Dataset for nucleotide sequence SP of genotype C

[Download (right click)] [Edit] [Sequences] [Repertoires]

3490 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

FJ562286_SP_P-C      gt---------taatcattacttc--aaaactaggcattatttacatact
MG571345_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
JQ801518_SP_P-C      atgcccctatcttgtcaacacgtccggaaact----aatgttgttatacg
AB014387_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagatg
GQ924629_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB115418_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacc
KJ717825_SP_P-C      atgcccctatcttatcaacgcttcctgagact----actgttgttagacc
KJ803812_SP_P-C      atgcccctatcttatcaacgcttcctgagact----actgttgttagacc
AB112066_SP_P-C      atgcccccatcttatcaacactcccggaaact----actgttgttagacg
EU939552_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttaaaca
AB112471_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX276836_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagaca
KR014000_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC315399_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
KJ717821_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttattagatc
KJ803809_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttattagatc
KR014006_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013827_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013998_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014007_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014002_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014005_SP_P-C      atacccctatcttatcaacacttccggaaact----actgttgttagacg
MK286461_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KX276853_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttrttagagg
KJ410511_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KF053184_SP_P-C      atgcccctatcttatccacacttccggaaact----actgttgttagaca
KJ803777_SP_P-C      atgcccctatcttatccacacttccggaaact----actgttgttagaca
JQ801508_SP_P-C      atgcccctatcttatcaatccttccggaaact----actgttattagacg
KF053168_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagatg
KJ803760_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagatg
HM011495_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacs
KX276841_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC792911_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ361526_SP_P-C      atgcccctatcttatcaacgcttccggagact----ggtgttgttagaca
JQ341653_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacc
GQ924619_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttgttagaca
AB014367_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801517_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
FJ562310_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
JQ027324_SP_P-C      atgcccctatcttatcaacacttccggaaact----rctgttgttagacc
KF214670_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX026888_SP_P-C      atgcccctatcttatcaactcttccggaaact----actgttgttagacg
JQ027332_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB031262_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386620_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964214_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386689_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
KU964228_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964219_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964217_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964220_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964227_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964216_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964221_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM750139_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964218_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964222_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964224_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964225_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964215_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964223_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964226_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828905_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828906_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828907_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828911_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828912_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828908_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828910_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717791_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
JQ801520_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924643_SP_P-C      atgcccctatcttatcaacgcttccggaaact----gctgttattagacg
EU570072_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089790_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY167091_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagagg
AB074047_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB931170_SP_P-C      atgcccctatcttatcaacacttcctgaaact----actgttgttagacg
AB931171_SP_P-C      atgcccctatcttatcaacacttcctgaaact----actgttgttagacg
MF925403_SP_P-C      atgcacctatcttatcaacgcttccggaaact----actgttgttagaca
KX765828_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410518_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagagg
JX507211_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
JQ429078_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagatg
KF053185_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
JX507212_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
MT426312_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426306_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426287_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426267_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148559_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148493_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341631_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426277_SP_P-C      atgcctctatcttatcaacacttccggaaact----actgttgttagacg
MT426288_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148567_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148483_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148491_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148479_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410493_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717812_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803800_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148476_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148520_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426326_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgctagacg
MT426319_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426314_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426298_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426297_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426292_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426284_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426310_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426283_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426280_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426279_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426266_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426265_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426289_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426264_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426254_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148570_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148564_SP_P-C      atgcccctatctcatcaacacttccggaaact----actgttgttagacg
KP148557_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148547_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148546_SP_P-C      atgcccctatcttatcaacatttccggaaact----actgttgttagacg
KP148543_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148540_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148535_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148534_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148525_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148488_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148473_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148465_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148315_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148463_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148464_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148466_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148468_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148469_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148470_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148471_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148472_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148474_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148475_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148477_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148480_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148481_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148482_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148487_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148489_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148492_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148512_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148513_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148514_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148517_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148521_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148523_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148524_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148526_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148528_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148529_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148531_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148532_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148537_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148538_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148545_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148548_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148549_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148551_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148554_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148555_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148558_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148560_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148561_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148562_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148563_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148566_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148571_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148572_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148573_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148574_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426251_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426252_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426253_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426255_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426256_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426257_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426258_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426259_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426260_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426261_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426262_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426263_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426268_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426269_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426270_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426271_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426272_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426273_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426274_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426275_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426276_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426278_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426281_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426285_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426286_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426290_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426291_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426293_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426294_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426295_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426296_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426299_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426300_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426301_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426303_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426304_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426305_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426307_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426309_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426311_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426313_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426315_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426316_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426317_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426318_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426320_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426321_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426322_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426323_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426324_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426325_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426327_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426329_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426330_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426331_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426332_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426333_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426334_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426335_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426336_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426337_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426338_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426339_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426340_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426341_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426342_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426343_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426344_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426345_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426328_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939542_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttgttagaca
FJ899767_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttgttagaca
JQ707768_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttgttagaca
JQ707769_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttgttagaca
JQ707770_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttgttagaca
JQ707771_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttgttagaca
JQ707772_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttgttagaca
JQ707773_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttgttagaca
JQ707774_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttgttagaca
KX276840_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013899_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
KF053173_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
KJ803766_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
JQ341635_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341624_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB112063_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674430_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KX276833_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacr
KR014021_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013839_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717809_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
KC792880_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801510_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801478_SP_P-C      atgcccctatcttatccacacttccggaaact----actgttgttagacg
JQ027320_SP_P-C      atgcccctatcttatcaactcttccggaaact----actgttgttagacg
GQ924636_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924609_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EF494377_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089803_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089802_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089773_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttyttagacg
AY641559_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF053177_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803770_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674425_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674458_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF053161_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttattagacg
KJ803754_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttattagacg
KT366464_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598761_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
HM011486_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089772_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB900113_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
AB112472_SP_P-C      atgctcctatcttatcaacacttccggaaact----actgttgttagacg
AB014368_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801515_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
JQ341619_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013820_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
JQ801523_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341630_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089785_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT347089_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
JQ341626_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
MF488703_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
HM011468_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
FJ904423_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
JQ801499_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
KX276847_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717822_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803810_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN827423_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB112348_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU717214_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU872005_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475355_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964353_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ788835_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ151414_SP_P-C      atgcccctatcttatcaacactttccggaact----actgttgttagacg
MF925409_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089804_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagagg
AB111946_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801491_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925376_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715415_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715416_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ027318_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367431_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089757_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341613_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803815_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803814_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717827_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717828_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX504535_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410519_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089801_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562298_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964020_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964021_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964022_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964023_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964024_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964025_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964026_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964027_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964028_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964029_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964030_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964031_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964032_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964033_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023652_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacc
JQ801472_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacc
MT426449_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MH220971_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925405_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
MF674471_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674417_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674399_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470911_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
KX765855_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX276849_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964049_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964050_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964051_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964052_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964053_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964054_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964055_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964056_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964057_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964058_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964059_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964060_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964061_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964062_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964063_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013841_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013838_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013823_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013772_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148462_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KM875429_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KM875428_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KM875406_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
KJ717826_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803813_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717823_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803811_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410491_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410492_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410494_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410499_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF053193_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
KF053164_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803757_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC875268_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX870000_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
JQ801490_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341650_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341647_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341618_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
FJ562304_SP_P-C      atgcccctatcttatcaacgcttccggaaact----actgttgttagacg
FJ023646_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EF197911_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ361534_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089791_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
DQ089778_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089759_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF473543_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB900109_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670258_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
AB367394_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB112408_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB112065_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013822_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013825_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013996_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013905_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013904_SP_P-C      atgcccctatcttatcaacacttccggaaacc----actgttgttagacg
KR013855_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013824_SP_P-C      atgcccctatcttatcaacgcttccggaaact----actgttgttagacg
KR013770_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341616_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
DQ089764_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ358154_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM011497_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013821_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013826_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013854_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013856_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013857_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013900_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013902_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881968_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470920_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023655_SP_P-C      atgcccctatcttatcaacacttcctgaaact----actgttgttagacg
AB205123_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KM875424_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagagg
KM875425_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagagg
DQ089776_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
DQ089777_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
JQ801489_SP_P-C      atgcccctatcttatcaacacttccgcaaact----actgttgttagacg
KY470915_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674475_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB368297_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826125_SP_P-C      -tgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765836_SP_P-C      acgcccctatcctatcaacacttccggaaact----actgttgttagacg
KX276854_SP_P-C      atgcccctatcttatcaacacttccggaaayt----rctgttgttagacg
AF223960_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
KJ598773_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562265_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY057947_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598767_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089775_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagagg
MG571332_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagagg
KF214668_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC875267_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB247916_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426474_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426458_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426516_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426552_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426548_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787455_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787456_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KM875405_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ478901_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173285_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410495_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470914_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801503_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089780_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ358153_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717839_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803823_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU051424_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801521_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341612_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089756_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY206385_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT366463_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426348_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426354_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377642_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715395_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715397_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939578_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB195952_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB195953_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB195954_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279259_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279260_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279261_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279262_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377593_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN827424_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN827425_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN827418_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN827421_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148519_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148530_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148552_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148575_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341651_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801482_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF053183_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803776_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG725248_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU882005_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX504545_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ246215_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
FJ562320_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB900115_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
JQ040131_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426637_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426451_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426448_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426445_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426437_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426409_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426395_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426371_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426363_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426355_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426352_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426308_SP_P-C      atgcccctatcttatcaacgcttccggaaact----actgttgttagacg
MG826123_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925410_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925395_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925375_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925369_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
MF925359_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674504_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674467_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674390_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470937_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470936_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470907_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470917_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX774504_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765843_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765840_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765839_SP_P-C      atgcccctatcttatcaacgcttccggaaact----actgttgttagacg
KX765827_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
KX765821_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765819_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765847_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX276852_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX276848_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttrttagacg
KT987423_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT307718_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT307719_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU051426_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU051427_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013927_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013903_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013840_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013837_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013835_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013836_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013787_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP148568_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KM875430_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717803_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803793_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717802_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803792_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410498_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410496_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF214672_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF214671_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF214669_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
KF214667_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC875269_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801522_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801501_SP_P-C      atgcccctatcttatcaacgcttccggaaact----actgttgttagacg
JQ801493_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801487_SP_P-C      atgcccctatcttatcaacgcttccggaaact----actgttgttagacg
MT426420_SP_P-C      atgcccctatcttatcaacgcttccggaaact----actgttgttagacg
JQ801480_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801475_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765825_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765844_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765845_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801473_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341666_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341663_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341661_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341642_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341622_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341620_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341615_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ027317_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN827422_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF488701_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG571335_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN827417_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF899336_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU051425_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924616_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924614_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924612_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924613_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410489_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377536_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ184326_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagagg
FJ562295_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279274_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023654_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801505_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774227_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013935_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925374_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MK628732_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023651_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470908_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023650_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023640_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916226_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774283_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279275_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC318702_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC318703_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306688_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EF688062_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377632_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341652_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801495_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX774506_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674486_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ361533_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924623_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717844_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803826_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX276844_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ315781_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ315783_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089788_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089784_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
DQ089783_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089781_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089770_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089769_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089768_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
JQ027333_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
DQ089766_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089762_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089761_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089771_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AJ748098_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089787_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023645_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ027321_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341641_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801496_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801497_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774236_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF053176_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF214673_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF214676_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173286_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410515_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KM875411_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX276851_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765822_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765842_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765849_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674429_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674457_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674463_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674514_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF223955_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB117758_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB105173_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674388_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674402_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674408_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674412_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674418_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674454_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674468_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674472_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674484_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674501_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB074756_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801504_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410504_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB074755_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023649_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924615_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF053167_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF053169_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803759_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803761_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013810_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765830_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB105174_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB300363_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF068756_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF223954_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF223956_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF223957_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF223958_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF223959_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AP011097_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY862869_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089763_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089765_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089767_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089779_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089782_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089789_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ315782_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EF494379_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306685_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306687_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306689_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306690_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306691_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306694_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023641_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023642_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023643_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023644_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023647_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023653_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023657_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023658_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ349225_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924604_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924649_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924650_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924658_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GU563561_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN827416_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040133_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341637_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341644_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341654_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341668_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341669_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ688403_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801470_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801481_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801483_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801486_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801488_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801502_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801511_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801513_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801519_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX507214_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774228_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC875270_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC875271_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC875272_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC875274_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF053187_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173323_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173324_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410501_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410508_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410513_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717810_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717811_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ717834_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803780_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803799_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803818_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KM875404_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT364718_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT364721_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT987424_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT987425_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT987426_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU051423_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765818_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765820_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765823_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765824_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765826_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765829_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765831_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765832_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765833_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765834_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765837_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765838_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765846_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765848_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765850_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765851_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765853_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX774503_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470906_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470909_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470910_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470912_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470913_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470916_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470918_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674386_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674398_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674403_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674411_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674435_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674442_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674444_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674474_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674489_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674494_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925365_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925367_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925377_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925387_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925406_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925408_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT111596_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426346_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426347_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426349_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426350_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426351_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426353_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426356_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426357_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426358_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426359_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426360_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426361_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426362_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426364_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426365_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426366_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426367_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426368_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426369_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426370_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426372_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426373_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426374_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426375_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426376_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426377_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426378_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426379_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426380_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426381_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426382_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426383_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426384_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426385_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426386_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426387_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426388_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426389_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426390_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426391_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426392_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426393_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426394_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426396_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426397_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426398_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426399_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426400_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426401_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426402_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426403_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426404_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426405_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426406_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426407_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426408_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426410_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426411_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426412_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426413_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426414_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426415_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426416_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426417_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426418_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426419_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426421_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426422_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426423_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426424_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426425_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426426_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426427_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426428_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426429_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426430_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426431_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426432_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426433_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426434_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426435_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426436_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426438_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426439_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426440_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426441_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426442_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426443_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426444_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426446_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426447_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426450_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426452_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426453_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426454_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB205125_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC592171_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC592172_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674502_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU498227_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774226_SP_P-C      atgcccctatcttatcaacccttccgaaaact----actgttgttaaaca
JQ341614_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagagg
EU939541_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774240_SP_P-C      atgcccctattttatcaacacttccggaaact----actgttgttaaacg
KF873536_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
KF873528_SP_P-C      atgcccctatcttatcaacacytccggaaact----actgttgttagacg
KU679960_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacc
KU679951_SP_P-C      atgcccctatcctatcaacgcttccggaract----actgttgttagacg
KU679947_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU679957_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU679949_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacc
KU679936_SP_P-C      atgcccctatcttatccacacttccggaaact----actgttgttagacg
KF873514_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF873516_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF873520_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF873525_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF873526_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF873529_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF873539_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF873541_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF873544_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU679937_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040167_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB241112_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX276855_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
JQ040132_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY220702_SP_P-C      atgcccctatcttatcaacccttccggaaact----actgttgttagacg
KJ717804_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagatg
KJ803794_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagatg
FJ386640_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagatg
AB493839_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386601_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562334_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013799_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013800_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
KR013801_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT114171_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagatg
EU717215_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY206388_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttaga--
AB014388_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU560439_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363260_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
EU670263_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KC774319_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagaca
JQ040135_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY220700_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
EU939603_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
HM011472_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttattagacg
MK818227_SP_P-C      atgcccctatcttatcaacacttccggaract----gctgttattagacg
FJ386604_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787437_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826136_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttaaacg
KY881816_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagatg
KU964064_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014048_SP_P-C      atgcccctatcttatcaacacttccggaagct----actgttgttagacg
KR013878_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700529_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY220699_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagatg
EU554540_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagatg
AB176642_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
KR014016_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
AB670242_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttrttagacg
AB493844_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB111115_SP_P-C      aggcccctatcatatcaacacttacggaaact----actgatgctagacg
JQ040139_SP_P-C      atgcccctatcttatccacacttccggaaact----actgttgttagaca
FJ386617_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670253_SP_P-C      atgcccctatcctatcaacacttccggaaact----gctgttattagacg
KY363266_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363267_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB176643_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
FJ899789_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU796069_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
KJ598660_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598656_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598654_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598657_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598653_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598648_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598661_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598641_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598642_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598635_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598636_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598638_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598639_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598640_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598645_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598646_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598647_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598649_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598650_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598651_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598652_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598655_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598658_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598659_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598637_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598644_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774269_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715343_SP_P-C      atgcccttttcttatcaacactcgcggaaact----actgttgttagacg
FJ562337_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
FJ562261_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
FJ562245_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939573_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014391_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598662_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598663_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598664_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598665_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598666_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598667_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598668_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598669_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598670_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598671_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598672_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598673_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598674_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598676_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598677_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ598678_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KR013842_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013847_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013848_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013844_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013845_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013849_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
X52939_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagaca
MG826134_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881991_SP_P-C      atgcccctatcttatcaacgcttccggaaact----actgttgttagacg
KY881976_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881819_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttggacg
KY881815_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KY881809_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
KY881805_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
KY881802_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KY363258_SP_P-C      atgcccctatcttatccacacttccggaaact----actgttgttagacg
KY363252_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC793107_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
KC774284_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787459_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715404_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386638_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386626_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
EU939566_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
EF137802_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ993181_SP_P-C      atgcccctatcttatcaacacttccggaaact----cctgttgttagacg
AY641563_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
AB670274_SP_P-C      atgcccctatcttatcaacacttccggaaact----actrttgttagacg
AB670268_SP_P-C      atgcccctatcttatcmacacttccggaaact----actattgttagacg
AB367433_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
AB195945_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
AB111113_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014393_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
AB014384_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB675674_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB675675_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC792995_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
FJ787451_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562230_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EF137803_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
AY206384_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367403_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426577_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426578_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014364_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173291_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173292_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173303_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG893558_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881966_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881971_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN400087_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN400089_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426624_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426615_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426612_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426610_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426609_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426603_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426599_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426588_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426584_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426579_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426580_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426581_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426582_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426583_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426585_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426586_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426587_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426589_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426590_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426591_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426592_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426593_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426594_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426595_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426596_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426597_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426598_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426600_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426601_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426602_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426604_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426605_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426606_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426607_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426608_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426611_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426613_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426614_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426616_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426617_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426618_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426619_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426620_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426621_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426622_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426623_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426625_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426626_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426627_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426628_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426629_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426631_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426632_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426633_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426634_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426635_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426636_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426638_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426639_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426640_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426641_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426642_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426643_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013943_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173287_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939593_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670294_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014381_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB026811_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB026812_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB026813_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB026814_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY641558_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032331_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386577_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN400088_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173288_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013791_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774321_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
KC774361_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
KU964046_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964042_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964039_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774206_SP_P-C      atgcccctatcttatcgacacttccggaaact----actgttgttagacg
KU964034_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964035_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964036_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964037_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964038_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964040_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964041_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964043_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964044_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964045_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964047_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964048_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386611_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013883_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013885_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787439_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787479_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787441_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363277_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963937_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774288_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828916_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828919_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377591_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377545_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386623_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032336_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU872012_SP_P-C      atgcccctatcttatcaacactttcggaaact----actgttgttggacg
EU522069_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089796_SP_P-C      atgcccctatcttatcaacgcttccggaaact----actgttgttagacg
KC774221_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013882_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013890_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598716_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774253_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089794_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173317_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173318_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426849_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426677_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426681_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013993_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774340_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774330_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774325_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774306_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774302_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774300_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774282_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774238_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700517_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562323_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562256_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562252_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562250_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715341_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787450_SP_P-C      ------ctatcttatcaacacttccggaaact----actgttgttagacg
GQ377529_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774204_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774280_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774285_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774296_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774298_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774303_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774304_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774308_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774351_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013817_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013818_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013819_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT364751_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT364752_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386664_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032338_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032339_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363276_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871980_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871998_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB198083_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014390_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014377_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB300362_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY247031_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871982_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386619_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562225_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475305_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475329_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475339_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475346_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377624_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC792862_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598756_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KJ598757_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KJ598765_SP_P-C      atgcccctatcttatcaacacctacggaaact----actgttgttagacg
KR013771_SP_P-C      atgcccctatcttatcgacacttccggaaact----actgttgttagacg
KY881810_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttaaacg
KY881807_SP_P-C      atgcccctatcttaccaacacttccggaaact----actgttgttagacg
KY881803_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KY881806_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881811_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881814_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KY881818_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
FJ562255_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
EU439025_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
EU439010_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
EU439011_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
DQ377160_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
EU439008_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
EU439012_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
EU439009_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
EU306724_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
EU306726_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
EU306728_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
FJ715379_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013942_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
KR013788_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
KR013790_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
KR013789_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
KC774335_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774213_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774214_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774211_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM750136_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774189_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774256_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774277_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774254_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013805_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386614_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013804_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013807_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013984_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013803_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939558_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013808_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562242_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
FJ386652_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
AB250109_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagatg
EU939555_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
AB367413_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ536411_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ536413_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598780_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
KJ598779_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
KJ598772_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
AF223961_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
KJ598774_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
KJ598775_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
KJ598776_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
KJ598778_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
MN683728_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475350_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774337_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787474_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013915_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939643_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU872008_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787485_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787482_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787483_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787488_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787489_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826124_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774191_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279276_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
D23682_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttattagaca
D23683_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttattagaca
KC792759_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
AB670270_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
AB670308_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
AB670246_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670248_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899773_SP_P-C      ---cccctatcttatcaacacttccggaaact----actgttgttagacg
MG826140_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacc
MG826138_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826132_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826129_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826128_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881962_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881990_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881817_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881812_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881804_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470930_SP_P-C      atgcccctatcttatcaacacttacggaaact----actgttgttagacg
KY470927_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363274_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363261_SP_P-C      atgcccctatcttatcaacactttcggaaact----actgttgttagacg
KU964343_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagagg
KR014013_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KR014008_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagaca
KR013812_SP_P-C      atgccccaatcttatcaacacttccggaaact----actgttgttagacg
KR013802_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013778_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013766_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173295_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
KC774353_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040161_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
JQ040143_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GU357845_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377609_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377586_SP_P-C      atgcccctatcttatcaacacttccggaaact----tctgttgttagacg
FJ899772_SP_P-C      atgcccctatcttatcaagacctccggaaact----actgttgttagacg
FJ899768_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787484_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787462_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562266_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562251_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562238_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562220_SP_P-C      atgcccctatcctatcaacacttccggaaact----gctgttgttagacg
FJ518810_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386673_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386630_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939658_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939646_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939645_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
EU939605_SP_P-C      atgcccctatcttatcaatacttccggaaact----actgttattagacg
EU939571_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939553_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939539_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
EU919169_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916237_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916214_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU872013_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU570067_SP_P-C      atgcccctatcttattaacacttccggaaact----actgttgttagacg
EU554541_SP_P-C      atgcccctatcctatcaatacttccggaaact----actgttgttagacg
EU554536_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU522071_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
DQ986375_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ980551_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagaca
DQ980547_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ975274_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ922649_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ377165_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ377164_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY220701_SP_P-C      atgcccctatcttatcaactcttccggaaact----actgttgttagacg
AY206392_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF411412_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
AF363961_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB697510_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttcttagacg
AB670306_SP_P-C      atgcccctatcttatcaacacttccggaaact----actrttgttagacg
AB670277_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670238_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367421_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB111120_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB111118_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB111112_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB106895_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB042282_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB042283_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377557_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
GQ475318_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774334_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KC774311_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040149_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828937_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939649_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ922651_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670264_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367405_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014396_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916238_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562297_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470882_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470885_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470887_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470890_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470891_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470879_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470875_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470874_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367395_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089797_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470877_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470880_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470886_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470888_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470878_SP_P-C      atgcccctatcttatctacacttccggaaact----actgttgttagacg
KY470884_SP_P-C      atgcccctatcttatctacacttccggaaact----actgttgttagacg
KY470873_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470876_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470881_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470883_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470889_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470892_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013811_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013809_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013813_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013814_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013815_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670262_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
EU306729_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013767_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707725_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707719_SP_P-C      atgcccctatcttatcgacacttccggaaact----actgttgttagacg
JQ707717_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707716_SP_P-C      atgcccctatcttatcaactcttccggaaact----actgttgttagacg
JQ707708_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707710_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707711_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707712_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707718_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707720_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707721_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707722_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707724_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707726_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707727_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707728_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707729_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707731_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707732_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707733_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707723_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013875_SP_P-C      acgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013833_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939654_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939644_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939556_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB033551_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881997_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881883_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881872_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881882_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881980_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787457_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787458_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF461358_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF461359_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF411410_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX504541_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774352_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787463_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787453_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787454_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF533983_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB111116_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306672_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AP011106_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306671_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AP011107_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826131_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826133_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826135_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826137_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173306_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939586_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939543_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939597_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386596_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386597_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386687_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562239_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040144_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964004_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475316_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475327_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475334_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ358158_SP_C-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475312_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KM875423_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871978_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871979_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014395_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014383_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014389_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
D23684_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774237_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562335_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377552_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774272_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939536_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
EU439013_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
KU963997_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
KC774281_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715365_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562280_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939611_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU796070_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU796072_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF411408_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF411411_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014378_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB697500_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
D23680_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774354_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX026880_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562270_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562241_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306725_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939659_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899761_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899765_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964201_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964204_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964207_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964208_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964210_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964211_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964213_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU717212_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
EU554542_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
FJ032345_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
AB014374_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
EU939537_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
FJ562329_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
KR013846_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881981_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386602_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
AB367408_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173302_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363254_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470926_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032340_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032341_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670304_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774279_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB300368_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT284754_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014399_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
FJ386657_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
KF779327_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826139_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426630_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG893560_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG893557_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826122_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
KY882003_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881998_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881994_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881989_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881983_SP_P-C      atgcccctaccttatcaacacttccggaaact----actgttgttagacg
KY881978_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881972_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881965_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881964_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881963_SP_P-C      atgcccctatcttatcaacactttcggaaact----actgttgttagacg
KY881938_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881939_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881940_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881941_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881942_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881943_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881959_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881969_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881996_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881920_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881928_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881937_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881999_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881916_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881915_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881890_SP_P-C      atgcccctatcttatcaacacttccagaaact----actgttgttagacg
KY881887_SP_P-C      atgcccctatcttatcaacacttccgggaact----actgttgttagacg
KY881885_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881876_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881873_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881737_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881744_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881765_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470925_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470895_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470899_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470903_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363281_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363280_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363275_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964350_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964354_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964355_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964359_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964365_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964349_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964358_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964363_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964198_SP_P-C      atgcccctatcttatcaacacttccggaaaat----actgttgttagacg
KU964180_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963996_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
KU964002_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
LC279250_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
LC279252_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
KU963882_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT284758_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014092_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014049_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014043_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014018_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KR014017_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KR014015_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KR014014_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KR014012_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KR014011_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KR014010_SP_P-C      atgcccctatcttatcaacacctccggaaact----actgttgttagacg
KR013923_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013872_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013874_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013876_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014099_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013860_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013853_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013852_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013831_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013828_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013796_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013795_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013769_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013765_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013764_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013762_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598777_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
KJ598768_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598703_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598691_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173443_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173444_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173319_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173321_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173304_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173307_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173308_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF214677_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC875263_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774355_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774348_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774290_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774286_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774271_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774247_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774244_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774327_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774232_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774231_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
KC774223_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774219_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774208_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774202_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774196_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774336_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774195_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774187_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774179_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
KC774297_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
JX661490_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX661489_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX504539_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX504536_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgctagacg
JX429917_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX504544_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774359_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013792_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013793_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013794_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014059_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX429913_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX429905_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC792658_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX026885_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX026878_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX026877_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707707_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707709_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707713_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707715_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ707730_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040164_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040156_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040154_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040152_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040127_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
X04615_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN315779_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM750141_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM750140_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM750137_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM750132_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM011465_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475356_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475353_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475342_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475321_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475310_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377619_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377600_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377631_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377585_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173433_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173434_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377576_SP_P-C      atgcccctatcttatcaacacttccggaaact----acagttgttagacg
GQ377575_SP_P-C      atgcccctatcttatcaacacttccggaaact----acagttgttagacg
GQ377570_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377546_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377526_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774209_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774343_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377524_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
GQ227695_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899788_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899769_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899770_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787469_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715424_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715422_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttatacg
FJ715418_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715405_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715406_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ227693_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715389_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715383_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715403_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715374_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715359_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715351_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715390_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715344_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715342_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562327_SP_P-C      atgcccctatcttatcatcacttccggaaact----actgttgttagacg
FJ562319_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562315_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562313_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562264_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562244_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562233_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562228_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagagg
FJ386667_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386651_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386650_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386609_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562273_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386595_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386592_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377621_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881813_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386591_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032361_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939648_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377521_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040155_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF214651_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939592_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939572_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939574_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX504542_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939564_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939562_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939540_SP_P-C      atgcccctatcttgtcaacacttccggaaact----actgttgttagacg
EU916215_SP_P-C      atgcccctatcttatcaacacttccgggaact----actgttgttagacg
EU916212_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916211_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916210_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU872000_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU872001_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU872002_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU872003_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU872004_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871976_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU589345_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU562216_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU554537_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013919_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU522068_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU439016_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306727_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306721_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306719_SP_P-C      atgcccctatcttatcagcacttccggaaact----actgttgttagacg
EU305542_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU305541_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ683578_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ377162_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089800_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377533_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX661492_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774200_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774205_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774261_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774262_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774278_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774342_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774345_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173313_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173314_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
D50519_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagacg
D23681_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttattagacg
D12980_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagacg
D00630_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF458664_SP_P-C      atgcccctatcttatcaacacttccgggaact----actgttgttagacg
AB670302_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939594_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386603_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670282_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670267_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670261_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386616_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670255_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
EU939548_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
AB670252_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670251_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386679_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670241_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB642099_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377562_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM011489_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB642097_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367804_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367430_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670309_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916216_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377517_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475306_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475308_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475311_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475313_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475315_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475320_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475331_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475347_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341662_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX429907_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX429909_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774266_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774331_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173439_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173440_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013829_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013830_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013832_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013834_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470929_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470933_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470934_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367423_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB365451_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB300372_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB299858_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367428_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367432_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB426467_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY167090_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY596108_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU305540_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939642_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386574_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386594_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386618_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386639_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386644_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562235_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562308_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715355_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715357_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377551_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377584_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040163_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040172_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX429915_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX429918_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774315_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774318_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173331_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173332_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173391_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173392_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KM213037_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013859_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013861_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013862_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT284759_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964187_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964188_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964191_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964192_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964193_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964194_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964195_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964196_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964197_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964199_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964352_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964356_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964357_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964360_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964361_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964362_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964364_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881917_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881918_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881919_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881921_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881922_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881923_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881924_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881925_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881926_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881927_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881929_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881930_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881931_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881932_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881933_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881934_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881935_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881936_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881967_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881970_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881975_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881977_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881982_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881985_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881986_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881992_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881995_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY882000_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB222714_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB222715_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB205124_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB202071_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB202072_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB198080_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB198077_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367410_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670285_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670305_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ536410_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ536412_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ536414_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715352_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715353_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475307_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475317_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM750138_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774210_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774333_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774347_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598766_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598769_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598770_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598771_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB195949_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB182589_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU881999_SP_P-C      ---cccctatcttatcaacacttccggaaact----actgttgttagacg
EU939567_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939612_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939647_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562293_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562324_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX026884_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014041_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014098_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279251_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279253_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB113879_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
EU939570_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
AB111119_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB111114_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881892_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB049610_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB362932_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939590_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939591_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899777_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173281_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173282_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB033553_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB033552_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB033556_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670254_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB697494_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY066028_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386663_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ518813_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377578_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF485389_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT284755_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964169_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964174_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964176_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964177_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964178_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964179_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964181_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964182_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964183_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964184_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB033550_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014397_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014394_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939546_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939585_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475325_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964076_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG893556_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014360_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU439014_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774184_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774220_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774243_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598689_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598693_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598694_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598698_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598699_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598702_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KY881891_SP_P-C      atgcccatatcttatcaacacttccggaaact----actgttgttagacg
KR013768_SP_P-C      atgtccctatcttatcaacacttccggaaact----actgttgttagacg
AB014362_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014376_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB026815_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB195942_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB195947_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB195948_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB198076_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB198078_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB198079_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB246345_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB288026_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB300359_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB300365_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367424_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB471848_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB471849_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB471850_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB485808_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB640730_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670247_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670256_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670266_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670269_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670276_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670283_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670287_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670290_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670291_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670295_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670297_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670301_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670307_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670311_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB675677_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB900099_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AP011098_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY247032_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089793_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ377161_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ377163_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ975273_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ980550_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306673_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306674_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306675_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306713_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306714_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306720_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU439005_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU439015_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU554538_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU554539_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU562218_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU570068_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU872010_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU882000_SP_P-C      ---cccctatcttatcaacacttccggaaact----actgttgttagacg
EU916213_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916217_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916229_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939538_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939544_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939554_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939561_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939563_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939576_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939580_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939587_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939604_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939610_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939618_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939640_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032332_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386575_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386587_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386598_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386605_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386627_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386637_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386662_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386685_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562218_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562243_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562249_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562268_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562274_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562275_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562283_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562285_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562290_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562301_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562330_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562332_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562333_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715358_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715375_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715376_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715377_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715378_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715380_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715381_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715392_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715407_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715409_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715421_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787468_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899763_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899764_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899771_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899775_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ227694_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ227696_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ259588_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377523_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377527_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377530_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377535_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377540_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377541_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377553_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377554_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377559_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377563_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377574_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377579_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377580_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377598_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377603_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377617_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377618_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377637_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377640_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475314_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475319_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475322_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475324_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475330_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475332_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475337_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475348_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ872210_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GU434374_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040129_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040162_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040165_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040166_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341648_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341658_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ688404_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX429903_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX429904_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX429906_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX429912_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX429916_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX504546_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX661491_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX661493_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX661495_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774181_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774185_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774190_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774192_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774203_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774218_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774224_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774233_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774241_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774248_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774249_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774250_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774251_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774255_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774257_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774259_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774268_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774270_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774274_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774275_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774276_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774292_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774293_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774295_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774299_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774309_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774310_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774312_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774326_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774329_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774339_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774356_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774357_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774360_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC875262_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF779300_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173283_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173284_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173294_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173310_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173315_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173316_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173395_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173396_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173426_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173427_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173428_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410505_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598680_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598681_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598688_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598690_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598695_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598696_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598697_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598701_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP027477_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KP784761_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013761_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013763_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013773_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013774_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013776_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013777_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013850_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013851_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013858_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013873_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013877_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013908_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013909_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT284756_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963871_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963872_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963873_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963874_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963875_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963876_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963877_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963878_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963879_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963880_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963881_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963884_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963885_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963992_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964065_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964066_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964067_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964068_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964069_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964070_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964071_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964072_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964073_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964074_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964075_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964077_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964078_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964171_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964172_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964173_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964175_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964334_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964336_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964337_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964338_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964339_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964340_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964342_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964344_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964345_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964346_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964347_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964348_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY022423_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363268_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470894_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470896_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470897_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470900_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470901_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470902_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470904_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470905_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881736_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881738_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881739_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881742_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881743_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881748_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881749_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881750_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881751_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881754_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881755_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881758_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881762_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881763_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881764_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881766_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881767_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881768_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881769_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881770_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881771_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881772_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881773_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881774_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881775_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881776_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881777_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881870_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881875_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881877_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881879_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881881_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881884_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881960_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881961_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881974_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881984_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881987_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881988_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881993_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY882001_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY882002_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC090200_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279258_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC373511_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC373512_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MH094411_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MN683726_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MN683727_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MN683729_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF053181_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803774_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM011479_SP_P-C      atgcccctatcttatcaacacttccggaaact----rctgttgttagacm
KX276837_SP_P-C      atgcccctatcttatcaacacttccggaaact----rctgttgttagacc
AB241113_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341632_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagatg
GQ924622_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
KM875412_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
KJ717799_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803790_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924620_SP_C-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU410080_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
AP011100_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB241111_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB241110_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU410081_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU410079_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014082_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014078_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014077_SP_P-C      atgcccctatcttatcaacacttccgggaact----actgttgttagacg
KR013871_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013870_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173335_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173336_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014083_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN827414_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF241410_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF241411_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN827415_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AP011099_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AP011101_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG571359_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
AY596107_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC792902_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
DQ089786_SP_P-C      atgcccctatcttatccacacttccggaaact----actgttgttagaca
FJ715364_SP_P-C      atgcccctatcttatcaacacttcccgaaact----actgttgttagacg
KX276850_SP_P-C      atgcccctatcttatcaacacttccggaaact----kstgttgttagaca
KY363287_SP_P-C      atgcccctatcctatcaacgcttccggaaact----actgttgttagacg
KY363285_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341643_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY206386_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014386_SP_P-C      atgcccctatcttatcatcacttccggaaact----tgtgttattagacg
KF053170_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
KJ803762_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
EU939569_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagatg
KR819180_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
HM011488_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013869_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ638218_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386661_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagatg
DQ089795_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367402_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363286_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
JQ341656_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ027322_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899778_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787448_SP_P-C      atgcccctatcttaccaacacttccggaaact----actgttgttagacg
FJ032355_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU589344_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367420_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttattagacg
AB367409_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB300373_SP_P-C      atgcccctgtcttatcaacacttccggaaact----actgttgttagacg
AB014398_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagaca
FJ386624_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ372968_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032333_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386665_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700506_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM011491_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787442_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787443_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB113877_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttgttagacg
AB014382_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787481_SP_P-C      atgcccctatcttatcaacacttccggaaact----accgttgttagacg
EU589342_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU589340_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU589341_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562276_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB971714_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB971715_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
X75665_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426282_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426250_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013865_SP_P-C      atgcccctatcttatcaacactcccggaaact----actgttgttagacg
KJ173296_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
KF214652_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
KF053175_SP_P-C      atgcccctatcttgtcaacacttccggaaact----actgttgttagacg
KJ803769_SP_P-C      atgcccctatcttgtcaacacttccggaaact----actgttgttagacg
KC774217_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774215_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774216_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX504534_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341657_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
JQ341628_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341621_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagayg
GQ924655_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
GQ377605_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715366_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562292_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
FJ386677_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386621_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032356_SP_P-C      atgcccctatcttatccacacttccggaaact----actgttgttagacg
EU939596_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
EU919168_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916222_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU560438_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670273_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
AB367404_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
AB300360_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014363_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828929_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828923_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828924_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828925_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828926_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828930_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828931_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828921_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828922_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828928_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX560520_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828918_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgtcgttagacg
JF828913_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828917_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828920_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ227697_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ227692_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgtcgttagacg
FJ787467_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787466_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787447_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386653_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386579_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032351_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939653_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB697490_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367803_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367411_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367398_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367397_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386628_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787445_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367396_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB195943_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB195944_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367392_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367399_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367412_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367414_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367416_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670275_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EF536065_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386629_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787464_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787465_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040168_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EF536066_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF828915_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032359_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
FJ386659_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
FJ032360_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939655_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939656_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939641_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964185_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964186_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964189_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964190_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774197_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562291_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023639_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY167092_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB300361_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377608_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
KR013866_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013863_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013864_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013867_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX661496_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939584_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF384371_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU560441_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787486_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899776_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377571_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377599_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377615_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173431_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173432_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032346_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
KC774320_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
KC875264_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
KC875265_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
KC875273_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
KJ717790_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
KJ803779_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
EU579443_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttgttagacg
FJ032347_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttgttagacg
FJ562221_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
EU560440_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
EU579442_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
EU589336_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
KC875261_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtgttgttagacg
FJ386645_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774245_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386589_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562258_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562299_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM750131_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173435_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173436_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774346_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562272_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562281_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040145_SP_P-C      atgcccctatctkatcaacacttccggaaact----actgttgttagacg
KC774180_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF925394_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
JQ341649_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
GQ377597_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939614_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964341_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670239_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
AB670240_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
EU916218_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939557_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939613_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386625_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386632_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JF436920_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774199_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JN827420_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB246346_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089760_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801509_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341611_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341664_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089792_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341659_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341655_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341639_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341633_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023648_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341617_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX765852_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363284_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475351_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475336_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377538_SP_P-C      atgcccctatcttatcaacacttcctgaaact----actgttgttagacg
GQ475328_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964318_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964321_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964326_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964327_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964333_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964319_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964322_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964323_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964324_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964325_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964328_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964329_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964330_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964331_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964332_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB298720_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB298721_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964320_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475341_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774182_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426841_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC793024_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ027323_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367417_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF053172_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173393_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173394_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ803765_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939588_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU562215_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU562217_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386631_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774225_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ622095_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
AB367425_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
AB642100_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
AB900116_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
MH887433_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
AB195936_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
AB670281_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
GQ475309_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
MH891502_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
AB195937_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
AB195938_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttgttagacg
KC774242_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916219_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386671_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386678_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787452_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475344_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB042284_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279254_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279255_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279256_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279257_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377636_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939616_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386576_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562318_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715367_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377518_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774252_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715402_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF286594_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB471851_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB471852_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB471853_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715382_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377616_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367422_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB642095_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
AB367401_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367407_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ975272_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964200_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964202_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964203_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964205_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964206_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964209_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964212_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426249_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX429914_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341670_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787449_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939615_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916225_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916223_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916224_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB198081_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB198082_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386588_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377514_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377528_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377577_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377601_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377628_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040151_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774194_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KM229703_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426248_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426302_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562232_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562282_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377572_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX560519_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939582_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040158_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475343_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagagg
GQ475352_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagagg
DQ986376_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670243_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014369_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB042285_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173430_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367435_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377543_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475326_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX661488_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774314_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173429_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173311_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363256_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363257_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX276831_SP_P-C      atgcccctatcttatcaacacttccggaaayt----actgttrttagaym
AB115417_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899795_SP_P-C      atgcccctatcttatcaacacttccggagact----actgttgttagacg
AB670298_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
EU939617_SP_P-C      atgcccctatcttatcaacacttccggaatgt----actgttattagaca
AB195932_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttattagaca
AB113878_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttattagaca
AB195931_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttattagaca
AB195930_SP_P-C      atgcccctatcctatcaacacttccggaaact----actgttattagaca
AB697502_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
KJ410521_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagaca
HM011481_SP_P-C      atgcccctatcttatcaacacttcckgaaact----actgttattagacg
KX276839_SP_P-C      atgcccctatcttatccacacttccggaaact----actgttattagacg
DQ993690_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899793_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899794_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU919165_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
GQ358157_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700522_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700543_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341634_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426743_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426679_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426680_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013780_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC793097_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ801500_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM011500_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacc
EU916227_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ478900_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgtagttagacg
MT426838_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341665_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagayg
FJ787461_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU919164_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
AY206378_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY167096_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagatg
MT426848_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826143_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363264_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX276838_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774316_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM011502_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715391_SP_P-C      atgcccctatcttatcaacacttcgggaaact----actgttgttagacg
FJ032334_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU881996_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ993692_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ478885_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426731_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426858_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426756_SP_P-C      atgcccctatcttatcaactcttccggaaact----actgttgttagacg
MT426760_SP_P-C      atgcccctatcttatcaactcttccggaaact----actgttgttagacg
MT426761_SP_P-C      atgcccctatcttatcaactcttccggaaact----actgttgttagacg
KY881889_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715368_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013783_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774313_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426737_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426659_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426683_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014380_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089799_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774229_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426847_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426811_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG893553_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013786_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF485390_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774260_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774267_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX661497_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM750135_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475323_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562331_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386670_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939549_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY167099_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014371_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939600_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB050018_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB111124_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB111125_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB246344_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939652_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562307_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377515_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377531_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475338_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM750134_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774264_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774338_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410510_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KM359441_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013779_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013781_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013782_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013784_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013785_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT284753_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279245_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279246_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279247_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279248_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
LC279249_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916204_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715350_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715370_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173309_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426854_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426853_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426850_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426845_SP_P-C      atgcccctatcttatctacacttccggaaact----actgttgttagacg
MT426843_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426839_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426837_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426829_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426818_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426804_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426797_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426819_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426795_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426796_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426793_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426781_SP_P-C      atgcccctatcttatctacacttccggaaact----actgttgttagacg
MT426776_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426766_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426754_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426750_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426745_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426729_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426717_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426692_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426673_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426672_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426666_SP_P-C      atgcccctatcttatcaacacgtccggaaact----actgttgttagacg
MT426650_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426773_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426775_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426649_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426739_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KX276835_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC792799_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ027319_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ151413_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ993691_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY206382_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426780_SP_P-C      atgcccctctcttatcaacacttccggaaact----actgttgttagacg
MT426663_SP_P-C      atgcccatatcttatcaacacttccggaaact----actgttgttagacg
AY206389_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ993693_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562284_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ751770_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924633_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ341636_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC792921_SP_P-C      ----ccctatcttatcaacacttccggaaact----actgttgttagacg
KC792999_SP_P-C      ----ccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173327_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173328_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173441_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173442_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173446_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ790199_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426644_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426645_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426646_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426647_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426648_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426651_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426652_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426653_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426654_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426655_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426656_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426657_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426658_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426660_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426661_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426662_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426664_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426665_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426667_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426668_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426669_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426670_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426671_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426674_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426675_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426676_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426678_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426682_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426684_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426685_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426686_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426687_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426688_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426689_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426690_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426691_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426693_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426694_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426695_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426696_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426697_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426698_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426699_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426700_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426701_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426702_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426703_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426704_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426705_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426706_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426707_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426708_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426709_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426710_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426711_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426712_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426713_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426714_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426715_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426716_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426718_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426719_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426720_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426721_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426722_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426723_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426724_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426725_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426726_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426727_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426728_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426730_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426732_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426733_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426734_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426735_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426736_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426738_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426740_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426741_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426742_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426744_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426746_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426747_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426748_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426749_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426751_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426752_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426753_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426755_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426757_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426758_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426759_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426762_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426763_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426764_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426765_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426767_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426768_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426769_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426770_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426771_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426772_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426774_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426777_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426778_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426779_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426782_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426783_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426784_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426785_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426786_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426787_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426788_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426789_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426790_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426791_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426792_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426794_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426798_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426799_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426800_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426801_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426802_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426803_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426805_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426806_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426807_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426808_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426809_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426810_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426812_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426813_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426814_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426815_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426816_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426817_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426820_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426821_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426822_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426823_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426824_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426825_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426826_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426827_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426828_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426830_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426831_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426832_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426833_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426834_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426835_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426836_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426840_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426842_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426844_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426846_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426851_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426852_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426855_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426856_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MT426857_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
V00867_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562326_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
HQ700576_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagayg
HQ700457_SP_P-C      atgcccctctcttatcaacacttccggaaact----actgttgttagacg
HQ700562_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700570_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700504_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700568_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700502_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700545_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700563_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700564_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700565_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700573_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700574_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700556_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700569_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700577_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700578_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700575_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700496_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700476_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700571_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700566_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700559_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700544_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700555_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700558_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700561_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700572_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700456_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700475_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700490_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700567_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700495_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598760_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY206381_SP_P-C      atgcccctatcttatcaacacttccggagact----tgtgttattagacg
GQ377623_SP_P-C      atgcccctatcttatcaacacttccggaaatt----actgttgttagaca
EU939583_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagatg
FJ787470_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787471_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
AB014372_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC792753_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagaca
GU721029_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KF214675_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670260_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttrttagatg
AB670237_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HQ700516_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU547559_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacc
D28880_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagacg
S75184_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ410514_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttcttagacg
EU570073_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU570074_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598720_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagatg
KU964238_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagatg
KU964243_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagatg
KJ598726_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagatg
KU964236_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagatg
KJ598737_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598739_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598731_SP_P-C      atgcccctatcttatccacacttccggaaact----actgttattagacg
KU964229_SP_P-C      atgcccctatcttatccacacttccggaaact----actgttattagacg
KJ598722_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598725_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598733_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598735_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KU964237_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KU964241_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598721_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KU964242_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598723_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598724_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598727_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598728_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598729_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598730_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598732_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598734_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598736_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KJ598738_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KU964230_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KU964231_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KU964232_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KU964233_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KU964234_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KU964235_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KU964239_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
KU964240_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
FJ787490_SP_P-C      atgcccctatcttatcaacacttccggaaact----actattgttagacg
AB014373_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470980_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470981_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470982_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470984_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470988_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470983_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470985_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470986_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470987_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470990_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470991_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774235_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JX504537_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173334_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173333_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826126_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC793046_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY670782_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562300_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY629631_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MG826127_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF495606_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY629637_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963904_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377555_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
HM011493_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963900_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963901_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963902_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963903_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963905_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963906_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963907_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963908_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963909_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963910_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963911_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963912_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963913_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963914_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC792831_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU717217_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598762_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939599_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU547562_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagagc
AB014365_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ089758_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ924642_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KT284757_SP_P-C      atgcccctatcttatcaacacttccggaaagt----actgttgttagagg
KC792710_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939657_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY641562_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF182804_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670279_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670265_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB195946_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY206376_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY206379_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367426_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367801_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939579_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899774_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB111117_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ478899_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MK321266_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MK720629_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MK720630_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871974_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
AF182805_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF182802_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871973_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871970_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871972_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
D50520_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964011_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964012_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964013_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964015_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964016_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964017_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964018_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964019_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964014_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF182803_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871969_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871971_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386641_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475333_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC792834_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774265_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670310_SP_P-C      atgcccctatcttatcaacacttccggaaact----tgtattgttagacg
AB367427_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470977_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470976_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470975_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470971_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470972_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470967_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470966_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470965_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470969_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470974_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470968_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470970_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470973_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470978_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY470979_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881973_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ032350_SP_P-C      acgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670263_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
MH818373_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
EU939625_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598741_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598742_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598744_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598745_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598747_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598748_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598750_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598754_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598743_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598746_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598751_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598752_SP_P-C      atgcacctatcttatcaacacttccggaaact----actgttgttagacg
KJ598753_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014379_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014392_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
MF674428_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881880_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173305_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173290_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
KC774289_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377620_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ787487_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
FJ386647_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386607_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939651_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939601_SP_P-C      atgcccctatcttatcaacgcttccggaaact----actgttgttagacg
EU916234_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU916233_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ980549_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670259_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB485810_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367418_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367406_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014385_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU717218_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367429_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963920_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562340_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963915_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963916_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963917_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963918_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963919_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963921_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963922_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963923_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963924_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963925_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963926_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963927_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963928_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963929_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013868_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367434_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
DQ922650_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386612_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670272_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562279_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
KC774358_SP_P-C      atgcccctatcttatcaacacttccggaaact----gctgttgttagacg
D50517_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagatg
D50518_SP_P-C        atgcccctatcttatcaacacttccggaaact----actgttgttagatg
AB670300_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670249_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
JQ040141_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881979_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881888_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363282_SP_P-C      atgcccctatcttagcaacacttccggaaact----actgttgttagacg
KY363278_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363279_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363253_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014057_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013961_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013797_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598740_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598749_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598715_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598714_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598719_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598679_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598686_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KF214655_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774287_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475354_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ377583_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173437_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173438_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ899783_SP_P-C      atgcccctatcttatcaacacttccggaaatt----actgttgttagacg
FJ715372_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715371_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715360_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562339_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562306_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386613_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939626_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774207_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939619_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939550_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939595_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871975_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU871977_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU554535_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU306722_SP_P-C      atgcccctattttatcaacacttccggaaact----actgttgttagacg
AY641560_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF461357_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF461363_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670288_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670278_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670292_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY306136_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AY641561_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562288_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173338_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU964170_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881871_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881874_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881878_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY881886_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB367802_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939568_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ023656_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598718_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB113875_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
AB113876_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttattagacg
AB111123_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB111121_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB111122_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB014361_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AB670289_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
AF458665_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939545_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939560_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939607_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
EU939609_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ386672_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562248_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562269_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ562325_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715398_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
FJ715400_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475345_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475349_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ475357_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
GQ872211_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774239_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KC774301_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173289_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173293_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173301_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173312_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173337_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ173445_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598687_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598705_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598706_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598707_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598708_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598709_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598710_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598711_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598712_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598713_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KJ598717_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014055_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR014060_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963886_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963887_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963888_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963889_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963890_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963891_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963892_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963893_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963894_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963895_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963896_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963897_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963898_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KU963899_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KY363283_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg
KR013798_SP_P-C      atgcccctatcttatcaacacttccggaaact----actgttgttagacg

FJ562286_SP_P-C      ctgtggaaggctggcattctatataagagagaaactac------------
MG571345_SP_P-C      acgaggcaagccccc--------tagaagaagaactccctcgcctcgcag
JQ801518_SP_P-C      acgaggcaggtcgca--------tagaagaagaactccctcgcatagcaa
AB014387_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924629_SP_P-C      acgaggcaggtcccm--------tagaagaagaactccctcttcttgcag
AB115418_SP_P-C      ccgaggcaggtcctc--------tagaagaagaactccctcgcctcgcag
KJ717825_SP_P-C      acgaggcaggtccct--------tagaagaagaactccctcgcctcgcag
KJ803812_SP_P-C      acgaggcaggtccct--------tagaagaagaactccctcgcctcgcag
AB112066_SP_P-C      acgaggcaggtcccc--------tagaaagagaactccctcgcctcgcag
EU939552_SP_P-C      accaggcaggtcccc--------tagaaaaagaactccctcgcctcgcaa
AB112471_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX276836_SP_P-C      acgragcaggtccmt--------tagaagaagaactccctcgcctcgcag
KR014000_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC315399_SP_P-C      acgaggcaggccccc--------tagaagaagaactccctcgcctcgcag
KJ717821_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803809_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014006_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013827_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013998_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014007_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014002_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014005_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MK286461_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX276853_SP_P-C      acgwggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410511_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053184_SP_P-C      acgaggcaggtccct--------tagaagaagaactccctcgcctcgcag
KJ803777_SP_P-C      acgaggcaggtccct--------tagaagaagaactccctcgcctcgcag
JQ801508_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053168_SP_P-C      tcgaggcaggtccac--------tagaagaagaactccctcgcctcgcag
KJ803760_SP_P-C      tcgaggcaggtccac--------tagaagaagaactccctcgcctcgcag
HM011495_SP_P-C      acgargcaggacccc--------tagaagaagaactccctcgcctcgcag
KX276841_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC792911_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ361526_SP_P-C      acgaggcaggtcctc--------tagaagaagaactccctcgcctcgcag
JQ341653_SP_P-C      ccgaggcaggtcctc--------tagaagaagaactccctcgcctcgccg
GQ924619_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctygcag
AB014367_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801517_SP_P-C      acgacgcaggtccct--------tagaagaagaactccctcgcctcgcag
FJ562310_SP_P-C      cccaggcaggtccac--------tagaagaagaactccctcgcctcgcag
JQ027324_SP_P-C      acgaggcaggwcccc--------tagaagaagaactccctcgcctcgcag
KF214670_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
JX026888_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccttcgcctcgcag
JQ027332_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB031262_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386620_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964214_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386689_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964228_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964219_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964217_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964220_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964227_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964216_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964221_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM750139_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964218_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964222_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964224_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964225_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964215_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964223_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964226_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828905_SP_P-C      acgaggcaggtccct--------tagaagaagaactccctcgcctcgcag
JF828906_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828907_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828911_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828912_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828908_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828910_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717791_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801520_SP_P-C      acgaggcaggtcccc--------tagaagaaaaactccctcgcctcccac
GQ924643_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
EU570072_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089790_SP_P-C      acgaggcaggwcccc--------tagaagaagaactccctcgcctcgccg
AY167091_SP_P-C      acgaagcagggcccc--------tagaagaagaactccctcgcctcgcag
AB074047_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB931170_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
AB931171_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
MF925403_SP_P-C      acgaggcaggtccct--------tagaagaagaactccctcgcctcgcag
KX765828_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410518_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX507211_SP_P-C      acgaggcaggtccac--------tagaagaagaactccctcgcctcgcag
JQ429078_SP_P-C      ccggggcaggacccc--------tagaagaagaactccctcgcctcgcag
KF053185_SP_P-C      tcgcggcaggtcccc--------tagaagaagaactccctcacctcgccg
JX507212_SP_P-C      acgagkcaggtcccc--------tagaagaagaacctccccgcctcgcag
MT426312_SP_P-C      gcgaggcaggtcccc--------tagaagaagaactcactcgcctcgcag
MT426306_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgccttgcag
MT426287_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426267_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148559_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148493_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341631_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426277_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426288_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148567_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148483_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148491_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148479_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410493_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717812_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803800_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148476_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148520_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426326_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426319_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426314_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426298_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426297_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426292_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426284_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426310_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426283_SP_P-C      acgaggcaggtgccc--------tagaagaagaactccctcgcctcgcag
MT426280_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426279_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426266_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426265_SP_P-C      acgaggcaggtcgcc--------tagaagaagaactccctcgcctcgcag
MT426289_SP_P-C      acgaggcaggtcgcc--------tagaagaagaactccctcgcctcgcag
MT426264_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426254_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148570_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148564_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148557_SP_P-C      acgaggcaggtcccc--------tagaagaagaactcccccgcctcgcag
KP148547_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148546_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148543_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgctg
KP148540_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148535_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148534_SP_P-C      acgaggcaggtctcc--------tagaagaagaactccctcgcctcgcag
KP148525_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148488_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148473_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148465_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148315_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148463_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148464_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148466_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148468_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148469_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148470_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148471_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148472_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148474_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148475_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148477_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148480_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148481_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148482_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148487_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148489_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148492_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148512_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148513_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148514_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148517_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148521_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148523_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148524_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148526_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148528_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148529_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148531_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148532_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148537_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148538_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148545_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148548_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148549_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148551_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148554_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148555_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148558_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148560_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148561_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148562_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148563_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148566_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148571_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148572_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148573_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148574_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426251_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426252_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426253_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426255_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426256_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426257_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426258_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426259_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426260_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426261_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426262_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426263_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426268_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426269_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426270_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426271_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426272_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426273_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426274_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426275_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426276_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426278_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426281_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426285_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426286_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426290_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426291_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426293_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426294_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426295_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426296_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426299_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426300_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426301_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426303_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426304_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426305_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426307_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426309_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426311_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426313_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426315_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426316_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426317_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426318_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426320_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426321_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426322_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426323_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426324_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426325_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426327_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426329_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426330_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426331_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426332_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426333_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426334_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426335_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426336_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426337_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426338_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426339_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426340_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426341_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426342_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426343_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426344_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426345_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426328_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939542_SP_P-C      acgaggcaggcccac--------tagaagaagaactccctcgcctcgcag
FJ899767_SP_P-C      acgaggcaggcccac--------tagaagaagaactccctcgcctcgcag
JQ707768_SP_P-C      acgaggcaggtccac--------tagaagaagaactccctcgcctcgcag
JQ707769_SP_P-C      acgaggcaggtccac--------tagaagaagaactccctcgcctcgcag
JQ707770_SP_P-C      acgaggcaggtccac--------tagaagaagaactccctcgcctcgcag
JQ707771_SP_P-C      acgaggcaggtccac--------tagaagaagaactccctcgcctcgcag
JQ707772_SP_P-C      acgaggcaggtccac--------tagaagaagaactccctcgcctcgcag
JQ707773_SP_P-C      acgaggcaggtccac--------tagaagaagaactccctcgcctcgcag
JQ707774_SP_P-C      acgaggcaggtccac--------tagaagaagaactccctcgcctcgcag
KX276840_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013899_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053173_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803766_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341635_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341624_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB112063_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674430_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX276833_SP_P-C      acgaggtaggtccct--------tagaagaagaactccctcgcctcgcag
KR014021_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013839_SP_P-C      acgtggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717809_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC792880_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
JQ801510_SP_P-C      acaaggcaggacccc--------tagaagaagaactccctcgcctcgcag
JQ801478_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ027320_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924636_SP_P-C      acgaggcaggtccca--------tagaagaagaactccctcgcctcgcag
GQ924609_SP_P-C      acgaggcaggtctcc--------tagaagaagaactccctcgcctcgcag
EF494377_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089803_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
DQ089802_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
DQ089773_SP_P-C      acgaggcagctcccc--------tagaagaagaactccctcgcctcgcag
AY641559_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KF053177_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgccg
KJ803770_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgccg
MF674425_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674458_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053161_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803754_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT366464_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598761_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM011486_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089772_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB900113_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
AB112472_SP_P-C      acgaggcaggacccc--------tagaagaagaattccctcgcctcgccg
AB014368_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801515_SP_P-C      acgaagcaggacccc--------tagaagaagaactccctcgcctcgcag
JQ341619_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013820_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801523_SP_P-C      acgaggcaggtcccc--------tagaagaagaacacccacgcctcgccg
JQ341630_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089785_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT347089_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
JQ341626_SP_P-C      acgaggcagggcccc--------tagaagaagaactccctcgcctcgcag
MF488703_SP_P-C      acgaggcaggccccc--------tagaagaagaactccctcgcctcgcag
HM011468_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ904423_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
JQ801499_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KX276847_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717822_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803810_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN827423_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB112348_SP_P-C      acgaggccggtcccc--------tagaagaagaactccctcgcctcgcag
EU717214_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU872005_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475355_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964353_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ788835_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ151414_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF925409_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089804_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111946_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801491_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
MF925376_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ715415_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715416_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ027318_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367431_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089757_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341613_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803815_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803814_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717827_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717828_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX504535_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410519_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089801_SP_P-C      acgakgcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562298_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964020_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964021_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964022_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964023_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964024_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964025_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964026_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964027_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964028_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964029_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964030_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964031_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964032_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964033_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023652_SP_P-C      acgaggcaggtccac--------tagaagaagaactccctcgcctcgccg
JQ801472_SP_P-C      acgaggcaggtccac--------tagaagaagaactccctcgcctcgcag
MT426449_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MH220971_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF925405_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674471_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674417_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674399_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470911_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KX765855_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX276849_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964049_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964050_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964051_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964052_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964053_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964054_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964055_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964056_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964057_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964058_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964059_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964060_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964061_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964062_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964063_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013841_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013838_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013823_SP_P-C      acgaggcaggtcccc--------tagaggaagaactccctcgcctcgcag
KR013772_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148462_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgccccgcag
KM875429_SP_P-C      acgaggcgggtcccc--------tagaagaagaactccctcgcctcgcag
KM875428_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KM875406_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717826_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803813_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717823_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803811_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410491_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410492_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410494_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410499_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053193_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KF053164_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803757_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC875268_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX870000_SP_P-C      acgaggcaggtcccc--------tagaagaagawctccctsgcctcgcag
JQ801490_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341650_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
JQ341647_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341618_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562304_SP_P-C      gcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023646_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EF197911_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ361534_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcacctcgcag
DQ089791_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
DQ089778_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089759_SP_P-C      acgakgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF473543_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB900109_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
AB670258_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
AB367394_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB112408_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB112065_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013822_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcacctcgcag
KR013825_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013996_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013905_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013904_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013855_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013824_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013770_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341616_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089764_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ358154_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM011497_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013821_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013826_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013854_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013856_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013857_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013900_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013902_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881968_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470920_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023655_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB205123_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KM875424_SP_P-C      acggggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KM875425_SP_P-C      acggggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089776_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089777_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801489_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470915_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674475_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB368297_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826125_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765836_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX276854_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF223960_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598773_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562265_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY057947_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598767_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089775_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG571332_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF214668_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KC875267_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB247916_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426474_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426458_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426516_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426552_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426548_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787455_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787456_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KM875405_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ478901_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173285_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410495_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470914_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801503_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgccccgcag
DQ089780_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ358153_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717839_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803823_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU051424_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801521_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341612_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089756_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY206385_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT366463_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426348_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426354_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377642_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715395_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715397_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939578_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB195952_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB195953_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB195954_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279259_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279260_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279261_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279262_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377593_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN827424_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN827425_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN827418_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN827421_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148519_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148530_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148552_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148575_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341651_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801482_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053183_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803776_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG725248_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU882005_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX504545_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ246215_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562320_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB900115_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040131_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426637_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426451_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426448_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426445_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426437_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426409_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426395_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426371_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426363_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426355_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426352_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426308_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826123_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF925410_SP_P-C      acgaggccggtcccc--------tagaagaagaactccctcgcctcgcag
MF925395_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
MF925375_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF925369_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF925359_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674504_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674467_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674390_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KY470937_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470936_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470907_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470917_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX774504_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765843_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765840_SP_P-C      acgaggcaggtcccc--------tagaagacgaactccctcgcctcgcag
KX765839_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765827_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765821_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765819_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765847_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX276852_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX276848_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT987423_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT307718_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT307719_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU051426_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU051427_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013927_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013903_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013840_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013837_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013835_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013836_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013787_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP148568_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KM875430_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717803_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803793_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717802_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcacctcgcag
KJ803792_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcacctcgcag
KJ410498_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ410496_SP_P-C      acgaagcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF214672_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF214671_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KF214669_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF214667_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC875269_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801522_SP_P-C      aagaggcaggtcccg--------tagaagaagaactccctcgcctcgcag
JQ801501_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801493_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801487_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426420_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801480_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801475_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765825_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765844_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765845_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801473_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
JQ341666_SP_P-C      acgasgcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341663_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341661_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341642_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341622_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341620_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341615_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ027317_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN827422_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF488701_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG571335_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN827417_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF899336_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU051425_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924616_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924614_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924612_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924613_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410489_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377536_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ184326_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ562295_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279274_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023654_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801505_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774227_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013935_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF925374_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MK628732_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023651_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KY470908_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ023650_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023640_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916226_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774283_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279275_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC318702_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC318703_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306688_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EF688062_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377632_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341652_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801495_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX774506_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674486_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ361533_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924623_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717844_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803826_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX276844_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ315781_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ315783_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089788_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089784_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089783_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089781_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcacctcgcag
DQ089770_SP_P-C      acgagccaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089769_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089768_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ027333_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089766_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089762_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089761_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089771_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AJ748098_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089787_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023645_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ027321_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341641_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801496_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801497_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774236_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053176_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF214673_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF214676_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173286_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410515_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KM875411_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX276851_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765822_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765842_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765849_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674429_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674457_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674463_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674514_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF223955_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB117758_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB105173_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674388_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674402_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674408_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674412_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674418_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674454_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674468_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674472_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674484_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674501_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB074756_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801504_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410504_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB074755_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023649_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924615_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053167_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053169_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803759_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803761_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013810_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765830_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB105174_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB300363_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF068756_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF223954_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF223956_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF223957_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF223958_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF223959_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AP011097_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY862869_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089763_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089765_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089767_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089779_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089782_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089789_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ315782_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EF494379_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306685_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306687_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306689_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306690_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306691_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306694_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023641_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023642_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023643_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023644_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023647_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023653_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023657_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023658_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ349225_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924604_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924649_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924650_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924658_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GU563561_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN827416_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040133_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341637_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341644_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341654_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341668_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341669_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ688403_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801470_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801481_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801483_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801486_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801488_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801502_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801511_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801513_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801519_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX507214_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774228_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC875270_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC875271_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC875272_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC875274_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053187_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173323_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173324_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410501_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410508_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410513_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717810_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717811_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717834_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803780_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803799_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803818_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KM875404_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT364718_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT364721_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT987424_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT987425_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT987426_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU051423_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765818_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765820_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765823_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765824_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765826_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765829_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765831_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765832_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765833_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765834_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765837_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765838_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765846_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765848_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765850_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765851_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765853_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX774503_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470906_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470909_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470910_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470912_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470913_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470916_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470918_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674386_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674398_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674403_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674411_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674435_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674442_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674444_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674474_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674489_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674494_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF925365_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF925367_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF925377_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF925387_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF925406_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF925408_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT111596_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426346_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426347_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426349_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426350_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426351_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426353_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426356_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426357_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426358_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426359_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426360_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426361_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426362_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426364_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426365_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426366_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426367_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426368_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426369_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426370_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426372_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426373_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426374_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426375_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426376_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426377_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426378_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426379_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426380_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426381_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426382_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426383_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426384_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426385_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426386_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426387_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426388_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426389_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426390_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426391_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426392_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426393_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426394_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426396_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426397_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426398_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426399_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426400_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426401_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426402_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426403_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426404_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426405_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426406_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426407_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426408_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426410_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426411_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426412_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426413_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426414_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426415_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426416_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426417_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426418_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426419_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426421_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426422_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426423_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426424_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426425_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426426_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426427_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426428_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426429_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426430_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426431_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426432_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426433_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426434_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426435_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426436_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426438_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426439_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426440_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426441_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426442_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426443_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426444_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426446_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426447_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426450_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426452_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426453_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426454_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB205125_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC592171_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC592172_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674502_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU498227_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774226_SP_P-C      acaaggcaggccccc--------taaaaaaaaaactccctcccctcccaa
JQ341614_SP_P-C      gcgatgcaggccccc--------tagaagaagaactccctcgcctcgcag
EU939541_SP_P-C      acaaggcaggtcccc--------taaaaaaaaaactccctcgcctcgcaa
KC774240_SP_P-C      acaaggcaggtcccc--------tgaaaaaaaaactccctcgcctcaaaa
KF873536_SP_P-C      acgaggcaggwcccy--------tagaagaagaactccctcgcctcgccg
KF873528_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU679960_SP_P-C      acgaggcaggtcctc--------tagaagaagaactccctcgcctcgccg
KU679951_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU679947_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU679957_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU679949_SP_P-C      acgaggcaggtccyc--------tagaagaagaactccctcgcctcgcag
KU679936_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF873514_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF873516_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF873520_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF873525_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF873526_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF873529_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF873539_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF873541_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF873544_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU679937_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040167_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB241112_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX276855_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040132_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY220702_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717804_SP_P-C      ccgagtcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803794_SP_P-C      ccgagtcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386640_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB493839_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386601_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562334_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013799_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013800_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013801_SP_P-C      acgaggcaggtcccc--------tagaagaagaactcccttgcctcgcag
MT114171_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU717215_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY206388_SP_P-C      -cgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014388_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU560439_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363260_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU670263_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774319_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040135_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY220700_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939603_SP_P-C      acgaggcaggtccat--------tagaagaagaactccctcgcctcgcag
HM011472_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
MK818227_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386604_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787437_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826136_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881816_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964064_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014048_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcttcgcag
KR013878_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700529_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY220699_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU554540_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB176642_SP_P-C      acgaggcaggtccct--------tagaagaagaactccctcgcctcgcag
KR014016_SP_P-C      acgaggcaggtcccc--------tagaagaagaactacctcgcctcgcag
AB670242_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
AB493844_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111115_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040139_SP_P-C      acgaggcagkycctc--------tagaagaagaactccctcgcctcgcag
FJ386617_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670253_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363266_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363267_SP_P-C      acgaggcaggtcccc--------tggaagaagaactccctcgcctcgcag
AB176643_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899789_SP_P-C      acgaggcaggtcccc--------tagaagaagaaccccctcgcctcgcag
EU796069_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598660_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgtag
KJ598656_SP_P-C      acgaggcaggtcctc--------tagaagaagaactccctcgcctcgcag
KJ598654_SP_P-C      acgaggcaggtcccc--------tagaagaagaacttcctcgcctcgcag
KJ598657_SP_P-C      acgaggcaggtcccc--------tagaagaagaacttcctcgcctcgcag
KJ598653_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598648_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgtag
KJ598661_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgtag
KJ598641_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598642_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598635_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598636_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598638_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598639_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598640_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598645_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598646_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598647_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598649_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598650_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598651_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598652_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598655_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598658_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598659_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598637_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598644_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774269_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715343_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562337_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562261_SP_P-C      tcgaggcaggtcacc--------tagaagaagaactccctcgcctcgcag
FJ562245_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939573_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014391_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598662_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598663_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598664_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598665_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598666_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598667_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598668_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598669_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598670_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598671_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598672_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598673_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598674_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598676_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598677_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598678_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013842_SP_P-C      acgaggcaggtcccc--------tagaagaagaaccccctcgcctcgcag
KR013847_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013848_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013844_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013845_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013849_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
X52939_SP_P-C        acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826134_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881991_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881976_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881819_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcacctcgcag
KY881815_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881809_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881805_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881802_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363258_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363252_SP_P-C      acgaggcaggtcccc--------tggaagaagaactccctcgcctcgcag
KC793107_SP_P-C      acgaggcaggtccac--------tagaagaagaactccctcgcctcgcag
KC774284_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787459_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715404_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386638_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386626_SP_P-C      acaatgcaggtcctc--------tagaagaagaactccctcgcctcgcag
EU939566_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EF137802_SP_P-C      acgcggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ993181_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY641563_SP_P-C      acgcggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670274_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcmg
AB670268_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
AB367433_SP_P-C      acgaggcaggtcccc--------gagaagaagaactccctcgcctcgcag
AB195945_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111113_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014393_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014384_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB675674_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB675675_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC792995_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787451_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562230_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EF137803_SP_P-C      acgcagcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY206384_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367403_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426577_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426578_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014364_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173291_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173292_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173303_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG893558_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881966_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881971_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN400087_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN400089_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426624_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426615_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426612_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426610_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426609_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426603_SP_P-C      acgaggcaggtcccc--------tagaagaagaactcccttgcctcgcag
MT426599_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426588_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426584_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426579_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426580_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426581_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426582_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426583_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426585_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426586_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426587_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426589_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426590_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426591_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426592_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426593_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426594_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426595_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426596_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426597_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426598_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426600_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426601_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426602_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426604_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426605_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426606_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426607_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426608_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426611_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426613_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426614_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426616_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426617_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426618_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426619_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426620_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426621_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426622_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426623_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426625_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426626_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426627_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426628_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426629_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426631_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426632_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426633_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426634_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426635_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426636_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426638_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426639_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426640_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426641_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426642_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426643_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013943_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173287_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939593_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670294_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014381_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB026811_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB026812_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB026813_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB026814_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY641558_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032331_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386577_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN400088_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173288_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013791_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774321_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774361_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964046_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964042_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964039_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774206_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964034_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964035_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964036_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964037_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964038_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964040_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964041_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964043_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964044_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964045_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964047_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964048_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386611_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013883_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013885_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787439_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787479_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787441_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363277_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963937_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774288_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828916_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828919_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377591_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377545_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386623_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032336_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU872012_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU522069_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089796_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774221_SP_P-C      acgaggcaggtcccc--------tggaagaagaactccctcgcctcgcag
KR013882_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013890_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598716_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774253_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089794_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173317_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173318_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426849_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426677_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426681_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013993_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774340_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774330_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774325_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774306_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774302_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774300_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774282_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774238_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700517_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562323_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcacctcgcag
FJ562256_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562252_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562250_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715341_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787450_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377529_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774204_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774280_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774285_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774296_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774298_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774303_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774304_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774308_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774351_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013817_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013818_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013819_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT364751_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT364752_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386664_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032338_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ032339_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KY363276_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU871980_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU871998_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB198083_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014390_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014377_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB300362_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY247031_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU871982_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386619_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562225_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475305_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475329_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475339_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475346_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377624_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC792862_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598756_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598757_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598765_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013771_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881810_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881807_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881803_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881806_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881811_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881814_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881818_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562255_SP_P-C      tcgaggcaggtccac--------tagaagaagaactccctcgcctcgcag
EU439025_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU439010_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU439011_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ377160_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU439008_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU439012_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU439009_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306724_SP_P-C      tcgaggcaggtaccc--------tagaagaagaactccctcgcctcgcag
EU306726_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306728_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715379_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013942_SP_P-C      tcgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KR013788_SP_P-C      tcgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KR013790_SP_P-C      tcgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KR013789_SP_P-C      tcgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KC774335_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KC774213_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774214_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774211_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM750136_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774189_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774256_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774277_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774254_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013805_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386614_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013804_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013807_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013984_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013803_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939558_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013808_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562242_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386652_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB250109_SP_P-C      tcgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU939555_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367413_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ536411_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ536413_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598780_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598779_SP_P-C      acgatgcaggtccac--------tagaagaagaactccctcgcctcgcag
KJ598772_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF223961_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598774_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598775_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598776_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598778_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
MN683728_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475350_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774337_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787474_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013915_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939643_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU872008_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787485_SP_P-C      acgaggcaggccccc--------tagaagaagaactccctcgcctcgcag
FJ787482_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787483_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787488_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787489_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826124_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774191_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279276_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
D23682_SP_P-C        acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
D23683_SP_P-C        acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC792759_SP_P-C      acgacgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670270_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670308_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670246_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670248_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899773_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcaa
MG826140_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826138_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826132_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
MG826129_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826128_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881962_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgtctcgcag
KY881990_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgtctcgcag
KY881817_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881812_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881804_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470930_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470927_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363274_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363261_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964343_SP_P-C      acgaatcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014013_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014008_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013812_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013802_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013778_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013766_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173295_SP_P-C      acgaggcaggtcccc--------trgaagaagaactccctcgcctcgcag
KC774353_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040161_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040143_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GU357845_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377609_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377586_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899772_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899768_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787484_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787462_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562266_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562251_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ562238_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ562220_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ518810_SP_P-C      acgaggcaggccccc--------tagaagaagaactccctcgcctcgcag
FJ386673_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386630_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939658_SP_P-C      accaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939646_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939645_SP_P-C      acaatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939605_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939571_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939553_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU939539_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU919169_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916237_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916214_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU872013_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU570067_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU554541_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU554536_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU522071_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ986375_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ980551_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
DQ980547_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ975274_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ922649_SP_P-C      acgaggcaggtcccc--------tagaggaagaactccctcgcctcgcag
DQ377165_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ377164_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY220701_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY206392_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF411412_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
AF363961_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB697510_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670306_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
AB670277_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670238_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367421_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111120_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111118_SP_P-C      acaaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111112_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB106895_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
AB042282_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB042283_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377557_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475318_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774334_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774311_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040149_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828937_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939649_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ922651_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
AB670264_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367405_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014396_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916238_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562297_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470882_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470885_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470887_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470890_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470891_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470879_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470875_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470874_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367395_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089797_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470877_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470880_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470886_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470888_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470878_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470884_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470873_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470876_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470881_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470883_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470889_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470892_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013811_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013809_SP_P-C      acgaggcaggtcccc--------taaaagaagaactccctcgcctcgcag
KR013813_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013814_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013815_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670262_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306729_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013767_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707725_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707719_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707717_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707716_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707708_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcaa
JQ707710_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707711_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707712_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707718_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707720_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707721_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707722_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707724_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707726_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707727_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707728_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707729_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707731_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707732_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707733_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707723_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013875_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013833_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939654_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939644_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939556_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB033551_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881997_SP_P-C      acgaggcaggtcccc--------tagaagaagaactcccccgcctcgcag
KY881883_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881872_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881882_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881980_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787457_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787458_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF461358_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF461359_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF411410_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX504541_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774352_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787463_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787453_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787454_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF533983_SP_P-C      tagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111116_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306672_SP_P-C      acgaggcaggtcccc--------tagaagaaaaactccctcacctcgcag
AP011106_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcacctcgcag
EU306671_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcacctcgcag
AP011107_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826131_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826133_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826135_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826137_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173306_SP_P-C      aagaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU939586_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcacag
EU939543_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU939597_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ386596_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ386597_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ386687_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ562239_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
JQ040144_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964004_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
GQ475316_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475327_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475334_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ358158_SP_C-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475312_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KM875423_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU871978_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU871979_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014395_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014383_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014389_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
D23684_SP_P-C        acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774237_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
FJ562335_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
GQ377552_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
KC774272_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
EU939536_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU439013_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963997_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774281_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715365_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562280_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939611_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU796070_SP_P-C      gcgaggcagatcccc--------tagaagaagaactccctcgcctcgcag
EU796072_SP_P-C      gcgaggcagatcccc--------tagaagaagaactccctcgcctcgcag
AF411408_SP_P-C      acgaggcagatcccc--------tagaagaagaactccctcgcctcgcag
AF411411_SP_P-C      acgaggcagatcccc--------tagaagaagaactccctcgcctcgcag
AB014378_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
AB697500_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
D23680_SP_P-C        acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774354_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX026880_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562270_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562241_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306725_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939659_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899761_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899765_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964201_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964204_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964207_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964208_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964210_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964211_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964213_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU717212_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU554542_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ032345_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
AB014374_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939537_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562329_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013846_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881981_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386602_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367408_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173302_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363254_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470926_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032340_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032341_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670304_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774279_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB300368_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT284754_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014399_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386657_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF779327_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826139_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426630_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG893560_SP_P-C      acgaggcaggtcacc--------tagaagaagaactccctcgcctcgcag
MG893557_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826122_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY882003_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881998_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881994_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881989_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881983_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881978_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881972_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881965_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881964_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881963_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881938_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881939_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881940_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881941_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881942_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881943_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881959_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881969_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881996_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881920_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881928_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881937_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881999_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881916_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881915_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881890_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881887_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881885_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881876_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881873_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881737_SP_P-C      acgaggtaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881744_SP_P-C      acgaggtaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881765_SP_P-C      acgaggtaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470925_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470895_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470899_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470903_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363281_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363280_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363275_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964350_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964354_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964355_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964359_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964365_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964349_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964358_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964363_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964198_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964180_SP_P-C      acgaggcaggccccc--------tagaagaagaactccctcgcctcgcag
KU963996_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964002_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279250_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279252_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963882_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT284758_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014092_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014049_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014043_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014018_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014017_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014015_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014014_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014012_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014011_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014010_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013923_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013872_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013874_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013876_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014099_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013860_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013853_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013852_SP_P-C      acgaggcaggtcccc--------tagaaggagaactccctcgcctcgcag
KR013831_SP_P-C      acgagacaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013828_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013796_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013795_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013769_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013765_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013764_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013762_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598777_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598768_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598703_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598691_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173443_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173444_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173319_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173321_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173304_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173307_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173308_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF214677_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC875263_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774355_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774348_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774290_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774286_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774271_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774247_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774244_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
KC774327_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
KC774232_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774231_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774223_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774219_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774208_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774202_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774196_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774336_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774195_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774187_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774179_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774297_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX661490_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX661489_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcacctcgcag
JX504539_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX504536_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX429917_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX504544_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774359_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013792_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013793_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013794_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014059_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX429913_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX429905_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC792658_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX026885_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX026878_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX026877_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707707_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707709_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707713_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707715_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ707730_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040164_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040156_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040154_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040152_SP_P-C      acgakgcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040127_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
X04615_SP_P-C        acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN315779_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM750141_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM750140_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM750137_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM750132_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM011465_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475356_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475353_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475342_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475321_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475310_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377619_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377600_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377631_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377585_SP_P-C      acgaggcaggtcccc--------tcgaagaagaactccctcgcctcgcag
KJ173433_SP_P-C      acgaggcaggtcccc--------tcgaagaagaactccctcgcctcgcag
KJ173434_SP_P-C      acgaggcaggtcccc--------tcgaagaagaactccctcgcctcgcag
GQ377576_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377575_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377570_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377546_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377526_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774209_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774343_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377524_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ227695_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899788_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899769_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899770_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787469_SP_P-C      acgaggcaggtcccc--------tagaagaagaactcccttgcctcgcag
FJ715424_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715422_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715418_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715405_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715406_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ227693_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715389_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715383_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcgg
FJ715403_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcgg
FJ715374_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715359_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715351_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715390_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715344_SP_P-C      acgaggcatgtcccc--------tagaagaagaactccctcgcctcgcag
FJ715342_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562327_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562319_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562315_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562313_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562264_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562244_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562233_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562228_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386667_SP_P-C      acgaggcaggttccc--------tagaagaagaactccctcgcctcgcag
FJ386651_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386650_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386609_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562273_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386595_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386592_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377621_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881813_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386591_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032361_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939648_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377521_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040155_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF214651_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939592_SP_P-C      acggggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939572_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939574_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX504542_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939564_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939562_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939540_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916215_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916212_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916211_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916210_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU872000_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU872001_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU872002_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU872003_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU872004_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU871976_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU589345_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU562216_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU554537_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013919_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU522068_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU439016_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306727_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306721_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306719_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU305542_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU305541_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ683578_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ377162_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089800_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377533_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX661492_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774200_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774205_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774261_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774262_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774278_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774342_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774345_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173313_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173314_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
D50519_SP_P-C        acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
D23681_SP_P-C        acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
D12980_SP_P-C        acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
D00630_SP_P-C        acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF458664_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670302_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939594_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386603_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670282_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670267_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670261_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386616_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670255_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939548_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670252_SP_P-C      acgagggaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670251_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386679_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670241_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB642099_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377562_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM011489_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB642097_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367804_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367430_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670309_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916216_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377517_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475306_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475308_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475311_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475313_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475315_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475320_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475331_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475347_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341662_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX429907_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX429909_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774266_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774331_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173439_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173440_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013829_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013830_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013832_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013834_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470929_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470933_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470934_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367423_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB365451_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB300372_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB299858_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367428_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367432_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB426467_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY167090_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY596108_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU305540_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939642_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386574_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386594_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386618_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386639_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386644_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562235_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562308_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715355_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715357_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377551_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377584_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040163_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040172_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX429915_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX429918_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774315_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774318_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173331_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173332_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173391_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173392_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KM213037_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013859_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013861_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013862_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT284759_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964187_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964188_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964191_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964192_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964193_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964194_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964195_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964196_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964197_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964199_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964352_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964356_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964357_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964360_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964361_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964362_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964364_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881917_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881918_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881919_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881921_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881922_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881923_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881924_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881925_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881926_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881927_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881929_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881930_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881931_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881932_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881933_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881934_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881935_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881936_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881967_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881970_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881975_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881977_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881982_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881985_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881986_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881992_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881995_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY882000_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB222714_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB222715_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB205124_SP_P-C      acgaggcaggtcccc--------tagaagaaggactccctcgcctcgcag
AB202071_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB202072_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB198080_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB198077_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367410_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670285_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670305_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ536410_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ536412_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ536414_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715352_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715353_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475307_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475317_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM750138_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774210_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774333_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774347_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598766_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598769_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598770_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598771_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB195949_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB182589_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU881999_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939567_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939612_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939647_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562293_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562324_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX026884_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014041_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014098_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279251_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279253_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB113879_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939570_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111119_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111114_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881892_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB049610_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB362932_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939590_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939591_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899777_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173281_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173282_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB033553_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB033552_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB033556_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670254_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB697494_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY066028_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386663_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ518813_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377578_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF485389_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT284755_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964169_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964174_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964176_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964177_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964178_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964179_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964181_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964182_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964183_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964184_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB033550_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014397_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014394_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939546_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939585_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475325_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964076_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG893556_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014360_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU439014_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774184_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774220_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774243_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598689_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598693_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598694_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598698_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598699_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598702_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881891_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013768_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014362_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014376_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB026815_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB195942_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB195947_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB195948_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB198076_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB198078_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB198079_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB246345_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB288026_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB300359_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB300365_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367424_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB471848_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB471849_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB471850_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB485808_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB640730_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670247_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670256_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670266_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670269_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670276_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670283_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670287_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670290_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670291_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670295_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670297_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670301_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670307_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670311_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB675677_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB900099_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AP011098_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY247032_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089793_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ377161_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ377163_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ975273_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ980550_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306673_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306674_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306675_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306713_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306714_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306720_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU439005_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU439015_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU554538_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU554539_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU562218_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU570068_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU872010_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU882000_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916213_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916217_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916229_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939538_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939544_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939554_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939561_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939563_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939576_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939580_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939587_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939604_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939610_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939618_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939640_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032332_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386575_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386587_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386598_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386605_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386627_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386637_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386662_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386685_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562218_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562243_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562249_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562268_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562274_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562275_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562283_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562285_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562290_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562301_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562330_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562332_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562333_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715358_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715375_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715376_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715377_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715378_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715380_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715381_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715392_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715407_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715409_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715421_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787468_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899763_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899764_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899771_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899775_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ227694_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ227696_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ259588_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377523_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377527_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377530_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377535_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377540_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377541_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377553_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377554_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377559_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377563_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377574_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377579_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377580_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377598_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377603_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377617_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377618_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377637_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377640_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475314_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475319_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475322_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475324_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475330_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475332_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475337_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475348_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ872210_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GU434374_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040129_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040162_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040165_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040166_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341648_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341658_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ688404_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX429903_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX429904_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX429906_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX429912_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX429916_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX504546_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX661491_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX661493_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX661495_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774181_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774185_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774190_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774192_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774203_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774218_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774224_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774233_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774241_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774248_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774249_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774250_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774251_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774255_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774257_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774259_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774268_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774270_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774274_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774275_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774276_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774292_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774293_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774295_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774299_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774309_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774310_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774312_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774326_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774329_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774339_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774356_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774357_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774360_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC875262_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF779300_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173283_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173284_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173294_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173310_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173315_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173316_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173395_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173396_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173426_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173427_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173428_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410505_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598680_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598681_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598688_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598690_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598695_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598696_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598697_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598701_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP027477_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KP784761_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013761_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013763_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013773_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013774_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013776_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013777_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013850_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013851_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013858_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013873_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013877_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013908_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013909_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT284756_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963871_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963872_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963873_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963874_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963875_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963876_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963877_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963878_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963879_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963880_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963881_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963884_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963885_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963992_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964065_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964066_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964067_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964068_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964069_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964070_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964071_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964072_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964073_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964074_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964075_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964077_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964078_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964171_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964172_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964173_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964175_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964334_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964336_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964337_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964338_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964339_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964340_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964342_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964344_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964345_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964346_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964347_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964348_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY022423_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363268_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470894_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470896_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470897_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470900_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470901_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470902_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470904_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470905_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881736_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881738_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881739_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881742_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881743_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881748_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881749_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881750_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881751_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881754_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881755_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881758_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881762_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881763_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881764_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881766_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881767_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881768_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881769_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881770_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881771_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881772_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881773_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881774_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881775_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881776_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881777_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881870_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881875_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881877_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881879_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881881_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881884_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881960_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881961_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881974_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881984_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881987_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881988_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881993_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY882001_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY882002_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC090200_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279258_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC373511_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC373512_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MH094411_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MN683726_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MN683727_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MN683729_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053181_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803774_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM011479_SP_P-C      acgakgcaggycccc--------tagaagaagaactccctcgcctcgcag
KX276837_SP_P-C      acgakgcaggycccc--------tagaagaagaactccctcgcctcgcag
AB241113_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341632_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924622_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctckcctcgcag
KM875412_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717799_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcacctcgcag
KJ803790_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcacctcgcag
GQ924620_SP_C-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU410080_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AP011100_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB241111_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB241110_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU410081_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU410079_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014082_SP_P-C      atgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014078_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgccccgcag
KR014077_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013871_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013870_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173335_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173336_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014083_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN827414_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF241410_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF241411_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN827415_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AP011099_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AP011101_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG571359_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY596107_SP_P-C      acgaggtaggtcccc--------tagaagaagaactccctcgcctcgcag
KC792902_SP_P-C      acgaggcaggccccc--------tagaagacgaactccctcgcctcgcag
DQ089786_SP_P-C      acgaggcaggtccct--------tagaagaagaactccctcgcctcgccg
FJ715364_SP_P-C      acgaggcagttcccc--------tagaagaagaactccctcgcctcgcag
KX276850_SP_P-C      acgaggcaggtccwc--------tagaagaagaactccctcgcctcgcag
KY363287_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363285_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341643_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY206386_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
AB014386_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053170_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803762_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939569_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR819180_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM011488_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013869_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ638218_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386661_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089795_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367402_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363286_SP_P-C      acgaggcaggtcccc--------tagaagaagaactcccccgcctcgcag
JQ341656_SP_P-C      acgakgcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ027322_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899778_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787448_SP_P-C      acgcggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032355_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcaa
EU589344_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367420_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367409_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB300373_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014398_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386624_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ372968_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032333_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ386665_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
HQ700506_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM011491_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787442_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787443_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB113877_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014382_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787481_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU589342_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU589340_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU589341_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562276_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB971714_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB971715_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
X75665_SP_P-C        aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426282_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgtctcgcag
MT426250_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgtctcgcag
KR013865_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173296_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF214652_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053175_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803769_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774217_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774215_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774216_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX504534_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341657_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341628_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341621_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
GQ924655_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377605_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
FJ715366_SP_P-C      acgaggcaggtcctc--------tagaagaagaactccctcgcctcgcag
FJ562292_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386677_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386621_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032356_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939596_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU919168_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916222_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgccttgcag
EU560438_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670273_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367404_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB300360_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcacctcgcag
AB014363_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828929_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828923_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828924_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828925_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828926_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828930_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828931_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828921_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828922_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828928_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX560520_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828918_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828913_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828917_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828920_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ227697_SP_P-C      acgaggcgggtcccc--------tagaagaagaactccctcgcctcgcag
GQ227692_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787467_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787466_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787447_SP_P-C      acgcggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386653_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386579_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032351_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939653_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB697490_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367803_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367411_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367398_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367397_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386628_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787445_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367396_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB195943_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB195944_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367392_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367399_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367412_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367414_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367416_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670275_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EF536065_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386629_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787464_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787465_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040168_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EF536066_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF828915_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032359_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386659_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032360_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939655_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939656_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939641_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964185_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964186_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964189_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964190_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774197_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562291_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ023639_SP_P-C      acggggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY167092_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB300361_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377608_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013866_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013863_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013864_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013867_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX661496_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939584_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF384371_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU560441_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787486_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899776_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377571_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377599_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377615_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173431_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173432_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032346_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774320_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC875264_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC875265_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC875273_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ717790_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803779_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU579443_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032347_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562221_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU560440_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU579442_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU589336_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC875261_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386645_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774245_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386589_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562258_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562299_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM750131_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173435_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173436_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774346_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562272_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562281_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040145_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774180_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF925394_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341649_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377597_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939614_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964341_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670239_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670240_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916218_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939557_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939613_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386625_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386632_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JF436920_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774199_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JN827420_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB246346_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089760_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ801509_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341611_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341664_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089792_SP_P-C      acgakgcaggtcccc--------tagaagamgaactccctcgcctcgcag
JQ341659_SP_P-C      acgakgcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341655_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341639_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341633_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023648_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341617_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX765852_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363284_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475351_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475336_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377538_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475328_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964318_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964321_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964326_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964327_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964333_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964319_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964322_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964323_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964324_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964325_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964328_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964329_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964330_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964331_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964332_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB298720_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB298721_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964320_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475341_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774182_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426841_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC793024_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ027323_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367417_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF053172_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173393_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173394_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ803765_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939588_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU562215_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU562217_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386631_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774225_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ622095_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367425_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB642100_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB900116_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MH887433_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB195936_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670281_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475309_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MH891502_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB195937_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB195938_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774242_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916219_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386671_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386678_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787452_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475344_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB042284_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279254_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279255_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279256_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279257_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377636_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939616_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386576_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562318_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715367_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377518_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774252_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715402_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF286594_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB471851_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB471852_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB471853_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715382_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377616_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367422_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB642095_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367401_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367407_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ975272_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964200_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964202_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964203_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964205_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964206_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964209_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964212_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426249_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX429914_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341670_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787449_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939615_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916225_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916223_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916224_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB198081_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB198082_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386588_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377514_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377528_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377577_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377601_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377628_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040151_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774194_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KM229703_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426248_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426302_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562232_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562282_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377572_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX560519_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939582_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040158_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475343_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475352_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ986376_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670243_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014369_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB042285_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173430_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367435_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377543_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475326_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX661488_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774314_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173429_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173311_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363256_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363257_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX276831_SP_P-C      mcgaggcaggycccc--------tagaagaagaactccctcgcctcgcag
AB115417_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ899795_SP_P-C      acgaagcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670298_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU939617_SP_P-C      acgaggcaggccccc--------tagaagaagaactccctcgcctcgcag
AB195932_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
AB113878_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
AB195931_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
AB195930_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
AB697502_SP_P-C      acgaggtaggtccac--------tagaagaagaactccctcgcctcgcag
KJ410521_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
HM011481_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KX276839_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
DQ993690_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899793_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899794_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU919165_SP_P-C      caggggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ358157_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700522_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700543_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341634_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426743_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426679_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426680_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013780_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC793097_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
JQ801500_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
HM011500_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916227_SP_P-C      gcgaggcaggtcccc--------tagaagaagaactcccccgcctcgcag
DQ478900_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426838_SP_P-C      acgaggcaggtgccc--------tagaagaagaactccctcgccttgcag
JQ341665_SP_P-C      wcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787461_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU919164_SP_P-C      cagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY206378_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY167096_SP_P-C      ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426848_SP_P-C      acgaggcaggtcccc--------tagaagaagaactacctcgcctcgcag
MG826143_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363264_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX276838_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774316_SP_P-C      acgaggcaggtcccc--------tagaagacgaactccctcgcctcgcag
HM011502_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715391_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032334_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU881996_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ993692_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ478885_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426731_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426858_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426756_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426760_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426761_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881889_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715368_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013783_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774313_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426737_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426659_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426683_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014380_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089799_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774229_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426847_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426811_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG893553_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013786_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF485390_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774260_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774267_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JX661497_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM750135_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475323_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562331_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386670_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939549_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY167099_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014371_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939600_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB050018_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111124_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111125_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB246344_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939652_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562307_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377515_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377531_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475338_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM750134_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774264_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774338_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410510_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KM359441_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013779_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013781_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013782_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013784_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013785_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT284753_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279245_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279246_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279247_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279248_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
LC279249_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916204_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715350_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715370_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173309_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426854_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426853_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426850_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426845_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426843_SP_P-C      acgagtcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426839_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426837_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426829_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426818_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426804_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426797_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426819_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426795_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcggctcgcag
MT426796_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcggctcgcag
MT426793_SP_P-C      acgaggcaggtcccc--------tagacgaagaactccctcgcctcgcag
MT426781_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426776_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426766_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426754_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426750_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426745_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426729_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426717_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426692_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426673_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426672_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426666_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426650_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426773_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426775_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426649_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426739_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KX276835_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC792799_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ027319_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ151413_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ993691_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY206382_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426780_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426663_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY206389_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ993693_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562284_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ751770_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924633_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ341636_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC792921_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC792999_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173327_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173328_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173441_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173442_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173446_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ790199_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426644_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426645_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426646_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426647_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426648_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426651_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426652_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426653_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426654_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426655_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426656_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426657_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426658_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426660_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426661_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426662_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426664_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426665_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426667_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426668_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426669_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426670_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426671_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426674_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426675_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426676_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426678_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426682_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426684_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426685_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426686_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426687_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426688_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426689_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426690_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426691_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426693_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426694_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426695_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426696_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426697_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426698_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426699_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426700_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426701_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426702_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426703_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426704_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426705_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426706_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426707_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426708_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426709_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426710_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426711_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426712_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426713_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426714_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426715_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426716_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426718_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426719_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426720_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426721_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426722_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426723_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426724_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426725_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426726_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426727_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426728_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426730_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426732_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426733_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426734_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426735_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426736_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426738_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426740_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426741_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426742_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426744_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426746_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426747_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426748_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426749_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426751_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426752_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426753_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426755_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426757_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426758_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426759_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426762_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426763_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426764_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426765_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426767_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426768_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426769_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426770_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426771_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426772_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426774_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426777_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426778_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426779_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426782_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426783_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426784_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426785_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426786_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426787_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426788_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426789_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426790_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426791_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426792_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426794_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426798_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426799_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426800_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426801_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426802_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426803_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426805_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426806_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426807_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426808_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426809_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426810_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426812_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426813_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426814_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426815_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426816_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426817_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426820_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426821_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426822_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426823_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426824_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426825_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426826_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426827_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426828_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426830_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426831_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426832_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426833_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426834_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426835_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426836_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426840_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426842_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426844_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426846_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426851_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426852_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426855_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426856_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MT426857_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
V00867_SP_P-C        acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562326_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcacctcgccg
HQ700576_SP_P-C      cagaggcaggtccac--------tagaagaagaactccctcgcctcgcag
HQ700457_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700562_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700570_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700504_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700568_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700502_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700545_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700563_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700564_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700565_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700573_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700574_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700556_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700569_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700577_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700578_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700575_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700496_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700476_SP_P-C      acgaggcaggwcccc--------tagaagaagaactccctcgcctcgcag
HQ700571_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700566_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700559_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700544_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700555_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700558_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700561_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700572_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700456_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700475_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700490_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700567_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HQ700495_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598760_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY206381_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcacag
GQ377623_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939583_SP_P-C      tcgaggcaggtccgc--------tagaagaagaactccctcgcctcgcag
FJ787470_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787471_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014372_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC792753_SP_P-C      acgakgcaggtcccc--------tagaagaagaactccctcgcctcgcag
GU721029_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF214675_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670260_SP_P-C      tcgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670237_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
HQ700516_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU547559_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
D28880_SP_P-C        acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
S75184_SP_P-C        acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ410514_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU570073_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU570074_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598720_SP_P-C      tcgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964238_SP_P-C      tcgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964243_SP_P-C      tcgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598726_SP_P-C      tcgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964236_SP_P-C      tcgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598737_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598739_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598731_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964229_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598722_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598725_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598733_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598735_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964237_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964241_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598721_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964242_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598723_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598724_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598727_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598728_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598729_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598730_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598732_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598734_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598736_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KJ598738_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964230_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964231_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964232_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964233_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964234_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964235_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964239_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964240_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ787490_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014373_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KY470980_SP_P-C      acgaggcaggtcccc--------tagaagaaggactccctcgcctcgcag
KY470981_SP_P-C      acgaggcaggtcccc--------tagaagaaggactccctcgcctcgcag
KY470982_SP_P-C      acgaggcaggtcccc--------tagaagaaggactccctcgcctcgcag
KY470984_SP_P-C      acgaggcaggtcccc--------tagaagaaggactccctcgcctcgcag
KY470988_SP_P-C      acgaggcaggtcccc--------tagaagaaggactccctcgcctcgcag
KY470983_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470985_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470986_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470987_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470990_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470991_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774235_SP_P-C      acgaggcaggtcccc--------tcgaagaagaactccctcgcctcgcag
JX504537_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173334_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173333_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826126_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC793046_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY670782_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562300_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY629631_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MG826127_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF495606_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY629637_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963904_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377555_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
HM011493_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963900_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963901_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963902_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963903_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963905_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963906_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963907_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963908_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963909_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963910_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963911_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963912_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963913_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963914_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC792831_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU717217_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598762_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939599_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcat
EU547562_SP_P-C      aagatgcaggtcccc--------tagaagaagaactccctcgcctcgccg
AB014365_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ089758_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ924642_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KT284757_SP_P-C      acgaggcagggcccc--------tagaagaagaactccctcgcctcgcag
KC792710_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939657_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY641562_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF182804_SP_P-C      acgaggcaggtcccc--------tggaagaagaactccctcgcctcgcag
AB670279_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670265_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgccg
AB195946_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY206376_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY206379_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367426_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367801_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939579_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899774_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111117_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
DQ478899_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MK321266_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MK720629_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MK720630_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU871974_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF182805_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF182802_SP_P-C      acaaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU871973_SP_P-C      acgaggcgggtcccc--------tagaagaagaactccctcgcctcgcag
EU871970_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU871972_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
D50520_SP_P-C        acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964011_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964012_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964013_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964015_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964016_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964017_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964018_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964019_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU964014_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF182803_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU871969_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU871971_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386641_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475333_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC792834_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774265_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670310_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgccg
AB367427_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470977_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470976_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470975_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470971_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470972_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470967_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470966_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470965_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470969_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470974_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470968_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470970_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470973_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470978_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY470979_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881973_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ032350_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670263_SP_P-C      aagatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
MH818373_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939625_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598741_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598742_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598744_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598745_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598747_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598748_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598750_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598754_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598743_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598746_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598751_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598752_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598753_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014379_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014392_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
MF674428_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881880_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgtag
KJ173305_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173290_SP_P-C      acgatgcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774289_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377620_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ787487_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386647_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386607_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939651_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939601_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU916234_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU916233_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
DQ980549_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670259_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB485810_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367418_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367406_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014385_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU717218_SP_P-C      acgaggcaggtcccc--------tagatgaagaactccctcgcctcgcag
AB367429_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963920_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562340_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KU963915_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963916_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963917_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963918_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963919_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963921_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963922_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963923_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963924_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963925_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963926_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963927_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963928_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963929_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013868_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367434_SP_P-C      acgaggcatgtctcc--------tagaagaagaactccctcgcctcgcag
DQ922650_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386612_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670272_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562279_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774358_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
D50517_SP_P-C        ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
D50518_SP_P-C        ccgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670300_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670249_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
JQ040141_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881979_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881888_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363282_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363278_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363279_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363253_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
KR014057_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013961_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013797_SP_P-C      acgaggcaggccccc--------tagaagaagaactccctcgcctcgcag
KJ598740_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598749_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598715_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598714_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598719_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598679_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598686_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KF214655_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774287_SP_P-C      aagaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475354_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ377583_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173437_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173438_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ899783_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715372_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715371_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715360_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562339_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562306_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
FJ386613_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU939626_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774207_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939619_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU939550_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU939595_SP_P-C      acgaggcaggacccc--------tagaagaagaactccctcgcctcgcag
EU871975_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU871977_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU554535_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU306722_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY641560_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF461357_SP_P-C      acgaggcaggtcccc--------tagaagacgaactccctcgcctcgcag
AF461363_SP_P-C      acgaggcaggtcccc--------tagaagacgaactccctcgcctcgcag
AB670288_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670278_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670292_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY306136_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AY641561_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562288_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173338_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU964170_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881871_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881874_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881878_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY881886_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB367802_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939568_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ023656_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598718_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB113875_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB113876_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111123_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111121_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB111122_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB014361_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AB670289_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
AF458665_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939545_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939560_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939607_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
EU939609_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ386672_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562248_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562269_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ562325_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715398_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
FJ715400_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475345_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475349_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ475357_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
GQ872211_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774239_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KC774301_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173289_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173293_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173301_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173312_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173337_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ173445_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598687_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598705_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598706_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598707_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598708_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598709_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598710_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598711_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598712_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598713_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KJ598717_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014055_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR014060_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963886_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963887_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963888_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963889_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963890_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963891_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963892_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963893_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963894_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963895_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963896_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963897_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963898_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KU963899_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KY363283_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag
KR013798_SP_P-C      acgaggcaggtcccc--------tagaagaagaactccctcgcctcgcag

FJ562286_SP_P-C      acgcagcgcttcatt------ttgtgggtcaccatattcttgggaa----
MG571345_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801518_SP_P-C      acgaaggtctcaatcgtcgcgtagcagaagatgtcaatctcgggaatctc
AB014387_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcta
GQ924629_SP_P-C      aygaaggtctcaatcgycaagtcgcagaagatctcaatgtcgggaatgtc
AB115418_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
KJ717825_SP_P-C      acgaaggtctcaatcgccgcttcgcagaagatctcaatctcgggaacctc
KJ803812_SP_P-C      acgaaggtctcaatcgccgcttcgcagaagatctcaatctcgggaacctc
AB112066_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939552_SP_P-C      acgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctc
AB112471_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX276836_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcty
KR014000_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctt
KC315399_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ717821_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactcta
KJ803809_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactcta
KR014006_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013827_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013998_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR014007_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KR014002_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KR014005_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
MK286461_SP_P-C      acgaaggtctcaatcgccgcgtcrcagaagatctcaatctcgggaatctc
KX276853_SP_P-C      acgaagrtctcaatcgccgcgtcgcagaagatctcmatctcgggrmtcyc
KJ410511_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctg
KF053184_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KJ803777_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
JQ801508_SP_P-C      acgaagatctcaatcgccgcgtcgccgaagatctccatctcggggatccc
KF053168_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ803760_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
HM011495_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaycyc
KX276841_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctc
KC792911_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratctc
DQ361526_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341653_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
GQ924619_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
AB014367_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratctc
JQ801517_SP_P-C      acgaaggtctcaatcgccgcgtcgcggaagatctccatctcggggatctc
FJ562310_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
JQ027324_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctc
KF214670_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JX026888_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ027332_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB031262_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386620_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964214_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
FJ386689_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964228_SP_P-C      acgaaggtctcaatcgacgcgtcgcagaagatctcaatctcgggaatctc
KU964219_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KU964217_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KU964220_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KU964227_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KU964216_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KU964221_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
HM750139_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964218_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964222_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964224_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964225_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964215_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964223_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964226_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JF828905_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JF828906_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JF828907_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JF828911_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JF828912_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JF828908_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JF828910_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ717791_SP_P-C      acgaaggtctcaatcgccgcttcgcagaagatctcaatctcgggaacctc
JQ801520_SP_P-C      acgaaggtctcaatcccctcctcgcagaagatctcaatctcgggaatctc
GQ924643_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
EU570072_SP_P-C      acgacgatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
DQ089790_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AY167091_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
AB074047_SP_P-C      acgaaggtctcaatcgccgcgtagcagaagatctcaatctcggggatctc
AB931170_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
AB931171_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
MF925403_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765828_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ410518_SP_P-C      acgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JX507211_SP_P-C      acgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctc
JQ429078_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF053185_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
JX507212_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426312_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426306_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426287_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426267_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148559_SP_P-C      acaaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148493_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341631_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426277_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426288_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148567_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KP148483_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KP148491_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KP148479_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KJ410493_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcct
KJ717812_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KJ803800_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KP148476_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148520_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426326_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426319_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426314_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426298_SP_P-C      acgaaggtctcaatcgccgcatcgcagaagatctcaatctcgggaatctc
MT426297_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426292_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426284_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426310_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426283_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426280_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426279_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426266_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426265_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426289_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426264_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426254_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148570_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148564_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148557_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148547_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagacctcaatctcgggaatctc
KP148546_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148543_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148540_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
KP148535_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148534_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148525_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaggatctcaatctcgggaatctc
KP148488_SP_P-C      acgaaggtctcaatcgccgcgtcacagaagatctcaatctcgggaatctc
KP148473_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148465_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148315_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148463_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148464_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148466_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148468_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148469_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148470_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148471_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148472_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148474_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148475_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148477_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148480_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148481_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148482_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148487_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148489_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148492_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148512_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148513_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148514_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148517_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148521_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148523_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148524_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148526_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148528_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148529_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148531_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148532_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148537_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148538_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148545_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148548_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148549_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148551_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148554_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148555_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148558_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148560_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148561_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148562_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148563_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148566_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148571_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148572_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148573_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148574_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426251_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426252_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426253_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426255_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426256_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426257_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426258_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426259_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426260_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426261_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426262_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426263_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426268_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426269_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426270_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426271_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426272_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426273_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426274_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426275_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426276_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426278_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426281_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426285_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426286_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426290_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426291_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426293_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426294_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426295_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426296_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426299_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426300_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426301_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426303_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426304_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426305_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426307_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426309_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426311_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426313_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426315_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426316_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426317_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426318_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426320_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426321_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426322_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426323_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426324_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426325_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426327_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426329_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426330_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426331_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426332_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426333_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426334_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426335_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426336_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426337_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426338_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426339_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426340_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426341_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426342_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426343_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426344_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426345_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426328_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939542_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ899767_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707768_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707769_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707770_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707771_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707772_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707773_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707774_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX276840_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaycyc
KR013899_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctc
KF053173_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
KJ803766_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
JQ341635_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341624_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB112063_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcggggatctc
MF674430_SP_P-C      acgaaggtctcaatcacctcgtcgcagaagatctcaatctcgggactctc
KX276833_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR014021_SP_P-C      acgaaggcctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
KR013839_SP_P-C      acgaaggtctcaatcaccgcgtcgctgaagatctcaatctcgggaatctc
KJ717809_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC792880_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801510_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801478_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcta
JQ027320_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
GQ924636_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatgtcgggaatgtc
GQ924609_SP_P-C      angaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatstc
EF494377_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatccc
DQ089803_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089802_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
DQ089773_SP_P-C      acgaagttctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AY641559_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF053177_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ803770_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674425_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
MF674458_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KF053161_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ803754_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KT366464_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
KJ598761_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
HM011486_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctc
DQ089772_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
AB900113_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
AB112472_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB014368_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801515_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341619_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacatc
KR013820_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801523_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341630_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggsaatctc
DQ089785_SP_P-C      aagaaggtctcaatcgccgcgtcgccgaagaactcaatctcgggaatccc
KT347089_SP_P-C      acgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341626_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF488703_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
HM011468_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ904423_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801499_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX276847_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacccc
KJ717822_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KJ803810_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
JN827423_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB112348_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU717214_SP_P-C      acgagggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
EU872005_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
GQ475355_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964353_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ788835_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
FJ151414_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
MF925409_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089804_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
AB111946_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801491_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF925376_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ715415_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ715416_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ027318_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatccc
AB367431_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
DQ089757_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
JQ341613_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KJ803815_SP_P-C      acgaaggtctcaatcgccgctgcgcagaacatctcaatctcgggaatctc
KJ803814_SP_P-C      acgaaggtctcaatcgccgctgcgcagaacatctcaatctcgggaatctc
KJ717827_SP_P-C      acgaaggtctcaatcgccgctgcgcagaacatctcaatctcgggaatctc
KJ717828_SP_P-C      acgaaggtctcaatcgccgctgcgcagaacatctcaatctcgggaatctc
JX504535_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ410519_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089801_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562298_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964020_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964021_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964022_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964023_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964024_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964025_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964026_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964027_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964028_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964029_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964030_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964031_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964032_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964033_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023652_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801472_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426449_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MH220971_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctc
MF925405_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
MF674471_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
MF674417_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaacctc
MF674399_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470911_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765855_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX276849_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
KU964049_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964050_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964051_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964052_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964053_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964054_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964055_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964056_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964057_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964058_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964059_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964060_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964061_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964062_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964063_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013841_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctt
KR013838_SP_P-C      acgaaggtctcaatcaccgcgtcgctgaagatctcaatctcgggaatctc
KR013823_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KR013772_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatttc
KP148462_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KM875429_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaacctcgggaatctc
KM875428_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KM875406_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ717826_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ803813_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ717823_SP_P-C      acgaaggtctcaatcgccgcggcgcagaagatctcaatctcgggaatctc
KJ803811_SP_P-C      acgaaggtctcaatcgccgcggcgcagaagatctcaatctcgggaatctc
KJ410491_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ410492_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ410494_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ410499_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF053193_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF053164_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
KJ803757_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
KC875268_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagctctcaatctcgggaatctc
JX870000_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801490_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaacctc
JQ341650_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctc
JQ341647_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341618_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562304_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023646_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctc
EF197911_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ361534_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
DQ089791_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089778_SP_P-C      acgaaggtctcaatcaccgcgtcgcagacgatctcaatctcgggaatctc
DQ089759_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF473543_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB900109_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
AB670258_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
AB367394_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB112408_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB112065_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
KR013822_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KR013825_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KR013996_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KR013905_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
KR013904_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013855_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013824_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013770_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341616_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089764_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
GQ358154_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
HM011497_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013821_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013826_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013854_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013856_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013857_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013900_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013902_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881968_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470920_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023655_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB205123_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KM875424_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KM875425_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089776_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
DQ089777_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
JQ801489_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470915_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674475_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB368297_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG826125_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765836_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
KX276854_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF223960_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggsaatctc
KJ598773_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562265_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AY057947_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598767_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089775_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG571332_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF214668_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC875267_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB247916_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426474_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggtaatctc
MT426458_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426516_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426552_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426548_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ787455_SP_P-C      acgaaggtctcaatcgccgcgtcgcggaagatctcaatctcgggaatctc
FJ787456_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KM875405_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatcttaatctcgggaatctc
DQ478901_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ173285_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ410495_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470914_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801503_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctc
DQ089780_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctc
GQ358153_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctc
KJ717839_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctc
KJ803823_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctc
KU051424_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801521_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341612_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089756_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
AY206385_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KT366463_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426348_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426354_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ377642_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ715395_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ715397_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939578_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB195952_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB195953_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB195954_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
LC279259_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
LC279260_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
LC279261_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
LC279262_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ377593_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JN827424_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JN827425_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JN827418_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JN827421_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148519_SP_P-C      acgaaggtctcaatcgccgcgtcgctgaagatctcaatctcgggaatctc
KP148530_SP_P-C      acgaaggtctcaatcgccgcgtcgctgaagatctcaatctcgggaatctc
KP148552_SP_P-C      acgaaggtctcaatcgccgcgtcgctgaagatctcaatctcgggaatctc
KP148575_SP_P-C      acgaaggtctcaatcgccgcgtcgctgaagatctcaatctcgggaatctc
JQ341651_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801482_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF053183_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ803776_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG725248_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU882005_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JX504545_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ246215_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562320_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB900115_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
JQ040131_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
MT426637_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426451_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426448_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426445_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426437_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426409_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426395_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426371_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426363_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426355_SP_P-C      acgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426352_SP_P-C      acgaaagtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426308_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG826123_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF925410_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF925395_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF925375_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF925369_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
MF925359_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
MF674504_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
MF674467_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaacctc
MF674390_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
KY470937_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcggtctcgggaatctc
KY470936_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctc
KY470907_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470917_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX774504_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765843_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765840_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765839_SP_P-C      acgaaggtctcaatcgccgcgtcacagaagatctcaatctcgggaatctc
KX765827_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765821_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765819_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765847_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX276852_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX276848_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KT987423_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KT307718_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KT307719_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU051426_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU051427_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013927_SP_P-C      acgaaggtctcaatcgccgcgtcgctgaagatctcaatctcgggaatctc
KR013903_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013840_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
KR013837_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
KR013835_SP_P-C      acgaaggtctcaatcaccgcgtcgctgaagatctcaatctcgggaatctc
KR013836_SP_P-C      acgaaggtctcaatcaccgcgtcgctgaagatctcaatctcgggaatctc
KR013787_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KP148568_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KM875430_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KJ717803_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
KJ803793_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
KJ717802_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ803792_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ410498_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctc
KJ410496_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF214672_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF214671_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF214669_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KF214667_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC875269_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801522_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801501_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801493_SP_P-C      acaaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801487_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426420_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801480_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
JQ801475_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765825_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765844_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765845_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801473_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341666_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341663_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341661_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341642_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
JQ341622_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggraatctc
JQ341620_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagawctcaatctcgggaatctc
JQ341615_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ027317_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JN827422_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF488701_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG571335_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JN827417_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JF899336_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU051425_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ924616_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ924614_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ924612_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ924613_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ410489_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ377536_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ184326_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562295_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
LC279274_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023654_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801505_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774227_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013935_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF925374_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MK628732_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023651_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470908_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023650_SP_P-C      acgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctc
FJ023640_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU916226_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774283_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
LC279275_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
LC318702_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
LC318703_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU306688_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EF688062_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ377632_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341652_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801495_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX774506_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674486_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ361533_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
GQ924623_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KJ717844_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KJ803826_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KX276844_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
DQ315781_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ315783_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089788_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
DQ089784_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089783_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctc
DQ089781_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089770_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089769_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089768_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ027333_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089766_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089762_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctm
DQ089761_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
DQ089771_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
AJ748098_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089787_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023645_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ027321_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341641_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801496_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801497_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774236_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF053176_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF214673_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF214676_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ173286_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ410515_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KM875411_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX276851_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765822_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765842_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765849_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674429_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674457_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674463_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674514_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF223955_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB117758_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB105173_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
MF674388_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
MF674402_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
MF674408_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
MF674412_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
MF674418_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
MF674454_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
MF674468_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
MF674472_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
MF674484_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
MF674501_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
AB074756_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801504_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ410504_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB074755_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023649_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ924615_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF053167_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF053169_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ803759_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ803761_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013810_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765830_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB105174_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB300363_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF068756_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF223954_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF223956_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF223957_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF223958_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF223959_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AP011097_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AY862869_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089763_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089765_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089767_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089779_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089782_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089789_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ315782_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EF494379_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU306685_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU306687_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU306689_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU306690_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU306691_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU306694_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023641_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023642_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023643_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023644_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023647_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023653_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023657_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ023658_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ349225_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ924604_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ924649_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ924650_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ924658_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GU563561_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JN827416_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ040133_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341637_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341644_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341654_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341668_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ341669_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ688403_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801470_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801481_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801483_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801486_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801488_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801502_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801511_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801513_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ801519_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JX507214_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774228_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC875270_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC875271_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC875272_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC875274_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF053187_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ173323_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ173324_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ410501_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ410508_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ410513_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ717810_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ717811_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ717834_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ803780_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ803799_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ803818_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KM875404_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KT364718_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KT364721_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KT987424_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KT987425_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KT987426_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU051423_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765818_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765820_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765823_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765824_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765826_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765829_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765831_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765832_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765833_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765834_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765837_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765838_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765846_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765848_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765850_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765851_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX765853_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX774503_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470906_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470909_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470910_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470912_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470913_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470916_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470918_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674386_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674398_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674403_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674411_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674435_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674442_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674444_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674474_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674489_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674494_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF925365_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF925367_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF925377_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF925387_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF925406_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF925408_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT111596_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426346_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426347_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426349_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426350_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426351_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426353_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426356_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426357_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426358_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426359_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426360_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426361_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426362_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426364_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426365_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426366_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426367_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426368_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426369_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426370_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426372_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426373_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426374_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426375_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426376_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426377_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426378_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426379_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426380_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426381_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426382_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426383_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426384_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426385_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426386_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426387_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426388_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426389_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426390_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426391_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426392_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426393_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426394_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426396_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426397_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426398_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426399_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426400_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426401_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426402_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426403_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426404_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426405_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426406_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426407_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426408_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426410_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426411_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426412_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426413_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426414_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426415_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426416_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426417_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426418_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426419_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426421_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426422_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426423_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426424_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426425_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426426_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426427_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426428_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426429_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426430_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426431_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426432_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426433_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426434_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426435_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426436_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426438_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426439_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426440_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426441_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426442_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426443_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426444_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426446_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426447_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426450_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426452_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426453_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426454_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB205125_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
LC592171_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
LC592172_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MF674502_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU498227_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774226_SP_P-C      acaaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggggattc
JQ341614_SP_P-C      acgaaggtctcaatcgccgmgtcgcagargatctccatctcggggatctc
EU939541_SP_P-C      acaaaggtctcaatcgccgcgtcgcaaaaaatctcaatctcgggaatctc
KC774240_SP_P-C      acaaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF873536_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatccc
KF873528_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcyc
KU679960_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratccc
KU679951_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU679947_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatccc
KU679957_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
KU679949_SP_P-C      acgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatccc
KU679936_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccm
KF873514_SP_P-C      acgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatccc
KF873516_SP_P-C      acgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatccc
KF873520_SP_P-C      acgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatccc
KF873525_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
KF873526_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF873529_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF873539_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
KF873541_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
KF873544_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU679937_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratccc
JQ040167_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB241112_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KX276855_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcmatctmggggatctc
JQ040132_SP_P-C      acgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatccc
AY220702_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KJ717804_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KJ803794_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
FJ386640_SP_P-C      acgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB493839_SP_P-C      acgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatccc
FJ386601_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562334_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013799_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013800_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013801_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT114171_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcggggatctc
EU717215_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AY206388_SP_P-C      acgaaggtctcaatcgcctcgtcgcagacgatctcaatctcgggaatctc
AB014388_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
EU560439_SP_P-C      acgacggtctcaatcaccgcgtcgcagaagatctaaatctcgggaatctc
KY363260_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcta
EU670263_SP_P-C      acgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774319_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
JQ040135_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
AY220700_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
EU939603_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
HM011472_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
MK818227_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
FJ386604_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ787437_SP_P-C      acgaaggtctcagtcgccgcgtcgcagaagatctcaatctcgggaatctc
MG826136_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
KY881816_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KU964064_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR014048_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KR013878_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctt
HQ700529_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
AY220699_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
EU554540_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
AB176642_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctc
KR014016_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaggatctcaatctcgggaatctc
AB670242_SP_P-C      acgaaggtctcaatcgccacgtcgcagaagaactcaatctcgggaatctc
AB493844_SP_P-C      acgacgatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctc
AB111115_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ040139_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386617_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
AB670253_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KY363266_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
KY363267_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
AB176643_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
FJ899789_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
EU796069_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
KJ598660_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598656_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598654_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598657_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598653_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598648_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598661_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598641_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598642_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598635_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598636_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598638_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598639_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598640_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598645_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598646_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598647_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598649_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598650_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598651_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598652_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598655_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598658_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598659_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598637_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598644_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774269_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ715343_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562337_SP_P-C      acgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctc
FJ562261_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
FJ562245_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939573_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB014391_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KJ598662_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598663_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598664_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598665_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598666_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598667_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598668_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598669_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598670_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598671_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598672_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598673_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598674_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598676_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598677_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598678_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013842_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013847_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013848_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013844_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013845_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013849_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
X52939_SP_P-C        acgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
MG826134_SP_P-C      acgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctc
KY881991_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
KY881976_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
KY881819_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881815_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881809_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KY881805_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KY881802_SP_P-C      acgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctc
KY363258_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KY363252_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KC793107_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774284_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctc
FJ787459_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
FJ715404_SP_P-C      acgaaggtctcaatcgctgcgtcgcagaagatctcaatctcgggaatctc
FJ386638_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386626_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939566_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcta
EF137802_SP_P-C      acgaagatctcaatcgccgcgtcgcagacgatctcaatctcgggaatctc
DQ993181_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AY641563_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
AB670274_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctc
AB670268_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctc
AB367433_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcggtctcgggaatctc
AB195945_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
AB111113_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
AB014393_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
AB014384_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
AB675674_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB675675_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC792995_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
FJ787451_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
FJ562230_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EF137803_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
AY206384_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB367403_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426577_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426578_SP_P-C      acgaaagtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB014364_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ173291_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ173292_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ173303_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG893558_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881966_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881971_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JN400087_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatcctgggaatctc
JN400089_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatcctgggaatctc
MT426624_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426615_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426612_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426610_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426609_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctc
MT426603_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426599_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426588_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426584_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426579_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426580_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426581_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426582_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426583_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426585_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426586_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426587_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426589_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426590_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426591_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426592_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426593_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426594_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426595_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426596_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426597_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426598_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426600_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426601_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426602_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426604_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426605_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426606_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426607_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426608_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426611_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426613_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426614_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426616_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426617_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426618_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426619_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426620_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426621_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426622_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426623_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426625_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426626_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426627_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426628_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426629_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426631_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426632_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426633_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426634_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426635_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426636_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426638_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426639_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426640_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426641_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426642_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426643_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013943_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ173287_SP_P-C      acgaaagtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939593_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB670294_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB014381_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
AB026811_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB026812_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB026813_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB026814_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AY641558_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ032331_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386577_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JN400088_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ173288_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013791_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774321_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
KC774361_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
KU964046_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctc
KU964042_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964039_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774206_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964034_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964035_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964036_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964037_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964038_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964040_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964041_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964043_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964044_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964045_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964047_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964048_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386611_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KR013883_SP_P-C      acggagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctt
KR013885_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctt
FJ787439_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ787479_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ787441_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY363277_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KU963937_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctc
KC774288_SP_P-C      acgaagatctcaatcgccgcgtcgcacaagatctcaatctcgggaatctc
JF828916_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JF828919_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ377591_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ377545_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386623_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ032336_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU872012_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU522069_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089796_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774221_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
KR013882_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctc
KR013890_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctc
KJ598716_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774253_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089794_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacatc
KJ173317_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KJ173318_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
MT426849_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426677_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426681_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013993_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KC774340_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774330_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
KC774325_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774306_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774302_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
KC774300_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaaactcgggaatctc
KC774282_SP_P-C      acgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctc
KC774238_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
HQ700517_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562323_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562256_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562252_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
FJ562250_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ715341_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ787450_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ377529_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774204_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774280_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774285_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774296_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774298_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774303_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774304_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774308_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774351_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013817_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013818_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013819_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KT364751_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KT364752_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386664_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ032338_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ032339_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY363276_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU871980_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU871998_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB198083_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB014390_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB014377_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB300362_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AY247031_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU871982_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386619_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562225_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ475305_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ475329_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ475339_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ475346_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ377624_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC792862_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598756_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598757_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598765_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013771_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcgatcttgggaatctc
KY881810_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881807_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881803_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaggatctcaatctcgggaatctc
KY881806_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881811_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KY881814_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881818_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562255_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU439025_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaagctcgggaatctt
EU439010_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaagctcgggaatctt
EU439011_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaagctcgggaatctt
DQ377160_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU439008_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
EU439012_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
EU439009_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
EU306724_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
EU306726_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
EU306728_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
FJ715379_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013942_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013788_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013790_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013789_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774335_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774213_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774214_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774211_SP_P-C      acgacgttctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
HM750136_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774189_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774256_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774277_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774254_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013805_SP_P-C      acgaaggtctcaattgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386614_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctt
KR013804_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013807_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013984_SP_P-C      acgaaggcctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013803_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939558_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013808_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562242_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
FJ386652_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
AB250109_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939555_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
AB367413_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ536411_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ536413_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598780_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598779_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598772_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF223961_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598774_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598775_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598776_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ598778_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MN683728_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ475350_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774337_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ787474_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013915_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939643_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU872008_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ787485_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
FJ787482_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
FJ787483_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
FJ787488_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
FJ787489_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
MG826124_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KC774191_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
LC279276_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
D23682_SP_P-C        acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
D23683_SP_P-C        acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC792759_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB670270_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
AB670308_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
AB670246_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
AB670248_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
FJ899773_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG826140_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG826138_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG826132_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG826129_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
MG826128_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881962_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KY881990_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KY881817_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KY881812_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881804_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KY470930_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KY470927_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY363274_SP_P-C      gcgaaggtctcaatcgccgcgtcgcagaagatctcaatgtcgggaatctc
KY363261_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964343_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR014013_SP_P-C      acgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR014008_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013812_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013802_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
KR013778_SP_P-C      acgaaggtctcgatcgccgcgtcgcagaagatctaaatctcgggaatctt
KR013766_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ173295_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcty
KC774353_SP_P-C      acgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctc
JQ040161_SP_P-C      acgtaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ040143_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcty
GU357845_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
GQ377609_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
GQ377586_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatccc
FJ899772_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ899768_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
FJ787484_SP_P-C      acgaaggtctcaatcgccgcgacgcagaagatctcaatctcgggaatctt
FJ787462_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562266_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
FJ562251_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562238_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562220_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ518810_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386673_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
FJ386630_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939658_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939646_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
EU939645_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
EU939605_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939571_SP_P-C      acgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939553_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939539_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctc
EU919169_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
EU916237_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatcccaatctcgggaatctc
EU916214_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU872013_SP_P-C      acgaaggtctcaatcgccgcgtcgccgaagatctaaatctcgggaatctc
EU570067_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU554541_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU554536_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU522071_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ986375_SP_P-C      acgaaggtctcaatcgccgcgtcgctgaagatctcaatctcgggaatctc
DQ980551_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ980547_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ975274_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatcccaatctcgggaatctc
DQ922649_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggaaatctc
DQ377165_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ377164_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AY220701_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AY206392_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctc
AF411412_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF363961_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB697510_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctaggggatctc
AB670306_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctc
AB670277_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB670238_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB367421_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctc
AB111120_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB111118_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB111112_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB106895_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB042282_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
AB042283_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
GQ377557_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ475318_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774334_SP_P-C      acgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctc
KC774311_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ040149_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
JF828937_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
EU939649_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
DQ922651_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB670264_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
AB367405_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctc
AB014396_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctc
EU916238_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562297_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470882_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470885_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470887_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470890_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470891_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470879_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470875_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470874_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB367395_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
DQ089797_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470877_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470880_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470886_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcgatctcgggaatctc
KY470888_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcgatctcgggaatctc
KY470878_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470884_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470873_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470876_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470881_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470883_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470889_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY470892_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013811_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013809_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013813_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013814_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013815_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB670262_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactccc
EU306729_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013767_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707725_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707719_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707717_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707716_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707708_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707710_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707711_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707712_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707718_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707720_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707721_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707722_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707724_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707726_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707727_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707728_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707729_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707731_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707732_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707733_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ707723_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013875_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggagtctc
KR013833_SP_P-C      acgaagatctcaatcgccgcgtcgcagaaggtctcaatctcgggaatctc
EU939654_SP_P-C      acgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
EU939644_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939556_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
AB033551_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881997_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881883_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881872_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881882_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881980_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ787457_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatttc
FJ787458_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF461358_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF461359_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF411410_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JX504541_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774352_SP_P-C      acgaaggtctcaaataccgcgtcgcagaagatctcaatctcgggaatctc
FJ787463_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ787453_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ787454_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF533983_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB111116_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU306672_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AP011106_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU306671_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AP011107_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG826131_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG826133_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG826135_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG826137_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ173306_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939586_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939543_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939597_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386596_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386597_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386687_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562239_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
JQ040144_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU964004_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ475316_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ475327_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ475334_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ358158_SP_C-C      acgaagatctcaatcgccgcgtcgcagacgatctcaatctcgggaatctc
GQ475312_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KM875423_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
EU871978_SP_P-C      ccgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
EU871979_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
AB014395_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB014383_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
AB014389_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
D23684_SP_P-C        acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774237_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccc
FJ562335_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
GQ377552_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774272_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939536_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU439013_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KU963997_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774281_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ715365_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562280_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939611_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU796070_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU796072_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF411408_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AF411411_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB014378_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB697500_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
D23680_SP_P-C        acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774354_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
JX026880_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
FJ562270_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
FJ562241_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
EU306725_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggggtctc
EU939659_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
FJ899761_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
FJ899765_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KU964201_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KU964204_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KU964207_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KU964208_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KU964210_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KU964211_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
KU964213_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctc
EU717212_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU554542_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ032345_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB014374_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
EU939537_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ562329_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KR013846_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881981_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386602_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB367408_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KJ173302_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY363254_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
KY470926_SP_P-C      acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctt
FJ032340_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ032341_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB670304_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KC774279_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB300368_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KT284754_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
AB014399_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
FJ386657_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KF779327_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG826139_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MT426630_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG893560_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG893557_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
MG826122_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY882003_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881998_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881994_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881989_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881983_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881978_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881972_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctc
KY881965_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881964_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
KY881963_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
KY881938_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
KY881939_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
KY881940_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
KY881941_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
KY881942_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
KY881943_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
KY881959_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc
KY881969_SP_P-C      acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctc