca
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377538_X_P-C Feature FT:CDS GQ377538_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J52). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgatccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377540_X_P-C Feature FT:CDS GQ377540_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J57). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctggtagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377541_X_P-C Feature FT:CDS GQ377541_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J58). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaagcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377543_X_P-C Feature FT:CDS GQ377543_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J63). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgtccaccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377545_X_P-C Feature FT:CDS GQ377545_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J76). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377546_X_P-C Feature FT:CDS GQ377546_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J77). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377551_X_P-C Feature FT:CDS GQ377551_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J82). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactctcggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377552_X_P-C Feature FT:CDS GQ377552_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J83). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtcagttctccagcaccaagcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377553_X_P-C Feature FT:CDS GQ377553_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J84). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377554_X_P-C Feature FT:CDS GQ377554_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J85). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377555_X_P-C Feature FT:CDS GQ377555_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J86). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggatctaccgtccccttctttgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtagacataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377557_X_P-C Feature FT:CDS GQ377557_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J88). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcctcttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggmg
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377559_X_P-C Feature FT:CDS GQ377559_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J92). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccacgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377562_X_P-C Feature FT:CDS GQ377562_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J97). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgcccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccagatcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377563_X_P-C Feature FT:CDS GQ377563_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J98). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttgggtctctaccgtccctttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaagatctttgtac
tgggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377570_X_P-C Feature FT:CDS GQ377570_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J110). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377571_X_P-C Feature FT:CDS GQ377571_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J112). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377572_X_P-C Feature FT:CDS GQ377572_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J113). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377574_X_P-C Feature FT:CDS GQ377574_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J115). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcacagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcaaaaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377575_X_P-C Feature FT:CDS GQ377575_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J116). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcckaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggycttgcccaaggtcttacataagaggactcttggactckcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttacggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377576_X_P-C Feature FT:CDS GQ377576_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J117). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggccaaaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377577_X_P-C Feature FT:CDS GQ377577_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J118). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttggggctctatcgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taagaggctggtagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377578_X_P-C Feature FT:CDS GQ377578_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J125). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377579_X_P-C Feature FT:CDS GQ377579_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J126). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagataaggttaaaggtctttgtac
taggaagctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377580_X_P-C Feature FT:CDS GQ377580_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J127). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcagctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggaaattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377583_X_P-C Feature FT:CDS GQ377583_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J132). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377584_X_P-C Feature FT:CDS GQ377584_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J133). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactctcggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaataggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377585_X_P-C Feature FT:CDS GQ377585_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J134). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggttctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377586_X_P-C Feature FT:CDS GQ377586_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J135). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcctcttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377591_X_P-C Feature FT:CDS GQ377591_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J148). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggttttacataaacggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377593_X_P-C Feature FT:CDS GQ377593_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J150). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctggtagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377597_X_P-C Feature FT:CDS GQ377597_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J157). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctggtagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377598_X_P-C Feature FT:CDS GQ377598_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J158). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtccgcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtcccctgcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgttagcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377599_X_P-C Feature FT:CDS GQ377599_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J160). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377600_X_P-C Feature FT:CDS GQ377600_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J161). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcwtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377601_X_P-C Feature FT:CDS GQ377601_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J164). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttggggctctatcgtccccttcttcttctgccgttccggccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattagtttaatgatctttgtac
tgggaggctgttagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377603_X_P-C Feature FT:CDS GQ377603_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J166). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcktctgccgttccggccraccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377605_X_P-C Feature FT:CDS GQ377605_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J169). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377608_X_P-C Feature FT:CDS GQ377608_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J174). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttggaggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377609_X_P-C Feature FT:CDS GQ377609_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J176). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377615_X_P-C Feature FT:CDS GQ377615_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J186). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggmccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tggagggctgttagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377616_X_P-C Feature FT:CDS GQ377616_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J192). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377617_X_P-C Feature FT:CDS GQ377617_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J193). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattatgttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377618_X_P-C Feature FT:CDS GQ377618_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J194). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggtctctaccgtccgcttctacttctgccgttccggccgtccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377619_X_P-C Feature FT:CDS GQ377619_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J195). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377620_X_P-C Feature FT:CDS GQ377620_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J197). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactattggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377621_X_P-C Feature FT:CDS GQ377621_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J206). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcacaggactgacaacgaacga
ctctggggctcacatcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377623_X_P-C Feature FT:CDS GQ377623_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J208). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcgacgctgaatcccgcgg
acgatccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtctggggaggagaataggttaatgatttttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377624_X_P-C Feature FT:CDS GQ377624_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J221). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377628_X_P-C Feature FT:CDS GQ377628_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J232). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377631_X_P-C Feature FT:CDS GQ377631_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J239). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgttc
tgggaggctgttagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377632_X_P-C Feature FT:CDS GQ377632_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J240). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatccagcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaagatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377636_X_P-C Feature FT:CDS GQ377636_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J248). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctaccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttayataacaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377637_X_P-C Feature FT:CDS GQ377637_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J249). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377640_X_P-C Feature FT:CDS GQ377640_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J253). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagtttaatgatctttgtac
tgggaggctgttagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377642_X_P-C Feature FT:CDS GQ377642_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J256). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatctttgtac
tgggaggctgttagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475305_X_P-C Feature FT:CDS GQ475305_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR1CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgcttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475306_X_P-C Feature FT:CDS GQ475306_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR2CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgtccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475307_X_P-C Feature FT:CDS GQ475307_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR3CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475308_X_P-C Feature FT:CDS GQ475308_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR4CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475309_X_P-C Feature FT:CDS GQ475309_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR5CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475310_X_P-C Feature FT:CDS GQ475310_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR6CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475311_X_P-C Feature FT:CDS GQ475311_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR7CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccgaccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475312_X_P-C Feature FT:CDS GQ475312_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR8CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475313_X_P-C Feature FT:CDS GQ475313_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR9CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475314_X_P-C Feature FT:CDS GQ475314_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR10CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475315_X_P-C Feature FT:CDS GQ475315_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR11CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475316_X_P-C Feature FT:CDS GQ475316_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR12CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475317_X_P-C Feature FT:CDS GQ475317_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR13CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgccg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatccggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475318_X_P-C Feature FT:CDS GQ475318_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR14CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcggctgccgttccgaccgaccacggggcgtacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgtccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475319_X_P-C Feature FT:CDS GQ475319_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR15CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475320_X_P-C Feature FT:CDS GQ475320_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR16CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475321_X_P-C Feature FT:CDS GQ475321_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR17CHB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475322_X_P-C Feature FT:CDS GQ475322_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR18LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctttctctgccgttccggccgtccacggggaaaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475324_X_P-C Feature FT:CDS GQ475324_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR20LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475325_X_P-C Feature FT:CDS GQ475325_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR21LC). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475326_X_P-C Feature FT:CDS GQ475326_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR22LC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475327_X_P-C Feature FT:CDS GQ475327_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR23LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475328_X_P-C Feature FT:CDS GQ475328_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR24LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475329_X_P-C Feature FT:CDS GQ475329_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR25LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgcttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475330_X_P-C Feature FT:CDS GQ475330_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR26LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactttaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475331_X_P-C Feature FT:CDS GQ475331_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR27LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475332_X_P-C Feature FT:CDS GQ475332_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR28LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactatcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475333_X_P-C Feature FT:CDS GQ475333_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR29LC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475334_X_P-C Feature FT:CDS GQ475334_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR30LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475336_X_P-C Feature FT:CDS GQ475336_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR32LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475337_X_P-C Feature FT:CDS GQ475337_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR33LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttcctgccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475338_X_P-C Feature FT:CDS GQ475338_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR34LC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccggggccgtttgggcctctatcgtccccttcttcatctaccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcctaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgagtcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475339_X_P-C Feature FT:CDS GQ475339_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR35HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggcctctaccgtccccttctttctctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475341_X_P-C Feature FT:CDS GQ475341_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR37HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475342_X_P-C Feature FT:CDS GQ475342_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR38HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475343_X_P-C Feature FT:CDS GQ475343_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR39HCC). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcagctgctgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcg
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475344_X_P-C Feature FT:CDS GQ475344_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR40HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475345_X_P-C Feature FT:CDS GQ475345_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR41HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475346_X_P-C Feature FT:CDS GQ475346_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR42HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgcttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475347_X_P-C Feature FT:CDS GQ475347_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR43HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475348_X_P-C Feature FT:CDS GQ475348_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR44HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475349_X_P-C Feature FT:CDS GQ475349_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR45HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475350_X_P-C Feature FT:CDS GQ475350_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR46HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcaactgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475351_X_P-C Feature FT:CDS GQ475351_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR47HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475352_X_P-C Feature FT:CDS GQ475352_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR48HCC). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgtccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|GQ475353_X_P-C Feature FT:CDS GQ475353_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR49HCC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccatcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475354_X_P-C Feature FT:CDS GQ475354_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR50HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475355_X_P-C Feature FT:CDS GQ475355_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR51HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctrcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475356_X_P-C Feature FT:CDS GQ475356_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR52HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggmtctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtygggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475357_X_P-C Feature FT:CDS GQ475357_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR53HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcatgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855521_X_P-C Feature FT:CDS GQ855521_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate migrant 3). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855523_X_P-C Feature FT:CDS GQ855523_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate migrant 37). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgcccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855525_X_P-C Feature FT:CDS GQ855525_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate migrant 96). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatccagcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855528_X_P-C Feature FT:CDS GQ855528_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate migrant 140). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttgggtctctaccgtccccttcttcgtttgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855530_X_P-C Feature FT:CDS GQ855530_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate migrant 204). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855531_X_P-C Feature FT:CDS GQ855531_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate migrant 205). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtcgcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccgccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855533_X_P-C Feature FT:CDS GQ855533_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate migrant 230). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855534_X_P-C Feature FT:CDS GQ855534_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate migrant 266). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccagggcttgcccaaggtcttacataagaggactcttggactctcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855537_X_P-C Feature FT:CDS GQ855537_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate migrant 350). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagacaaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855541_X_P-C Feature FT:CDS GQ855541_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate migrant 385). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgcccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855543_X_P-C Feature FT:CDS GQ855543_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate migrant 416). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcgacgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcctgccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactcggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855544_X_P-C Feature FT:CDS GQ855544_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate migrant 423). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccgtctcggggtcgcttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855548_X_P-C Feature FT:CDS GQ855548_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate migrant 512). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgcccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ872210_X_P-C Feature FT:CDS GQ872210_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ872211_X_P-C Feature FT:CDS GQ872211_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924604_X_P-C Feature FT:CDS GQ924604_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccattccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattcggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924609_X_P-C Feature FT:CDS GQ924609_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcactgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924612_X_P-C Feature FT:CDS GQ924612_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M30a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctacatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924613_X_P-C Feature FT:CDS GQ924613_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M30b). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctacatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924615_X_P-C Feature FT:CDS GQ924615_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgtctgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactcggttaaagatttatgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924616_X_P-C Feature FT:CDS GQ924616_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924619_X_P-C Feature FT:CDS GQ924619_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M37). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactcggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924620_X_C-C Feature FT:CDS GQ924620_X_C-C of [Viruses] Hepatitis B Virus genotype C (isolate M38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccaacctggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924622_X_P-C Feature FT:CDS GQ924622_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactcccagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924623_X_P-C Feature FT:CDS GQ924623_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M41). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgcctttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctgccaggtcttgcccaaggtcttacataagagaactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactcggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924629_X_P-C Feature FT:CDS GQ924629_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M51). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924633_X_P-C Feature FT:CDS GQ924633_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M56). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924636_X_P-C Feature FT:CDS GQ924636_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M68). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttacagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924642_X_P-C Feature FT:CDS GQ924642_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M77). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtccgcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtcccctgcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataggttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924643_X_P-C Feature FT:CDS GQ924643_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M78). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924649_X_P-C Feature FT:CDS GQ924649_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M86). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924650_X_P-C Feature FT:CDS GQ924650_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M87). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924655_X_P-C Feature FT:CDS GQ924655_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M92). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtcctcttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924658_X_P-C Feature FT:CDS GQ924658_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M95). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccattccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcctgccaggtcttgcccaaggtcttacataagagaactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattcggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU357845_X_P-C Feature FT:CDS GU357845_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y1021). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactttatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactattggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU434374_X_P-C Feature FT:CDS GU434374_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 214-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU563561_X_P-C Feature FT:CDS GU563561_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BV-153). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttctgcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU721029_X_P-C Feature FT:CDS GU721029_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CMCL107). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcggaacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttcacatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggttaatggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011465_X_P-C Feature FT:CDS HM011465_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctttaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011468_X_P-C Feature FT:CDS HM011468_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggcmttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011472_X_P-C Feature FT:CDS HM011472_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtattcaaagactgggaggagttgggggaggagtttagattaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011479_X_P-C Feature FT:CDS HM011479_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggrtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggycttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaytaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011481_X_P-C Feature FT:CDS HM011481_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011486_X_P-C Feature FT:CDS HM011486_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcctaaggtcttatataagaggactcttggactctcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011488_X_P-C Feature FT:CDS HM011488_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaycgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgccygccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttacagactgggaggagttgggggaggagtctagrttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011489_X_P-C Feature FT:CDS HM011489_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggcccaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011491_X_P-C Feature FT:CDS HM011491_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accgccgtgaacgcctgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtattcaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011493_X_P-C Feature FT:CDS HM011493_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgatgaatcctgcgg
acgacccgtcccggggccgtttgggaatctaccgtccccttckttgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtattgcccaaggtcttatataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011495_X_P-C Feature FT:CDS HM011495_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctatcgtccccttcttcgtctgccgttccggccgaccacgggacgcacctct
ctttacgcggtctccccgtctgtgccttcacatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactcccagctatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011497_X_P-C Feature FT:CDS HM011497_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatccagcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcctcaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011500_X_P-C Feature FT:CDS HM011500_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011502_X_P-C Feature FT:CDS HM011502_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggmccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750131_X_P-C Feature FT:CDS HM750131_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate QHN-57). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcag
acgacccatctcggggccgtttgggtctctaccgtcccctccttcgtctgcccttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcactgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750132_X_P-C Feature FT:CDS HM750132_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Tibet-165). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750134_X_P-C Feature FT:CDS HM750134_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate QHX-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750135_X_P-C Feature FT:CDS HM750135_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate QHX-14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750136_X_P-C Feature FT:CDS HM750136_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GSDC-53). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcgggggcgtttggggatctaccgtccccttcgtcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatatttcaaagactgtgtgtttaaagactgggaggagttaggggaggagatcaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750137_X_P-C Feature FT:CDS HM750137_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate QHN-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750138_X_P-C Feature FT:CDS HM750138_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Tibet-100). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750139_X_P-C Feature FT:CDS HM750139_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GSD-17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750140_X_P-C Feature FT:CDS HM750140_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GSD-56). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactctccgcaatgccaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM750141_X_P-C Feature FT:CDS HM750141_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate QHX-115). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgtatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagtcgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ622095_X_P-C Feature FT:CDS HQ622095_X_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccggttgggtctctatcgtccccttctacagctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ638218_X_P-C Feature FT:CDS HQ638218_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate A64-1). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700456_X_P-C Feature FT:CDS HQ700456_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_NZL_HA121_1984). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctaccgtccccttcttcgtctgccgttccggccacccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700457_X_P-C Feature FT:CDS HQ700457_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_NZL_HA71_1997). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgcttggggmtctaycgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700475_X_P-C Feature FT:CDS HQ700475_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_NZL_PA58_1984). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctaccgtccccttcttcgtctgccgttccggccamccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttamagactgggaggagttgggggaggagattagattaaaggtcattgtrc
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700476_X_P-C Feature FT:CDS HQ700476_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_NZL_PA58_1999). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700490_X_P-C Feature FT:CDS HQ700490_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_NZL_WH23_1993). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctaccgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagcttagattaaagttgtttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700495_X_P-C Feature FT:CDS HQ700495_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_F155PF_2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgcttggggatctaccgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgctgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagcttagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700496_X_P-C Feature FT:CDS HQ700496_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_F155C_2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgcttggggatctaccgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgctgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700502_X_P-C Feature FT:CDS HQ700502_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_Is_1991). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctatcgtcccctccttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700504_X_P-C Feature FT:CDS HQ700504_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_Ve_1992). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700506_X_P-C Feature FT:CDS HQ700506_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_NC_TA32_2003). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgcttggggctctaccgtcccctccttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700516_X_P-C Feature FT:CDS HQ700516_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_PNG_D029_2005). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgcttggggatctatcgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcaaaaaaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700517_X_P-C Feature FT:CDS HQ700517_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_PNG_D058A_2005). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggactgtaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctccgcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700522_X_P-C Feature FT:CDS HQ700522_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_PNG_H086A_2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcagcgctgaatccggcgg
acgatccgtctcggggccgcctggggatctaccgtccccttctttgcctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatgatcttgcccaaggtcttgcataagaggactcttggactcacagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700529_X_P-C Feature FT:CDS HQ700529_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_PNG_W083A_2004). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgcttggggatctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgcctggtattgcctaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700543_X_P-C Feature FT:CDS HQ700543_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_PNG_P124A_2005). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcagcgctgaatccggcgg
acgatccgtctcggggccgcctggggatctaccgtccccttctttgcctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatgatcttgcccaaggtcttgcataagaggactcttggactcacagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700555_X_P-C Feature FT:CDS HQ700555_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BD4171_2001). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggctctaccgtccccttctccgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgrgccgtgtgcacttcgctwcacctctgcacgtcgcatggar
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700556_X_P-C Feature FT:CDS HQ700556_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BA4986_2002). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctatcgtccccttcttcgtttgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatcagccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcatcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700558_X_P-C Feature FT:CDS HQ700558_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BD5375_2001). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggctctaccgtccccttctccgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700559_X_P-C Feature FT:CDS HQ700559_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BD5561_2001). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggmtctaccgtccccttctccgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttamagactgggaggagttgggggaggagattagattaaaggtstttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700561_X_P-C Feature FT:CDS HQ700561_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BF7376_2002). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggctctaccgtccccttctccgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtgtttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700562_X_P-C Feature FT:CDS HQ700562_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tomga_BH5413_2002). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctatcgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgarcgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccgr
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700563_X_P-C Feature FT:CDS HQ700563_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BL9389_2002). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggggtctatcgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700564_X_P-C Feature FT:CDS HQ700564_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BQ3589_2001). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctatcgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttaggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700565_X_P-C Feature FT:CDS HQ700565_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BR6895_2001). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctatcgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttaggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700566_X_P-C Feature FT:CDS HQ700566_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_JN1142_2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctaccgtccccttctccgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700567_X_P-C Feature FT:CDS HQ700567_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To268_2006). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctaccgtccccttctccgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgttyaargactgggaggagttgggggaggagatyagrttaaaggtctttgtay
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700568_X_P-C Feature FT:CDS HQ700568_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To281_2006). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctatcgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcatcaatgtcarcgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700569_X_P-C Feature FT:CDS HQ700569_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To347_2006). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctaccgtccccttctccgtttgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700570_X_P-C Feature FT:CDS HQ700570_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To356_2006). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctatcgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcagtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagatcaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700571_X_P-C Feature FT:CDS HQ700571_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To391_2006). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgcttggggatctaccgtcccctgcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700572_X_P-C Feature FT:CDS HQ700572_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To422_2007). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggctctaccgtccccttctccgtctgccgttccggccaaccacggggcrcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgyacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggyattgcccaaggtcttgcataagaggactcttggactctcarcgatgtcaacgrccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagaytagattaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700573_X_P-C Feature FT:CDS HQ700573_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To426_2007). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctatcgtccccttcttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700574_X_P-C Feature FT:CDS HQ700574_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To400_2006). Complete genome. [Hepadnaviridae] (length=468 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctatcgtcccctccttcgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagatcaggttaaaggtcttgtttg
tattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700575_X_P-C Feature FT:CDS HQ700575_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To244_2006). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggmtctatcgtccccttctccgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggakgagwmtagrttaatgwtstwtgtwc
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700576_X_P-C Feature FT:CDS HQ700576_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To250_2006). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctmcgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatstaccgtccccttctycgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcayctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagcttagattaawgrtstttgtac
taggaggctgtaggcataaattggtctgttcaccagyaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700577_X_P-C Feature FT:CDS HQ700577_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To293_2006). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctaycgtccccttctycgtytgccgttccggccaaccacggggcgcacctct
ctttacgcsgtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaargactgggrggagttrggggaggagatyagrttaawgatstttgtay
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700578_X_P-C Feature FT:CDS HQ700578_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To16_2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgattgggactctaccgtccccttctccgtctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacatggtattgcccaaggtcttgtataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtattcaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF436920_X_P-C Feature FT:CDS JF436920_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SZ6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828905_X_P-C Feature FT:CDS JF828905_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacatcaaagactgtttgttcaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828906_X_P-C Feature FT:CDS JF828906_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828907_X_P-C Feature FT:CDS JF828907_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-3). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatccgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828908_X_P-C Feature FT:CDS JF828908_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-4). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcgcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcatctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828910_X_P-C Feature FT:CDS JF828910_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-8). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828911_X_P-C Feature FT:CDS JF828911_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-9). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgcccggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828912_X_P-C Feature FT:CDS JF828912_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-11). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgttcaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828913_X_P-C Feature FT:CDS JF828913_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaatgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828915_X_P-C Feature FT:CDS JF828915_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828916_X_P-C Feature FT:CDS JF828916_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828917_X_P-C Feature FT:CDS JF828917_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828918_X_P-C Feature FT:CDS JF828918_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828919_X_P-C Feature FT:CDS JF828919_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828920_X_P-C Feature FT:CDS JF828920_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-14). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828921_X_P-C Feature FT:CDS JF828921_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggtcgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828922_X_P-C Feature FT:CDS JF828922_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828923_X_P-C Feature FT:CDS JF828923_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828924_X_P-C Feature FT:CDS JF828924_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828925_X_P-C Feature FT:CDS JF828925_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcactgaatcctgcgg
acgacccctctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgccctccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828926_X_P-C Feature FT:CDS JF828926_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828928_X_P-C Feature FT:CDS JF828928_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828929_X_P-C Feature FT:CDS JF828929_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828930_X_P-C Feature FT:CDS JF828930_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828931_X_P-C Feature FT:CDS JF828931_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-15). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgtttgggcctctaccgtccccttcttcctctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF828937_X_P-C Feature FT:CDS JF828937_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES72-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgttcgggcctctatcgtccccttcttcttctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF899336_X_P-C Feature FT:CDS JF899336_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10B3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN104432_X_P-C Feature FT:CDS JN104432_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taagaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN104433_X_P-C Feature FT:CDS JN104433_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN104434_X_P-C Feature FT:CDS JN104434_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgcttgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacagggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN104435_X_P-C Feature FT:CDS JN104435_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttggggaaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN104437_X_P-C Feature FT:CDS JN104437_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN104440_X_P-C Feature FT:CDS JN104440_X_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
gtggctgctcggctgtgctgcaaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcccggggccgtttgggactctatcgtccccttcttcgtctaccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcctaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN315779_X_P-C Feature FT:CDS JN315779_X_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgggrccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN400087_X_P-C Feature FT:CDS JN400087_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-75-Mother). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgcaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN400088_X_P-C Feature FT:CDS JN400088_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-77-Baby). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgcaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN400089_X_P-C Feature FT:CDS JN400089_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-77-Mother). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgcaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418493_X_P-C Feature FT:CDS JN418493_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N6). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418494_X_P-C Feature FT:CDS JN418494_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N10). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418495_X_P-C Feature FT:CDS JN418495_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N11). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttggggctctaccgtccccttcttcttctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggctttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418496_X_P-C Feature FT:CDS JN418496_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N13). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggca
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418497_X_P-C Feature FT:CDS JN418497_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N16). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttctacatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggatttgggggaggagaataggttaatgatttatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418498_X_P-C Feature FT:CDS JN418498_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N19). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggtcgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggcagtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418500_X_P-C Feature FT:CDS JN418500_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N32). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggtctctaccgtccccttctgcgtctgccgttccgcccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418501_X_P-C Feature FT:CDS JN418501_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N34). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418503_X_P-C Feature FT:CDS JN418503_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N38). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgtccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418504_X_P-C Feature FT:CDS JN418504_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N41). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccatgaggcatacttcaaagacagtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418505_X_P-C Feature FT:CDS JN418505_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N42). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggcctctatcgtccccttctacatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcgatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418506_X_P-C Feature FT:CDS JN418506_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N44). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418507_X_P-C Feature FT:CDS JN418507_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N47). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418508_X_P-C Feature FT:CDS JN418508_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N48). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgcaaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccggttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418509_X_P-C Feature FT:CDS JN418509_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N50). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcgcggccgtttgggactctatcgtccccttctgcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactcccagcgatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggagactgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418510_X_P-C Feature FT:CDS JN418510_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N57). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctaccgtccccttcttcggctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418511_X_P-C Feature FT:CDS JN418511_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N61). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418512_X_P-C Feature FT:CDS JN418512_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N64). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttatttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418513_X_P-C Feature FT:CDS JN418513_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N67). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttgggactctaccgtccccttcttctgctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418514_X_P-C Feature FT:CDS JN418514_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N72). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcg
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418515_X_P-C Feature FT:CDS JN418515_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N79). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtcacggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418518_X_P-C Feature FT:CDS JN418518_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N87). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataataagactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaataggttaatgatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418519_X_P-C Feature FT:CDS JN418519_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N89). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccatctcggggccgtttgggtctctaccgtccccttctgcgtctgccgttccgcccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaagatttttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418521_X_P-C Feature FT:CDS JN418521_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N91). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418523_X_P-C Feature FT:CDS JN418523_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N96). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418524_X_P-C Feature FT:CDS JN418524_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N97). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacacccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagataaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418525_X_P-C Feature FT:CDS JN418525_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N98). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccggttgggcctataccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418526_X_P-C Feature FT:CDS JN418526_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N102). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418527_X_P-C Feature FT:CDS JN418527_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N103). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggtctctaccgtccccttctgcgtctgccgttccgcccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418528_X_P-C Feature FT:CDS JN418528_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NT1). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctttaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418530_X_P-C Feature FT:CDS JN418530_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T9). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcactgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgtccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418532_X_P-C Feature FT:CDS JN418532_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T28). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418533_X_P-C Feature FT:CDS JN418533_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T29). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctcccagtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtagcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418534_X_P-C Feature FT:CDS JN418534_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T33). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctatcgtcccctccttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttacagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418535_X_P-C Feature FT:CDS JN418535_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T41). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418536_X_P-C Feature FT:CDS JN418536_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T42). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctcccagtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418538_X_P-C Feature FT:CDS JN418538_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T54). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctatgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN418539_X_P-C Feature FT:CDS JN418539_X_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T55). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgtttgggcctctaccgtcctcttcttcatctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttgtcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattag