HBVdb

Dataset for nucleotide sequence SP of genotype C

[Download (right click)] [Alignment] [Repertoires]

2988 sequence(s)

>gnl|hbvcds|AB014360_SP_P-C Feature FT:CDS AB014360_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01D01HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacggttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014361_SP_P-C Feature FT:CDS AB014361_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 02D02HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014362_SP_P-C Feature FT:CDS AB014362_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 03D03HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014363_SP_P-C Feature FT:CDS AB014363_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 04D04HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatatttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014364_SP_P-C Feature FT:CDS AB014364_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 05D05HCC). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcamctctatgtttccctcttgttgctgtacaaaaccttcggacg
gcaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014365_SP_P-C Feature FT:CDS AB014365_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01D06HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014367_SP_P-C Feature FT:CDS AB014367_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 08D08HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratctcaatgaacatcaactaccagtac
gggaacatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014368_SP_P-C Feature FT:CDS AB014368_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 09D09HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacrtcaactaccagcac
gggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcy
tggctcagtttactag
>gnl|hbvcds|AB014369_SP_P-C Feature FT:CDS AB014369_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10D10HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014371_SP_P-C Feature FT:CDS AB014371_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 12D12HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014372_SP_P-C Feature FT:CDS AB014372_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 13D13HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaaactctacgattccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB014373_SP_P-C Feature FT:CDS AB014373_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 14D14HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaggacctgcacgactcctgctcaaaacacctcagggattccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014374_SP_P-C Feature FT:CDS AB014374_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 15D15HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatctactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014376_SP_P-C Feature FT:CDS AB014376_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 17T02HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014377_SP_P-C Feature FT:CDS AB014377_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18T03HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014378_SP_P-C Feature FT:CDS AB014378_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 19Y01HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014379_SP_P-C Feature FT:CDS AB014379_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 20Y02HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatyaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaaacacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014380_SP_P-C Feature FT:CDS AB014380_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 21Y03HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcaactctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014381_SP_P-C Feature FT:CDS AB014381_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 22Y04HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014382_SP_P-C Feature FT:CDS AB014382_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23Y05HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcgaaacacctctatatttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014383_SP_P-C Feature FT:CDS AB014383_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 24Y06HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014384_SP_P-C Feature FT:CDS AB014384_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 25Y07HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaacwaccagcac
gggaccatgcaagacctgcacrattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014385_SP_P-C Feature FT:CDS AB014385_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26Y08HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcagaacacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014386_SP_P-C Feature FT:CDS AB014386_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 27Y09HCC). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcatcacttccggaaacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacatgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014387_SP_P-C Feature FT:CDS AB014387_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 28Y10HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgaacatcaacaaacagcac
gggaccatgcaagacctgcacgattcctgctcaaaacacctctatgtttccctcttgttgctgtacaaaaccttcggaca
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB014388_SP_P-C Feature FT:CDS AB014388_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 29Y11HCC). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaacyaccagcac
gggaccatgcaagacctgcacgaytcctgctcaaaacacctctatgtttccctcytgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcrtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014389_SP_P-C Feature FT:CDS AB014389_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 30Y12HCC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014390_SP_P-C Feature FT:CDS AB014390_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 31Y13HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014391_SP_P-C Feature FT:CDS AB014391_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 32Y14HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaaacaactctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
trgctcagtttactag
>gnl|hbvcds|AB014392_SP_P-C Feature FT:CDS AB014392_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 33Y15HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaaacacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014393_SP_P-C Feature FT:CDS AB014393_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 34Y16HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcattttactag
>gnl|hbvcds|AB014394_SP_P-C Feature FT:CDS AB014394_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 35Y17HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014395_SP_P-C Feature FT:CDS AB014395_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 36Y18HCC). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggttttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014396_SP_P-C Feature FT:CDS AB014396_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 37Y19HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaagcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014397_SP_P-C Feature FT:CDS AB014397_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 38Y20HCC). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014398_SP_P-C Feature FT:CDS AB014398_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 39Y21HCC). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttgtgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacatgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB014399_SP_P-C Feature FT:CDS AB014399_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 40Y22HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB026811_SP_P-C Feature FT:CDS AB026811_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;97.Feb.). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB026812_SP_P-C Feature FT:CDS AB026812_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;98.May). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB026813_SP_P-C Feature FT:CDS AB026813_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;97.Sep.). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB026814_SP_P-C Feature FT:CDS AB026814_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Donor 3;98.May). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB026815_SP_P-C Feature FT:CDS AB026815_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 2:full). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB031262_SP_P-C Feature FT:CDS AB031262_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV VietA-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacgtcaaccaccagcat
gggaccatgcaagacctgcacaactcctgctctaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB033550_SP_P-C Feature FT:CDS AB033550_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NDR260). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB033551_SP_P-C Feature FT:CDS AB033551_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK300). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagaaccgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB033552_SP_P-C Feature FT:CDS AB033552_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK494). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB033553_SP_P-C Feature FT:CDS AB033553_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK619). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacgaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB033556_SP_P-C Feature FT:CDS AB033556_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AK66). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB042282_SP_P-C Feature FT:CDS AB042282_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB042283_SP_P-C Feature FT:CDS AB042283_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB042284_SP_P-C Feature FT:CDS AB042284_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctccactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB042285_SP_P-C Feature FT:CDS AB042285_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-4). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB049610_SP_P-C Feature FT:CDS AB049610_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV AN29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB050018_SP_P-C Feature FT:CDS AB050018_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB074047_SP_P-C Feature FT:CDS AB074047_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtagcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcgaaacatctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB074755_SP_P-C Feature FT:CDS AB074755_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB074756_SP_P-C Feature FT:CDS AB074756_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th55). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB105173_SP_P-C Feature FT:CDS AB105173_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hawaii 16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB105174_SP_P-C Feature FT:CDS AB105174_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hawaii 60). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB106895_SP_P-C Feature FT:CDS AB106895_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate pHB4-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacggttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB111112_SP_P-C Feature FT:CDS AB111112_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaatctctatgtgtccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB111113_SP_P-C Feature FT:CDS AB111113_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgaaagacctgcacgattcctgctcaaggaatctctatgtgtccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB111114_SP_P-C Feature FT:CDS AB111114_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB111115_SP_P-C Feature FT:CDS AB111115_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
aggcccctatcatatcaacacttacggaaactactgatgctagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
aaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB111116_SP_P-C Feature FT:CDS AB111116_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
aaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB111117_SP_P-C Feature FT:CDS AB111117_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgttcctcc
tggctcagtttactag
>gnl|hbvcds|AB111118_SP_P-C Feature FT:CDS AB111118_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacaaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB111119_SP_P-C Feature FT:CDS AB111119_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcaatttactag
>gnl|hbvcds|AB111120_SP_P-C Feature FT:CDS AB111120_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB111121_SP_P-C Feature FT:CDS AB111121_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB111122_SP_P-C Feature FT:CDS AB111122_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB111123_SP_P-C Feature FT:CDS AB111123_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB111124_SP_P-C Feature FT:CDS AB111124_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB111125_SP_P-C Feature FT:CDS AB111125_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB111946_SP_P-C Feature FT:CDS AB111946_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT103). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcat
gggaccatgcaagacctgcacgacacctgctcaaggaacctctatgtttccctcttgttgctgtaccaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB112063_SP_P-C Feature FT:CDS AB112063_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT101). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcat
gggaccatgcaagacctgcacgacacctgctcaaggaacctctatgtttccctcttgttgctgtacacaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB112065_SP_P-C Feature FT:CDS AB112065_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT140). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccatcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB112066_SP_P-C Feature FT:CDS AB112066_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY624). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccccatcttatcaacactcccggaaactactgttgttagacgacgaggcaggtcccctagaaagagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccatcac
gggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccctcgtgctgctgtacaaaaccttcggacg
gaaatggcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB112348_SP_P-C Feature FT:CDS AB112348_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY656). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggccggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctctaggagactctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB112408_SP_P-C Feature FT:CDS AB112408_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY683). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctctaggcatctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB112471_SP_P-C Feature FT:CDS AB112471_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TH123). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctggacgaatcctgctcaaggaacctctatgtttccctcatgttggtggacaaaaccttgggacg
gaaaatgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB112472_SP_P-C Feature FT:CDS AB112472_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TH124). Complete genome. [Hepadnaviridae] (length=336 residues).
atgctcctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaattccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB113875_SP_P-C Feature FT:CDS AB113875_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB113876_SP_P-C Feature FT:CDS AB113876_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB113877_SP_P-C Feature FT:CDS AB113877_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaaactctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB113878_SP_P-C Feature FT:CDS AB113878_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB113879_SP_P-C Feature FT:CDS AB113879_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB115417_SP_P-C Feature FT:CDS AB115417_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-O47). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgattcctgctcaaagcacctctatgtttccctcttggtggtggacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcgtcctgggctttcgcaagaatcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB115418_SP_P-C Feature FT:CDS AB115418_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-O55). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagaccccgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttcccttttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcgtcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB117758_SP_P-C Feature FT:CDS AB117758_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CB10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB176642_SP_P-C Feature FT:CDS AB176642_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-115). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB176643_SP_P-C Feature FT:CDS AB176643_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-NK1). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaayctctatgagtccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB182589_SP_P-C Feature FT:CDS AB182589_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CH:Mat-Ko). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195930_SP_P-C Feature FT:CDS AB195930_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcgtatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195931_SP_P-C Feature FT:CDS AB195931_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195932_SP_P-C Feature FT:CDS AB195932_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcattccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195936_SP_P-C Feature FT:CDS AB195936_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195937_SP_P-C Feature FT:CDS AB195937_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195938_SP_P-C Feature FT:CDS AB195938_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195942_SP_P-C Feature FT:CDS AB195942_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195943_SP_P-C Feature FT:CDS AB195943_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB195944_SP_P-C Feature FT:CDS AB195944_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB195945_SP_P-C Feature FT:CDS AB195945_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccgtcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195946_SP_P-C Feature FT:CDS AB195946_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgttgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccgtcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB195947_SP_P-C Feature FT:CDS AB195947_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195948_SP_P-C Feature FT:CDS AB195948_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195949_SP_P-C Feature FT:CDS AB195949_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195952_SP_P-C Feature FT:CDS AB195952_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195953_SP_P-C Feature FT:CDS AB195953_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB195954_SP_P-C Feature FT:CDS AB195954_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB198076_SP_P-C Feature FT:CDS AB198076_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB198077_SP_P-C Feature FT:CDS AB198077_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB198078_SP_P-C Feature FT:CDS AB198078_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB198079_SP_P-C Feature FT:CDS AB198079_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB198080_SP_P-C Feature FT:CDS AB198080_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB198081_SP_P-C Feature FT:CDS AB198081_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB198082_SP_P-C Feature FT:CDS AB198082_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB198083_SP_P-C Feature FT:CDS AB198083_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB202071_SP_P-C Feature FT:CDS AB202071_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB202072_SP_P-C Feature FT:CDS AB202072_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB205123_SP_P-C Feature FT:CDS AB205123_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CN578-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaccaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttcctag
>gnl|hbvcds|AB205124_SP_P-C Feature FT:CDS AB205124_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TJ3-1-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaaggactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB205125_SP_P-C Feature FT:CDS AB205125_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VH34-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB222714_SP_P-C Feature FT:CDS AB222714_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UZNVC7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB222715_SP_P-C Feature FT:CDS AB222715_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UZNVC7M). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB241110_SP_P-C Feature FT:CDS AB241110_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhLC03). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccacaacaagcac
gggaccatgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB241111_SP_P-C Feature FT:CDS AB241111_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhLC14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB241112_SP_P-C Feature FT:CDS AB241112_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhHCC15). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccacaacaagcac
gggaccatgcaaaacctgcacgaatcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB241113_SP_P-C Feature FT:CDS AB241113_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhHCC13). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctccaccaccagcac
gggaccctgcaaaacctgcacgaatcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB246344_SP_P-C Feature FT:CDS AB246344_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB246345_SP_P-C Feature FT:CDS AB246345_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB246346_SP_P-C Feature FT:CDS AB246346_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacttcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB247916_SP_P-C Feature FT:CDS AB247916_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
ttactcagtttactag
>gnl|hbvcds|AB250109_SP_P-C Feature FT:CDS AB250109_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IH030213). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagatgtcgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB288026_SP_P-C Feature FT:CDS AB288026_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB298720_SP_P-C Feature FT:CDS AB298720_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BAJT2006-1S). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgcaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB298721_SP_P-C Feature FT:CDS AB298721_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BAJT2006-1C). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgcaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB299858_SP_P-C Feature FT:CDS AB299858_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB300359_SP_P-C Feature FT:CDS AB300359_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB300360_SP_P-C Feature FT:CDS AB300360_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccttgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB300361_SP_P-C Feature FT:CDS AB300361_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagaactcaatctcgggaatctcaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB300362_SP_P-C Feature FT:CDS AB300362_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB300363_SP_P-C Feature FT:CDS AB300363_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB300365_SP_P-C Feature FT:CDS AB300365_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB300368_SP_P-C Feature FT:CDS AB300368_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB300372_SP_P-C Feature FT:CDS AB300372_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient14). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggcttccgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB300373_SP_P-C Feature FT:CDS AB300373_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient15). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctgtcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB362932_SP_P-C Feature FT:CDS AB362932_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB365451_SP_P-C Feature FT:CDS AB365451_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BOL196). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaagaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367392_SP_P-C Feature FT:CDS AB367392_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367394_SP_P-C Feature FT:CDS AB367394_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 3/Adefovir-treated Pt. 8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367395_SP_P-C Feature FT:CDS AB367395_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367396_SP_P-C Feature FT:CDS AB367396_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggactgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367397_SP_P-C Feature FT:CDS AB367397_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367398_SP_P-C Feature FT:CDS AB367398_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 7/Adefovir-treated Pt. 20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367399_SP_P-C Feature FT:CDS AB367399_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 8/Adefovir-treated Pt. 29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367401_SP_P-C Feature FT:CDS AB367401_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 10/Adefovir-treated Pt. 9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367402_SP_P-C Feature FT:CDS AB367402_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagttcactag
>gnl|hbvcds|AB367403_SP_P-C Feature FT:CDS AB367403_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 12/Adefovir-treated Pt. 17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagtac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367404_SP_P-C Feature FT:CDS AB367404_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 13/Adefovir-treated Pt. 22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367405_SP_P-C Feature FT:CDS AB367405_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 14/Adefovir-treated Pt. 25). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367406_SP_P-C Feature FT:CDS AB367406_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 15/Adefovir-treated Pt. 7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367407_SP_P-C Feature FT:CDS AB367407_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 16/Adefovir-treated Pt. 11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367408_SP_P-C Feature FT:CDS AB367408_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 17/Adefovir-treated Pt. 14). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367409_SP_P-C Feature FT:CDS AB367409_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 18). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcatgacctgcacgactcctgctcatggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367410_SP_P-C Feature FT:CDS AB367410_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 19/Adefovir-treated Pt. 19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367411_SP_P-C Feature FT:CDS AB367411_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367412_SP_P-C Feature FT:CDS AB367412_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367413_SP_P-C Feature FT:CDS AB367413_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 22/Adefovir-treated Pt. 4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367414_SP_P-C Feature FT:CDS AB367414_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 23/Adefovir-treated Pt. 3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367416_SP_P-C Feature FT:CDS AB367416_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367417_SP_P-C Feature FT:CDS AB367417_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367418_SP_P-C Feature FT:CDS AB367418_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 27/Adefovir-treated Pt. 21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaacatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367420_SP_P-C Feature FT:CDS AB367420_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367421_SP_P-C Feature FT:CDS AB367421_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 30). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367422_SP_P-C Feature FT:CDS AB367422_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 31/Adefovir-treated Pt. 12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367423_SP_P-C Feature FT:CDS AB367423_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 32/Adefovir-treated Pt. 28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtggggctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367424_SP_P-C Feature FT:CDS AB367424_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367425_SP_P-C Feature FT:CDS AB367425_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 34/Adefovir-treated Pt. 15). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367426_SP_P-C Feature FT:CDS AB367426_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 35). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggcttccgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367427_SP_P-C Feature FT:CDS AB367427_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 36/Adefovir-treated Pt. 18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagatacctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367428_SP_P-C Feature FT:CDS AB367428_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 37/Adefovir-treated Pt. 10). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367429_SP_P-C Feature FT:CDS AB367429_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 38). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaatctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367430_SP_P-C Feature FT:CDS AB367430_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 39/Adefovir-treated Pt. 5). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367431_SP_P-C Feature FT:CDS AB367431_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 40). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367432_SP_P-C Feature FT:CDS AB367432_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367433_SP_P-C Feature FT:CDS AB367433_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 42/Adefovir-treated Pt. 27). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtccccgagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB367434_SP_P-C Feature FT:CDS AB367434_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 43/Adefovir-treated Pt. 26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcatgtctcctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367435_SP_P-C Feature FT:CDS AB367435_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 44/Adefovir-treated Pt. 23). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367801_SP_P-C Feature FT:CDS AB367801_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 30). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggcttccgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367802_SP_P-C Feature FT:CDS AB367802_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 16). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB367803_SP_P-C Feature FT:CDS AB367803_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaatgtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB367804_SP_P-C Feature FT:CDS AB367804_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB368297_SP_P-C Feature FT:CDS AB368297_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatctttggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB426467_SP_P-C Feature FT:CDS AB426467_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB471848_SP_P-C Feature FT:CDS AB471848_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-F). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB471849_SP_P-C Feature FT:CDS AB471849_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-C2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB471850_SP_P-C Feature FT:CDS AB471850_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-C1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB471851_SP_P-C Feature FT:CDS AB471851_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2NK-F). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB471852_SP_P-C Feature FT:CDS AB471852_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2S-C2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB471853_SP_P-C Feature FT:CDS AB471853_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2S-C3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB485808_SP_P-C Feature FT:CDS AB485808_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-IT). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB485810_SP_P-C Feature FT:CDS AB485810_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FEP2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB493839_SP_P-C Feature FT:CDS AB493839_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 08UC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgaacatcaacgaccaccac
aggaccttgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB493844_SP_P-C Feature FT:CDS AB493844_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 43UC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccttgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB640730_SP_P-C Feature FT:CDS AB640730_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ehime-EPCH-HBV-C1-HN). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB642095_SP_P-C Feature FT:CDS AB642095_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2000-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB642097_SP_P-C Feature FT:CDS AB642097_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2003-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB642099_SP_P-C Feature FT:CDS AB642099_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2005-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB642100_SP_P-C Feature FT:CDS AB642100_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2006-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670237_SP_P-C Feature FT:CDS AB670237_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgactcctgctcaarrcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcmtgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670238_SP_P-C Feature FT:CDS AB670238_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggcccatgcaaggcctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670239_SP_P-C Feature FT:CDS AB670239_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670240_SP_P-C Feature FT:CDS AB670240_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670241_SP_P-C Feature FT:CDS AB670241_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcytgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670242_SP_P-C Feature FT:CDS AB670242_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccacgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgatccctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670243_SP_P-C Feature FT:CDS AB670243_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.7). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670246_SP_P-C Feature FT:CDS AB670246_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.10). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagaactgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670247_SP_P-C Feature FT:CDS AB670247_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670248_SP_P-C Feature FT:CDS AB670248_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.12). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcratgaacatcaactaccagcac
gggaccatgcaagaactgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670249_SP_P-C Feature FT:CDS AB670249_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacttcaactaccagcac
gggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670251_SP_P-C Feature FT:CDS AB670251_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.15). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670252_SP_P-C Feature FT:CDS AB670252_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagggaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670253_SP_P-C Feature FT:CDS AB670253_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670254_SP_P-C Feature FT:CDS AB670254_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.18). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670255_SP_P-C Feature FT:CDS AB670255_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.19). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670256_SP_P-C Feature FT:CDS AB670256_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670258_SP_P-C Feature FT:CDS AB670258_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacggttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670259_SP_P-C Feature FT:CDS AB670259_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.23). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgaacatcgactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670260_SP_P-C Feature FT:CDS AB670260_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagatgtcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670261_SP_P-C Feature FT:CDS AB670261_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670262_SP_P-C Feature FT:CDS AB670262_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670263_SP_P-C Feature FT:CDS AB670263_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670264_SP_P-C Feature FT:CDS AB670264_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB670265_SP_P-C Feature FT:CDS AB670265_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaactgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670266_SP_P-C Feature FT:CDS AB670266_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670267_SP_P-C Feature FT:CDS AB670267_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.31). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcargacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670268_SP_P-C Feature FT:CDS AB670268_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.32). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcmacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgttgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670269_SP_P-C Feature FT:CDS AB670269_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670270_SP_P-C Feature FT:CDS AB670270_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670272_SP_P-C Feature FT:CDS AB670272_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaactgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670273_SP_P-C Feature FT:CDS AB670273_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgaacatcaactaccagcac
gggaccatgcaagacctgcacaaytcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670274_SP_P-C Feature FT:CDS AB670274_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactrttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcmgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670275_SP_P-C Feature FT:CDS AB670275_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB670276_SP_P-C Feature FT:CDS AB670276_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670277_SP_P-C Feature FT:CDS AB670277_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaccctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670278_SP_P-C Feature FT:CDS AB670278_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670279_SP_P-C Feature FT:CDS AB670279_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgactgctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670281_SP_P-C Feature FT:CDS AB670281_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670282_SP_P-C Feature FT:CDS AB670282_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattactgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670283_SP_P-C Feature FT:CDS AB670283_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670285_SP_P-C Feature FT:CDS AB670285_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670287_SP_P-C Feature FT:CDS AB670287_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670288_SP_P-C Feature FT:CDS AB670288_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.15). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670289_SP_P-C Feature FT:CDS AB670289_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670290_SP_P-C Feature FT:CDS AB670290_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670291_SP_P-C Feature FT:CDS AB670291_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670292_SP_P-C Feature FT:CDS AB670292_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670294_SP_P-C Feature FT:CDS AB670294_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.21). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcccctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670295_SP_P-C Feature FT:CDS AB670295_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670297_SP_P-C Feature FT:CDS AB670297_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670298_SP_P-C Feature FT:CDS AB670298_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacgtcaactaccagcac
gggaccatgcaagacctgcacgaatcctgccaacggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670300_SP_P-C Feature FT:CDS AB670300_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670301_SP_P-C Feature FT:CDS AB670301_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670302_SP_P-C Feature FT:CDS AB670302_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670304_SP_P-C Feature FT:CDS AB670304_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.31). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcractaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgttgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670305_SP_P-C Feature FT:CDS AB670305_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670306_SP_P-C Feature FT:CDS AB670306_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactrttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670307_SP_P-C Feature FT:CDS AB670307_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.34). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670308_SP_P-C Feature FT:CDS AB670308_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.35). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670309_SP_P-C Feature FT:CDS AB670309_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.36). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670310_SP_P-C Feature FT:CDS AB670310_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttgtattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB670311_SP_P-C Feature FT:CDS AB670311_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB675674_SP_P-C Feature FT:CDS AB675674_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccctcttgttgctgttcaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB675675_SP_P-C Feature FT:CDS AB675675_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccctcttgttgctgttcaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB675677_SP_P-C Feature FT:CDS AB675677_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A39). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB697490_SP_P-C Feature FT:CDS AB697490_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggactgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB697494_SP_P-C Feature FT:CDS AB697494_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No9). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB697500_SP_P-C Feature FT:CDS AB697500_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB697502_SP_P-C Feature FT:CDS AB697502_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaacgaggtaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB697510_SP_P-C Feature FT:CDS AB697510_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttcttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctaggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB900099_SP_P-C Feature FT:CDS AB900099_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB900109_SP_P-C Feature FT:CDS AB900109_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB900113_SP_P-C Feature FT:CDS AB900113_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaacgaccagtac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB900115_SP_P-C Feature FT:CDS AB900115_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB900116_SP_P-C Feature FT:CDS AB900116_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB931170_SP_P-C Feature FT:CDS AB931170_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2P_HB11-0921). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgattcctgctcaagggacctctatgtttccctcttgttgctgttcaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB931171_SP_P-C Feature FT:CDS AB931171_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2S_HB11-0922). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgattcctgctcaagggacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB971714_SP_P-C Feature FT:CDS AB971714_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB11-1026). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaggacctgcacgactcttgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB971715_SP_P-C Feature FT:CDS AB971715_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB11-1027). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaggacctgcacgactcttgttcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF068756_SP_P-C Feature FT:CDS AF068756_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF182802_SP_P-C Feature FT:CDS AF182802_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacaaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcccgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcaatccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF182803_SP_P-C Feature FT:CDS AF182803_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcaatccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF182804_SP_P-C Feature FT:CDS AF182804_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF182805_SP_P-C Feature FT:CDS AF182805_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF223954_SP_P-C Feature FT:CDS AF223954_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF223955_SP_P-C Feature FT:CDS AF223955_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF223956_SP_P-C Feature FT:CDS AF223956_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF223957_SP_P-C Feature FT:CDS AF223957_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF223958_SP_P-C Feature FT:CDS AF223958_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF223959_SP_P-C Feature FT:CDS AF223959_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF223960_SP_P-C Feature FT:CDS AF223960_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggsaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF223961_SP_P-C Feature FT:CDS AF223961_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF241410_SP_P-C Feature FT:CDS AF241410_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 3270). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF241411_SP_P-C Feature FT:CDS AF241411_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8290). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF286594_SP_P-C Feature FT:CDS AF286594_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF363961_SP_P-C Feature FT:CDS AF363961_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggcttccgcaagattcctatgggagttggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF384371_SP_P-C Feature FT:CDS AF384371_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G376-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF411408_SP_P-C Feature FT:CDS AF411408_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcagatcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF411410_SP_P-C Feature FT:CDS AF411410_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccaccaccctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF411411_SP_P-C Feature FT:CDS AF411411_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcagatcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF411412_SP_P-C Feature FT:CDS AF411412_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcgactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF458664_SP_P-C Feature FT:CDS AF458664_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C84). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccgggaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF458665_SP_P-C Feature FT:CDS AF458665_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C733). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF461357_SP_P-C Feature FT:CDS AF461357_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF461358_SP_P-C Feature FT:CDS AF461358_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH8). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcgcgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttttcc
tggctcagtttactag
>gnl|hbvcds|AF461359_SP_P-C Feature FT:CDS AF461359_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate c16). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcgcgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF461363_SP_P-C Feature FT:CDS AF461363_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF473543_SP_P-C Feature FT:CDS AF473543_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2e). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccctgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF533983_SP_P-C Feature FT:CDS AF533983_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgtagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AJ748098_SP_P-C Feature FT:CDS AJ748098_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient Z1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AP011097_SP_P-C Feature FT:CDS AP011097_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AP011098_SP_P-C Feature FT:CDS AP011098_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AP011099_SP_P-C Feature FT:CDS AP011099_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AP011100_SP_P-C Feature FT:CDS AP011100_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AP011101_SP_P-C Feature FT:CDS AP011101_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AP011106_SP_P-C Feature FT:CDS AP011106_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AP011107_SP_P-C Feature FT:CDS AP011107_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY057947_SP_P-C Feature FT:CDS AY057947_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Tibet705). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacgtgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY066028_SP_P-C Feature FT:CDS AY066028_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY167090_SP_P-C Feature FT:CDS AY167090_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY167091_SP_P-C Feature FT:CDS AY167091_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ic). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagaggacgaagcagggcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY167092_SP_P-C Feature FT:CDS AY167092_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Id). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY167096_SP_P-C Feature FT:CDS AY167096_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IIIa). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY167099_SP_P-C Feature FT:CDS AY167099_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IVb). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaaatgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY206376_SP_P-C Feature FT:CDS AY206376_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaaggcctgcacgactcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY206378_SP_P-C Feature FT:CDS AY206378_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcctcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY206379_SP_P-C Feature FT:CDS AY206379_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaaggcctgcacgactcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY206381_SP_P-C Feature FT:CDS AY206381_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcacagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY206382_SP_P-C Feature FT:CDS AY206382_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttcttc
tggctcagtttactag
>gnl|hbvcds|AY206384_SP_P-C Feature FT:CDS AY206384_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatggaagtgtgcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY206385_SP_P-C Feature FT:CDS AY206385_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY206386_SP_P-C Feature FT:CDS AY206386_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggagtctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtaccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY206388_SP_P-C Feature FT:CDS AY206388_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol). [Hepadnaviridae] (length=333 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaggcaggtcccctagaagaagaactccctcgcct
cgcagacgaaggtctcaatcgcctcgtcgcagacgatctcaatctcgggaatctcaatgaaattcaactaccagcacggg
accatgcaagacctgcacgattcctgctcaaggaacctctatgagtccctcttgttgctgtacaaaaccttcggacggaa
actgcacttgtattcccatcccatcatcttgggccttcgcaagattcctatgggagtgggcctcagtccgtttctcctgg
ctcagtttactag
>gnl|hbvcds|AY206389_SP_P-C Feature FT:CDS AY206389_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY206392_SP_P-C Feature FT:CDS AY206392_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY220699_SP_P-C Feature FT:CDS AY220699_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY220700_SP_P-C Feature FT:CDS AY220700_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaacatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgagagtgggcctcagtccgtttctcc
tggctcaatttactag
>gnl|hbvcds|AY220701_SP_P-C Feature FT:CDS AY220701_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaactcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gcaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY220702_SP_P-C Feature FT:CDS AY220702_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacccttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccaacac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttgacaagattcctatgggagtgggcctcaatccgtttctcc
tgactcaatttactag
>gnl|hbvcds|AY247031_SP_P-C Feature FT:CDS AY247031_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUHB84). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY247032_SP_P-C Feature FT:CDS AY247032_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUHB95). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY306136_SP_P-C Feature FT:CDS AY306136_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H85). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY596107_SP_P-C Feature FT:CDS AY596107_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib-1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggtaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacttgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctca
tggctaagtttactag
>gnl|hbvcds|AY596108_SP_P-C Feature FT:CDS AY596108_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY641558_SP_P-C Feature FT:CDS AY641558_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He74). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY641559_SP_P-C Feature FT:CDS AY641559_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He53). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcaatttactag
>gnl|hbvcds|AY641560_SP_P-C Feature FT:CDS AY641560_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He100). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY641561_SP_P-C Feature FT:CDS AY641561_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He127). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY641562_SP_P-C Feature FT:CDS AY641562_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He82). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaaacacctctatttttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY641563_SP_P-C Feature FT:CDS AY641563_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He52). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgcggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcgactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY862869_SP_P-C Feature FT:CDS AY862869_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H8). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|D00630_SP_P-C Feature FT:CDS D00630_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|D12980_SP_P-C Feature FT:CDS D12980_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttggtgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|D23680_SP_P-C Feature FT:CDS D23680_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B4-HBVST1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|D23681_SP_P-C Feature FT:CDS D23681_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C4-HBVST2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgcttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|D23682_SP_P-C Feature FT:CDS D23682_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B5-HBVKO1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|D23683_SP_P-C Feature FT:CDS D23683_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C5-HBVKO2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|D23684_SP_P-C Feature FT:CDS D23684_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C6-TKB588). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|D28880_SP_P-C Feature FT:CDS D28880_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Plasma 1992-085-9434). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacaccaactaccagcac
aggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcatttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|D50517_SP_P-C Feature FT:CDS D50517_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|D50518_SP_P-C Feature FT:CDS D50518_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|D50519_SP_P-C Feature FT:CDS D50519_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tgggtcagtttactag
>gnl|hbvcds|D50520_SP_P-C Feature FT:CDS D50520_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089756_SP_P-C Feature FT:CDS DQ089756_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK75). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089757_SP_P-C Feature FT:CDS DQ089757_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2342). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089758_SP_P-C Feature FT:CDS DQ089758_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1733). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089759_SP_P-C Feature FT:CDS DQ089759_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1512). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089760_SP_P-C Feature FT:CDS DQ089760_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK454). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089761_SP_P-C Feature FT:CDS DQ089761_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK515). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089762_SP_P-C Feature FT:CDS DQ089762_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1644). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctmaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089763_SP_P-C Feature FT:CDS DQ089763_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1048). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089764_SP_P-C Feature FT:CDS DQ089764_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK967). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089765_SP_P-C Feature FT:CDS DQ089765_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK428). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089766_SP_P-C Feature FT:CDS DQ089766_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK553). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgyaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089767_SP_P-C Feature FT:CDS DQ089767_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1663). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089768_SP_P-C Feature FT:CDS DQ089768_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1814). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089769_SP_P-C Feature FT:CDS DQ089769_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK430). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcgtgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089770_SP_P-C Feature FT:CDS DQ089770_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1272). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagccaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089771_SP_P-C Feature FT:CDS DQ089771_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1629). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089772_SP_P-C Feature FT:CDS DQ089772_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK910). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089773_SP_P-C Feature FT:CDS DQ089773_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1193). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttyttagacgacgaggcagctcccctagaagaagaactccctcg
cctcgcagacgaagttctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089775_SP_P-C Feature FT:CDS DQ089775_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK290). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089776_SP_P-C Feature FT:CDS DQ089776_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK884). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089777_SP_P-C Feature FT:CDS DQ089777_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1159). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089778_SP_P-C Feature FT:CDS DQ089778_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1442). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagacgatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089779_SP_P-C Feature FT:CDS DQ089779_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK554). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089780_SP_P-C Feature FT:CDS DQ089780_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK947). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcay
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089781_SP_P-C Feature FT:CDS DQ089781_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1476). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089782_SP_P-C Feature FT:CDS DQ089782_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2032). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089783_SP_P-C Feature FT:CDS DQ089783_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1402). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089784_SP_P-C Feature FT:CDS DQ089784_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1285). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacctccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089785_SP_P-C Feature FT:CDS DQ089785_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1386). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaagaaggtctcaatcgccgcgtcgccgaagaactcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089786_SP_P-C Feature FT:CDS DQ089786_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2074). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacaacgaggcaggtcccttagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089787_SP_P-C Feature FT:CDS DQ089787_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK352). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089788_SP_P-C Feature FT:CDS DQ089788_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK820). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089789_SP_P-C Feature FT:CDS DQ089789_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK926). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089790_SP_P-C Feature FT:CDS DQ089790_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1248). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggwcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaggcctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggtctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089791_SP_P-C Feature FT:CDS DQ089791_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1205). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacyaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089792_SP_P-C Feature FT:CDS DQ089792_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK870). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaagamgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089793_SP_P-C Feature FT:CDS DQ089793_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK343). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089794_SP_P-C Feature FT:CDS DQ089794_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1896). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacatcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089795_SP_P-C Feature FT:CDS DQ089795_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1465). Complete genome. [Hepadnaviridae] (length=339 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaaattcaacaaccaccag
cacggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcgg
acggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggsctcagtccgtttc
tcctggctcagtttactag
>gnl|hbvcds|DQ089796_SP_P-C Feature FT:CDS DQ089796_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK751). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaacmaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089797_SP_P-C Feature FT:CDS DQ089797_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1169). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089799_SP_P-C Feature FT:CDS DQ089799_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK734). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089800_SP_P-C Feature FT:CDS DQ089800_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK741). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089801_SP_P-C Feature FT:CDS DQ089801_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2100). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagatacctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089802_SP_P-C Feature FT:CDS DQ089802_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1371). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089803_SP_P-C Feature FT:CDS DQ089803_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK931). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgaatcctgctcaagggacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ089804_SP_P-C Feature FT:CDS DQ089804_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK262). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ246215_SP_P-C Feature FT:CDS DQ246215_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GZ-DYH). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|DQ315781_SP_P-C Feature FT:CDS DQ315781_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI0398). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ315782_SP_P-C Feature FT:CDS DQ315782_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI0423). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ315783_SP_P-C Feature FT:CDS DQ315783_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI03188). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ361526_SP_P-C Feature FT:CDS DQ361526_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NK-586). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactggtgttgttagacaacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggcccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ361533_SP_P-C Feature FT:CDS DQ361533_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UDV-039). Partial genome (Contains: HBe, HBc, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ361534_SP_P-C Feature FT:CDS DQ361534_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CR-081). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ377160_SP_P-C Feature FT:CDS DQ377160_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT16). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgatgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ377161_SP_P-C Feature FT:CDS DQ377161_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ377162_SP_P-C Feature FT:CDS DQ377162_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggaaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ377163_SP_P-C Feature FT:CDS DQ377163_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ377164_SP_P-C Feature FT:CDS DQ377164_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgttcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagatccctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ377165_SP_P-C Feature FT:CDS DQ377165_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacccgcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtctctcc
tggctcagtttactag
>gnl|hbvcds|DQ478885_SP_P-C Feature FT:CDS DQ478885_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-D12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaacctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacttgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ478899_SP_P-C Feature FT:CDS DQ478899_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-D20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggcctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgttcctcc
tggctcagtttactag
>gnl|hbvcds|DQ478900_SP_P-C Feature FT:CDS DQ478900_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-H172). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgtagttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatttcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccgtcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ478901_SP_P-C Feature FT:CDS DQ478901_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-H155). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcaacttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ536410_SP_P-C Feature FT:CDS DQ536410_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ536411_SP_P-C Feature FT:CDS DQ536411_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ536412_SP_P-C Feature FT:CDS DQ536412_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ536413_SP_P-C Feature FT:CDS DQ536413_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ536414_SP_P-C Feature FT:CDS DQ536414_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ683578_SP_P-C Feature FT:CDS DQ683578_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ788835_SP_P-C Feature FT:CDS DQ788835_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaaactctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ922649_SP_P-C Feature FT:CDS DQ922649_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggaaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggccttagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ922650_SP_P-C Feature FT:CDS DQ922650_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgcttctcc
tggctcagtttactag
>gnl|hbvcds|DQ922651_SP_P-C Feature FT:CDS DQ922651_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcagtgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ975272_SP_P-C Feature FT:CDS DQ975272_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacttgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ975273_SP_P-C Feature FT:CDS DQ975273_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ975274_SP_P-C Feature FT:CDS DQ975274_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatcccaatctcgggaatctcaatgaacatcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ980547_SP_P-C Feature FT:CDS DQ980547_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggagcatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggccttagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ980549_SP_P-C Feature FT:CDS DQ980549_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttcccccttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggccttagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ980550_SP_P-C Feature FT:CDS DQ980550_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ980551_SP_P-C Feature FT:CDS DQ980551_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ986375_SP_P-C Feature FT:CDS DQ986375_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgctgaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaatctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ986376_SP_P-C Feature FT:CDS DQ986376_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtctccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ993181_SP_P-C Feature FT:CDS DQ993181_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactcctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gcaactgcacttgtattcccatcccatcatcctgggctttcgcaagcttcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ993690_SP_P-C Feature FT:CDS DQ993690_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 204-1113-Nature1.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagctg
gggtccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggccacagtccgtttctcc
tggttcagtttactag
>gnl|hbvcds|DQ993691_SP_P-C Feature FT:CDS DQ993691_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4007-0803-Nature2.2-unSero). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ993692_SP_P-C Feature FT:CDS DQ993692_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4007-0810-Nature2.1-unSero). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ993693_SP_P-C Feature FT:CDS DQ993693_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 232-1125-Nature1.1-unSero). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF137802_SP_P-C Feature FT:CDS EF137802_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgcggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccaccccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF137803_SP_P-C Feature FT:CDS EF137803_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgcagcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF197911_SP_P-C Feature FT:CDS EF197911_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcgactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtaccaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF494377_SP_P-C Feature FT:CDS EF494377_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TW1138). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF494379_SP_P-C Feature FT:CDS EF494379_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TW8585). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF536065_SP_P-C Feature FT:CDS EF536065_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|EF536066_SP_P-C Feature FT:CDS EF536066_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|EF688062_SP_P-C Feature FT:CDS EF688062_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GZ28-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU305540_SP_P-C Feature FT:CDS EU305540_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-123). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU305541_SP_P-C Feature FT:CDS EU305541_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-190). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccattatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU305542_SP_P-C Feature FT:CDS EU305542_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-1251). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtctgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306671_SP_P-C Feature FT:CDS EU306671_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306672_SP_P-C Feature FT:CDS EU306672_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaaaaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306673_SP_P-C Feature FT:CDS EU306673_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306674_SP_P-C Feature FT:CDS EU306674_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306675_SP_P-C Feature FT:CDS EU306675_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306685_SP_P-C Feature FT:CDS EU306685_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306687_SP_P-C Feature FT:CDS EU306687_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306688_SP_P-C Feature FT:CDS EU306688_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306689_SP_P-C Feature FT:CDS EU306689_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306690_SP_P-C Feature FT:CDS EU306690_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306691_SP_P-C Feature FT:CDS EU306691_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306694_SP_P-C Feature FT:CDS EU306694_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306713_SP_P-C Feature FT:CDS EU306713_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306714_SP_P-C Feature FT:CDS EU306714_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306719_SP_P-C Feature FT:CDS EU306719_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcagcacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306720_SP_P-C Feature FT:CDS EU306720_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306721_SP_P-C Feature FT:CDS EU306721_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggatcatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306722_SP_P-C Feature FT:CDS EU306722_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctattttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306724_SP_P-C Feature FT:CDS EU306724_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtaccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306725_SP_P-C Feature FT:CDS EU306725_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggggtctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306726_SP_P-C Feature FT:CDS EU306726_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306727_SP_P-C Feature FT:CDS EU306727_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggcccagtttactag
>gnl|hbvcds|EU306728_SP_P-C Feature FT:CDS EU306728_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU306729_SP_P-C Feature FT:CDS EU306729_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgatgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
cggctcagtttactag
>gnl|hbvcds|EU410079_SP_P-C Feature FT:CDS EU410079_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph109). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU410080_SP_P-C Feature FT:CDS EU410080_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph76). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU410081_SP_P-C Feature FT:CDS EU410081_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph80). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccacaacaagcac
gggaccatgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU439005_SP_P-C Feature FT:CDS EU439005_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU439008_SP_P-C Feature FT:CDS EU439008_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagcgggcctcagtccgcttctcc
tggctcagtttactag
>gnl|hbvcds|EU439009_SP_P-C Feature FT:CDS EU439009_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU439010_SP_P-C Feature FT:CDS EU439010_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaagctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactacacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU439011_SP_P-C Feature FT:CDS EU439011_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaagctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactacacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU439012_SP_P-C Feature FT:CDS EU439012_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgcttctcc
tggctcagtttactag
>gnl|hbvcds|EU439013_SP_P-C Feature FT:CDS EU439013_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactgg
>gnl|hbvcds|EU439014_SP_P-C Feature FT:CDS EU439014_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacggttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU439015_SP_P-C Feature FT:CDS EU439015_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU439016_SP_P-C Feature FT:CDS EU439016_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttattgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU439025_SP_P-C Feature FT:CDS EU439025_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaagctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU498227_SP_P-C Feature FT:CDS EU498227_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JL). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcag
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaactttcggacg
caaattgcacttgtattcccatcccaacatctggggctttcgcaaaattcctatgggggtcggcctcagtccgtttctcc
tggctcaattcactag
>gnl|hbvcds|EU522068_SP_P-C Feature FT:CDS EU522068_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 5N). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtatccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU522069_SP_P-C Feature FT:CDS EU522069_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 5T). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagaactgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU522071_SP_P-C Feature FT:CDS EU522071_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 7T). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU547559_SP_P-C Feature FT:CDS EU547559_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MC02). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
gggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gcaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU547562_SP_P-C Feature FT:CDS EU547562_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MC05). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagagcaagatgcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgaacatcaactaccagcac
gggcccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU554535_SP_P-C Feature FT:CDS EU554535_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S472-20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggagcctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU554536_SP_P-C Feature FT:CDS EU554536_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S472-24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgagcatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggccccagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU554537_SP_P-C Feature FT:CDS EU554537_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgccgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU554538_SP_P-C Feature FT:CDS EU554538_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU554539_SP_P-C Feature FT:CDS EU554539_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU554540_SP_P-C Feature FT:CDS EU554540_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S304-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgttcccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU554541_SP_P-C Feature FT:CDS EU554541_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S696-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaatacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggcccagtttactag
>gnl|hbvcds|EU554542_SP_P-C Feature FT:CDS EU554542_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S696-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU560438_SP_P-C Feature FT:CDS EU560438_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2-B74). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU560439_SP_P-C Feature FT:CDS EU560439_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7-B74). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcaccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaaccaccagtgc
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU560440_SP_P-C Feature FT:CDS EU560440_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1-S869). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggttcagtttactag
>gnl|hbvcds|EU560441_SP_P-C Feature FT:CDS EU560441_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4-S869). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU562215_SP_P-C Feature FT:CDS EU562215_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctacacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU562216_SP_P-C Feature FT:CDS EU562216_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 13). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU562217_SP_P-C Feature FT:CDS EU562217_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU562218_SP_P-C Feature FT:CDS EU562218_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU570067_SP_P-C Feature FT:CDS EU570067_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18-S541). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttattaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gagactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU570068_SP_P-C Feature FT:CDS EU570068_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26-S541). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU570072_SP_P-C Feature FT:CDS EU570072_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1-B74). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccattatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU570073_SP_P-C Feature FT:CDS EU570073_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8-S698). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggactctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaaactctacgtttccctcttgttgctgtataaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggaatgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU570074_SP_P-C Feature FT:CDS EU570074_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 11-S698). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggactctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaaactctacgtttccctcttgttgctgtataaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggaatgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU579442_SP_P-C Feature FT:CDS EU579442_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggttcagtttactag
>gnl|hbvcds|EU579443_SP_P-C Feature FT:CDS EU579443_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU589336_SP_P-C Feature FT:CDS EU589336_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1175-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU589340_SP_P-C Feature FT:CDS EU589340_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S852-7). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagttcactag
>gnl|hbvcds|EU589341_SP_P-C Feature FT:CDS EU589341_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S852-10). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagttcactag
>gnl|hbvcds|EU589342_SP_P-C Feature FT:CDS EU589342_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S852-13). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgattccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagttcactag
>gnl|hbvcds|EU589344_SP_P-C Feature FT:CDS EU589344_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S624-1). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacagcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tgtctcagtttactag
>gnl|hbvcds|EU589345_SP_P-C Feature FT:CDS EU589345_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S624-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|EU670263_SP_P-C Feature FT:CDS EU670263_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph105). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU717212_SP_P-C Feature FT:CDS EU717212_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D26K-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU717214_SP_P-C Feature FT:CDS EU717214_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G62K-8). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgagggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgaacatcaactaccagcac
gggtccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU717215_SP_P-C Feature FT:CDS EU717215_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Q67K-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgccaacggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgtacttgcattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU717217_SP_P-C Feature FT:CDS EU717217_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Q53K-4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaagggaactctacggttccctcttgttgctgtacaaaaccttcggaca
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU717218_SP_P-C Feature FT:CDS EU717218_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 107-3/C8). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagatgaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU796069_SP_P-C Feature FT:CDS EU796069_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacctcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagcttcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU796070_SP_P-C Feature FT:CDS EU796070_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacggcgaggcagatcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU796072_SP_P-C Feature FT:CDS EU796072_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacggcgaggcagatcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871969_SP_P-C Feature FT:CDS EU871969_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871970_SP_P-C Feature FT:CDS EU871970_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871971_SP_P-C Feature FT:CDS EU871971_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871972_SP_P-C Feature FT:CDS EU871972_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871973_SP_P-C Feature FT:CDS EU871973_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-99-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871974_SP_P-C Feature FT:CDS EU871974_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024A-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcagtgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871975_SP_P-C Feature FT:CDS EU871975_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024A-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871976_SP_P-C Feature FT:CDS EU871976_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 179-04-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatctttggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871977_SP_P-C Feature FT:CDS EU871977_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871978_SP_P-C Feature FT:CDS EU871978_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-95-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagccgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871979_SP_P-C Feature FT:CDS EU871979_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-95-4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871980_SP_P-C Feature FT:CDS EU871980_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-01-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871982_SP_P-C Feature FT:CDS EU871982_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-96-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU871998_SP_P-C Feature FT:CDS EU871998_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-00-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU872000_SP_P-C Feature FT:CDS EU872000_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-92-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU872001_SP_P-C Feature FT:CDS EU872001_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-92-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU872002_SP_P-C Feature FT:CDS EU872002_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-97-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU872003_SP_P-C Feature FT:CDS EU872003_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-97-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU872004_SP_P-C Feature FT:CDS EU872004_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-97-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU872005_SP_P-C Feature FT:CDS EU872005_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 179-96-1). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgaacatcaactaccagcac
gggtccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU872008_SP_P-C Feature FT:CDS EU872008_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252A-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaaattcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU872010_SP_P-C Feature FT:CDS EU872010_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-92-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU872012_SP_P-C Feature FT:CDS EU872012_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-99-5). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacactttcggaaactactgttgttggacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU872013_SP_P-C Feature FT:CDS EU872013_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-99-6). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU881996_SP_P-C Feature FT:CDS EU881996_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggacatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU881999_SP_P-C Feature FT:CDS EU881999_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient19). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=333 residues).
cccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcct
cgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcacggg
accatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaa
actgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctgg
ctcagtttactag
>gnl|hbvcds|EU882000_SP_P-C Feature FT:CDS EU882000_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient19). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=333 residues).
cccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcct
cgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcacggg
accatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaa
actgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctgg
ctcagtttactag
>gnl|hbvcds|EU882005_SP_P-C Feature FT:CDS EU882005_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient22). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916204_SP_P-C Feature FT:CDS EU916204_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1.1). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916210_SP_P-C Feature FT:CDS EU916210_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S2.4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggccttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916211_SP_P-C Feature FT:CDS EU916211_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3.1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgcacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916212_SP_P-C Feature FT:CDS EU916212_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3.2). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactgccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916213_SP_P-C Feature FT:CDS EU916213_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3.3). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916214_SP_P-C Feature FT:CDS EU916214_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3.4). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916215_SP_P-C Feature FT:CDS EU916215_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S4.1). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccgggaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtatccccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916216_SP_P-C Feature FT:CDS EU916216_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S4.2). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916217_SP_P-C Feature FT:CDS EU916217_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S4.3). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916218_SP_P-C Feature FT:CDS EU916218_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S4.4). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916219_SP_P-C Feature FT:CDS EU916219_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S5.1). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagatctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916222_SP_P-C Feature FT:CDS EU916222_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S5.4). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
ccttgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtatccccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916223_SP_P-C Feature FT:CDS EU916223_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S6.1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggactgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916224_SP_P-C Feature FT:CDS EU916224_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S6.2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggactgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916225_SP_P-C Feature FT:CDS EU916225_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S6.3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagcgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916226_SP_P-C Feature FT:CDS EU916226_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S7.1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916227_SP_P-C Feature FT:CDS EU916227_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S7.2). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacggcgaggcaggtcccctagaagaagaactcccccg
cctcgcagacgatggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916229_SP_P-C Feature FT:CDS EU916229_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S7.4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916233_SP_P-C Feature FT:CDS EU916233_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT1.1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagacctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916234_SP_P-C Feature FT:CDS EU916234_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT1.2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccacgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916237_SP_P-C Feature FT:CDS EU916237_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT2.2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatcccaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU916238_SP_P-C Feature FT:CDS EU916238_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT2.3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU919164_SP_P-C Feature FT:CDS EU919164_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient24). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgcagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU919165_SP_P-C Feature FT:CDS EU919165_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient24). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgcaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgcacaagggacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU919168_SP_P-C Feature FT:CDS EU919168_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU919169_SP_P-C Feature FT:CDS EU919169_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacagcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939536_SP_P-C Feature FT:CDS EU939536_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcgactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939537_SP_P-C Feature FT:CDS EU939537_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C8). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939538_SP_P-C Feature FT:CDS EU939538_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939539_SP_P-C Feature FT:CDS EU939539_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939540_SP_P-C Feature FT:CDS EU939540_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttgtcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939541_SP_P-C Feature FT:CDS EU939541_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacaaggcaggtcccctaaaaaaaaaactccctcg
cctcgcaaacaaaggtctcaatcgccgcgtcgcaaaaaatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939542_SP_P-C Feature FT:CDS EU939542_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggcccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939543_SP_P-C Feature FT:CDS EU939543_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacatgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939544_SP_P-C Feature FT:CDS EU939544_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C39). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939545_SP_P-C Feature FT:CDS EU939545_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939546_SP_P-C Feature FT:CDS EU939546_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939548_SP_P-C Feature FT:CDS EU939548_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C46). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939549_SP_P-C Feature FT:CDS EU939549_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C49). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939550_SP_P-C Feature FT:CDS EU939550_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C55). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939552_SP_P-C Feature FT:CDS EU939552_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C57). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttaaacaaccaggcaggtcccctagaaaaagaactccctcg
cctcgcaaacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgaacatcaaccaccagtac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939553_SP_P-C Feature FT:CDS EU939553_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C60). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tgrctcagtttactag
>gnl|hbvcds|EU939554_SP_P-C Feature FT:CDS EU939554_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C61). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939555_SP_P-C Feature FT:CDS EU939555_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C63). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939556_SP_P-C Feature FT:CDS EU939556_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C64). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacgtcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatctttggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939557_SP_P-C Feature FT:CDS EU939557_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C65). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939558_SP_P-C Feature FT:CDS EU939558_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C66). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgaacatcaacgaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939560_SP_P-C Feature FT:CDS EU939560_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C69). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939561_SP_P-C Feature FT:CDS EU939561_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C70). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939562_SP_P-C Feature FT:CDS EU939562_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C75). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939563_SP_P-C Feature FT:CDS EU939563_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939564_SP_P-C Feature FT:CDS EU939564_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C77). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|EU939566_SP_P-C Feature FT:CDS EU939566_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C88). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939567_SP_P-C Feature FT:CDS EU939567_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C91). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939568_SP_P-C Feature FT:CDS EU939568_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C93). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939569_SP_P-C Feature FT:CDS EU939569_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C102). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcgtgatgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939570_SP_P-C Feature FT:CDS EU939570_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C103). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939571_SP_P-C Feature FT:CDS EU939571_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C104). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939572_SP_P-C Feature FT:CDS EU939572_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C105). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939573_SP_P-C Feature FT:CDS EU939573_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C106). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcttgctgttgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939574_SP_P-C Feature FT:CDS EU939574_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C109). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939576_SP_P-C Feature FT:CDS EU939576_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C115). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939578_SP_P-C Feature FT:CDS EU939578_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C119). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacttgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939579_SP_P-C Feature FT:CDS EU939579_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C120). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcgaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939580_SP_P-C Feature FT:CDS EU939580_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939582_SP_P-C Feature FT:CDS EU939582_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939583_SP_P-C Feature FT:CDS EU939583_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B31). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagatgtcgaggcaggtccgctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcagtgaacgtcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939584_SP_P-C Feature FT:CDS EU939584_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B107). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccacaaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939585_SP_P-C Feature FT:CDS EU939585_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B126). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939586_SP_P-C Feature FT:CDS EU939586_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B142). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcacagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939587_SP_P-C Feature FT:CDS EU939587_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939588_SP_P-C Feature FT:CDS EU939588_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C173). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|EU939590_SP_P-C Feature FT:CDS EU939590_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C127). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939591_SP_P-C Feature FT:CDS EU939591_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C131). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939592_SP_P-C Feature FT:CDS EU939592_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C141). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939593_SP_P-C Feature FT:CDS EU939593_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C144). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939594_SP_P-C Feature FT:CDS EU939594_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C146). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939595_SP_P-C Feature FT:CDS EU939595_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C147). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939596_SP_P-C Feature FT:CDS EU939596_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C149). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939597_SP_P-C Feature FT:CDS EU939597_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C151). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939599_SP_P-C Feature FT:CDS EU939599_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C172). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcatacgaaggtctcaatcgccgcgtcgcacaagatctcaatctcgggaatccaaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939600_SP_P-C Feature FT:CDS EU939600_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C176). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939601_SP_P-C Feature FT:CDS EU939601_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C177). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939603_SP_P-C Feature FT:CDS EU939603_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C183). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtccattagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
saaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939604_SP_P-C Feature FT:CDS EU939604_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C192). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939605_SP_P-C Feature FT:CDS EU939605_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C200). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939607_SP_P-C Feature FT:CDS EU939607_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C207). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939609_SP_P-C Feature FT:CDS EU939609_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C209). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939610_SP_P-C Feature FT:CDS EU939610_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C211). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939611_SP_P-C Feature FT:CDS EU939611_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C212). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939612_SP_P-C Feature FT:CDS EU939612_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C213). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939613_SP_P-C Feature FT:CDS EU939613_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C214). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939614_SP_P-C Feature FT:CDS EU939614_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C217). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939615_SP_P-C Feature FT:CDS EU939615_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C226). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaaytcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939616_SP_P-C Feature FT:CDS EU939616_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C228). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacctcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939617_SP_P-C Feature FT:CDS EU939617_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C229). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaatgtactgttattagacaacgaggcaggccccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939618_SP_P-C Feature FT:CDS EU939618_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C230). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939619_SP_P-C Feature FT:CDS EU939619_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C233). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgcacaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939625_SP_P-C Feature FT:CDS EU939625_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C167). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacatcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939626_SP_P-C Feature FT:CDS EU939626_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D158). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939640_SP_P-C Feature FT:CDS EU939640_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C239). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939641_SP_P-C Feature FT:CDS EU939641_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D18). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcgtcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939642_SP_P-C Feature FT:CDS EU939642_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D20). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939643_SP_P-C Feature FT:CDS EU939643_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D32). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccttgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tcactcagtttactag
>gnl|hbvcds|EU939644_SP_P-C Feature FT:CDS EU939644_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcaccaatcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939645_SP_P-C Feature FT:CDS EU939645_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D38). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacaatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939646_SP_P-C Feature FT:CDS EU939646_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D88). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaagaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939647_SP_P-C Feature FT:CDS EU939647_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D90). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939648_SP_P-C Feature FT:CDS EU939648_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D96). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939649_SP_P-C Feature FT:CDS EU939649_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D98). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939651_SP_P-C Feature FT:CDS EU939651_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D104). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaagggacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939652_SP_P-C Feature FT:CDS EU939652_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D107). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939653_SP_P-C Feature FT:CDS EU939653_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D109). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|EU939654_SP_P-C Feature FT:CDS EU939654_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D115). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939655_SP_P-C Feature FT:CDS EU939655_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D116). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagttggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939656_SP_P-C Feature FT:CDS EU939656_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D117). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagttggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939657_SP_P-C Feature FT:CDS EU939657_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D139). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaaactctacttttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939658_SP_P-C Feature FT:CDS EU939658_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D142). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaccaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttcactcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939659_SP_P-C Feature FT:CDS EU939659_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D165). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023639_SP_P-C Feature FT:CDS FJ023639_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-0968). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023640_SP_P-C Feature FT:CDS FJ023640_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1206). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ023641_SP_P-C Feature FT:CDS FJ023641_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1237). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023642_SP_P-C Feature FT:CDS FJ023642_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1257). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023643_SP_P-C Feature FT:CDS FJ023643_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1306). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023644_SP_P-C Feature FT:CDS FJ023644_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1318). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023645_SP_P-C Feature FT:CDS FJ023645_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0071). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023646_SP_P-C Feature FT:CDS FJ023646_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0201). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtaccaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023647_SP_P-C Feature FT:CDS FJ023647_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0214). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023648_SP_P-C Feature FT:CDS FJ023648_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0273). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacyaccagcac
gggaccatgcaagacctgcacgastcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023649_SP_P-C Feature FT:CDS FJ023649_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0289). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ023650_SP_P-C Feature FT:CDS FJ023650_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0341). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023651_SP_P-C Feature FT:CDS FJ023651_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0391). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023652_SP_P-C Feature FT:CDS FJ023652_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0648). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccacgaggcaggtccactagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023653_SP_P-C Feature FT:CDS FJ023653_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0909). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023654_SP_P-C Feature FT:CDS FJ023654_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1412). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023655_SP_P-C Feature FT:CDS FJ023655_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0754). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023656_SP_P-C Feature FT:CDS FJ023656_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0938). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023657_SP_P-C Feature FT:CDS FJ023657_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0987). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ023658_SP_P-C Feature FT:CDS FJ023658_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-1116). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ032331_SP_P-C Feature FT:CDS FJ032331_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S193-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ032332_SP_P-C Feature FT:CDS FJ032332_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S265-10). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ032333_SP_P-C Feature FT:CDS FJ032333_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S359-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggttcagtttactag
>gnl|hbvcds|FJ032334_SP_P-C Feature FT:CDS FJ032334_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S445-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ032336_SP_P-C Feature FT:CDS FJ032336_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S462-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagaccagcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgcttctcc
tggctcagtttactag
>gnl|hbvcds|FJ032338_SP_P-C Feature FT:CDS FJ032338_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S462-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ032339_SP_P-C Feature FT:CDS FJ032339_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S462-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ032340_SP_P-C Feature FT:CDS FJ032340_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S529-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
ggaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggttcagtttactag
>gnl|hbvcds|FJ032341_SP_P-C Feature FT:CDS FJ032341_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S529-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggttcagtttactag
>gnl|hbvcds|FJ032345_SP_P-C Feature FT:CDS FJ032345_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S696-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ032346_SP_P-C Feature FT:CDS FJ032346_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S732-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtataaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ032347_SP_P-C Feature FT:CDS FJ032347_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S732-7). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ032350_SP_P-C Feature FT:CDS FJ032350_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S943-1). Complete genome. [Hepadnaviridae] (length=336 residues).
acgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatacaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ032351_SP_P-C Feature FT:CDS FJ032351_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S943-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggcttccgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ032355_SP_P-C Feature FT:CDS FJ032355_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1030-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcactattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggactgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ032356_SP_P-C Feature FT:CDS FJ032356_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1030-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcactattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggactgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ032359_SP_P-C Feature FT:CDS FJ032359_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1634-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ032360_SP_P-C Feature FT:CDS FJ032360_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1634-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgagctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ032361_SP_P-C Feature FT:CDS FJ032361_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1634-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagcttcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ151413_SP_P-C Feature FT:CDS FJ151413_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgagcatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ151414_SP_P-C Feature FT:CDS FJ151414_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacactttccggaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaaactctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349225_SP_P-C Feature FT:CDS FJ349225_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H94). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386574_SP_P-C Feature FT:CDS FJ386574_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1743). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386575_SP_P-C Feature FT:CDS FJ386575_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1745). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386576_SP_P-C Feature FT:CDS FJ386576_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1746). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386577_SP_P-C Feature FT:CDS FJ386577_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1747). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386579_SP_P-C Feature FT:CDS FJ386579_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1762). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggactgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ386587_SP_P-C Feature FT:CDS FJ386587_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1812). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386588_SP_P-C Feature FT:CDS FJ386588_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1828). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386589_SP_P-C Feature FT:CDS FJ386589_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1830). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386591_SP_P-C Feature FT:CDS FJ386591_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1869). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaggcctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386592_SP_P-C Feature FT:CDS FJ386592_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1870). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386594_SP_P-C Feature FT:CDS FJ386594_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1878). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386595_SP_P-C Feature FT:CDS FJ386595_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1879). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386596_SP_P-C Feature FT:CDS FJ386596_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1887). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386597_SP_P-C Feature FT:CDS FJ386597_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1888). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386598_SP_P-C Feature FT:CDS FJ386598_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1889). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386601_SP_P-C Feature FT:CDS FJ386601_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1912). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaggacctgcacgattactgctcaaggaacctctatgtttccctcttgttgctgtaccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386602_SP_P-C Feature FT:CDS FJ386602_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1914). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386603_SP_P-C Feature FT:CDS FJ386603_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1949). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386604_SP_P-C Feature FT:CDS FJ386604_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1950). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacatgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatctttggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggttcagtttactag
>gnl|hbvcds|FJ386605_SP_P-C Feature FT:CDS FJ386605_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1965). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386607_SP_P-C Feature FT:CDS FJ386607_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1967). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386609_SP_P-C Feature FT:CDS FJ386609_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1999). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386611_SP_P-C Feature FT:CDS FJ386611_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2018). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386612_SP_P-C Feature FT:CDS FJ386612_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2019). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386613_SP_P-C Feature FT:CDS FJ386613_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2039). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386614_SP_P-C Feature FT:CDS FJ386614_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2040). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccttaatgaacatcaacgaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386616_SP_P-C Feature FT:CDS FJ386616_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2064). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386617_SP_P-C Feature FT:CDS FJ386617_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2093). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggttcagtttactag
>gnl|hbvcds|FJ386618_SP_P-C Feature FT:CDS FJ386618_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2111). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386619_SP_P-C Feature FT:CDS FJ386619_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2119). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386620_SP_P-C Feature FT:CDS FJ386620_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2121). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagtac
gggaccctgcaagacctgcacggttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ386621_SP_P-C Feature FT:CDS FJ386621_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2123). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ386623_SP_P-C Feature FT:CDS FJ386623_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2165). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ386624_SP_P-C Feature FT:CDS FJ386624_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2187). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacttgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386625_SP_P-C Feature FT:CDS FJ386625_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2190). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386626_SP_P-C Feature FT:CDS FJ386626_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2205). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacaatgcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386627_SP_P-C Feature FT:CDS FJ386627_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2242). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386628_SP_P-C Feature FT:CDS FJ386628_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2255). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ386629_SP_P-C Feature FT:CDS FJ386629_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2286). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ386630_SP_P-C Feature FT:CDS FJ386630_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2336). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggagcctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386631_SP_P-C Feature FT:CDS FJ386631_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2359). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386632_SP_P-C Feature FT:CDS FJ386632_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2370). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386637_SP_P-C Feature FT:CDS FJ386637_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2151). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386638_SP_P-C Feature FT:CDS FJ386638_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2015). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaatctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccgatgggagtgggcctcagtccgtttctcc
tgactcagtttactag
>gnl|hbvcds|FJ386639_SP_P-C Feature FT:CDS FJ386639_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1929). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386640_SP_P-C Feature FT:CDS FJ386640_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2168). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaattgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggttcagtttactag
>gnl|hbvcds|FJ386641_SP_P-C Feature FT:CDS FJ386641_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2236). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386644_SP_P-C Feature FT:CDS FJ386644_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S737). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386645_SP_P-C Feature FT:CDS FJ386645_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S897). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386647_SP_P-C Feature FT:CDS FJ386647_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2400). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccaatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386650_SP_P-C Feature FT:CDS FJ386650_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2468). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tgactcagtttactag
>gnl|hbvcds|FJ386651_SP_P-C Feature FT:CDS FJ386651_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2476). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386652_SP_P-C Feature FT:CDS FJ386652_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2518). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386653_SP_P-C Feature FT:CDS FJ386653_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ386657_SP_P-C Feature FT:CDS FJ386657_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S165). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386659_SP_P-C Feature FT:CDS FJ386659_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S219). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386661_SP_P-C Feature FT:CDS FJ386661_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S251). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgaacatcaactacaaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386662_SP_P-C Feature FT:CDS FJ386662_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S269). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386663_SP_P-C Feature FT:CDS FJ386663_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S307). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386664_SP_P-C Feature FT:CDS FJ386664_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S310). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386665_SP_P-C Feature FT:CDS FJ386665_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S359). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggttcagtttactag
>gnl|hbvcds|FJ386667_SP_P-C Feature FT:CDS FJ386667_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S379). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggttccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386670_SP_P-C Feature FT:CDS FJ386670_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S454). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386671_SP_P-C Feature FT:CDS FJ386671_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S586). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386672_SP_P-C Feature FT:CDS FJ386672_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S606). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386673_SP_P-C Feature FT:CDS FJ386673_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S633). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcgactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagttcactag
>gnl|hbvcds|FJ386677_SP_P-C Feature FT:CDS FJ386677_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1104). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gcaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386678_SP_P-C Feature FT:CDS FJ386678_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1147). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386679_SP_P-C Feature FT:CDS FJ386679_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1217). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386685_SP_P-C Feature FT:CDS FJ386685_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1568). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386687_SP_P-C Feature FT:CDS FJ386687_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1600). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386689_SP_P-C Feature FT:CDS FJ386689_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1649). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccctgcaagacctgcacgaatcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ518810_SP_P-C Feature FT:CDS FJ518810_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggccccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tgactcagtttactag
>gnl|hbvcds|FJ518813_SP_P-C Feature FT:CDS FJ518813_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562218_SP_P-C Feature FT:CDS FJ562218_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562220_SP_P-C Feature FT:CDS FJ562220_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I12). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562221_SP_P-C Feature FT:CDS FJ562221_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562225_SP_P-C Feature FT:CDS FJ562225_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562228_SP_P-C Feature FT:CDS FJ562228_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562230_SP_P-C Feature FT:CDS FJ562230_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562232_SP_P-C Feature FT:CDS FJ562232_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I45). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562233_SP_P-C Feature FT:CDS FJ562233_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I48). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaagccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562235_SP_P-C Feature FT:CDS FJ562235_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I50). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562238_SP_P-C Feature FT:CDS FJ562238_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I62). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
tggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562239_SP_P-C Feature FT:CDS FJ562239_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I64). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562241_SP_P-C Feature FT:CDS FJ562241_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I67). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562242_SP_P-C Feature FT:CDS FJ562242_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I68). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562243_SP_P-C Feature FT:CDS FJ562243_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I71). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562244_SP_P-C Feature FT:CDS FJ562244_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I72). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggttcagtttactag
>gnl|hbvcds|FJ562245_SP_P-C Feature FT:CDS FJ562245_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I73). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaacatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttactgctgtacaaaactttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562248_SP_P-C Feature FT:CDS FJ562248_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I76). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562249_SP_P-C Feature FT:CDS FJ562249_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I79). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562250_SP_P-C Feature FT:CDS FJ562250_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I83). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562251_SP_P-C Feature FT:CDS FJ562251_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I84). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562252_SP_P-C Feature FT:CDS FJ562252_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I85). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562255_SP_P-C Feature FT:CDS FJ562255_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I92). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562256_SP_P-C Feature FT:CDS FJ562256_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I95). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacatgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562258_SP_P-C Feature FT:CDS FJ562258_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I97). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562261_SP_P-C Feature FT:CDS FJ562261_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I109). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcacctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562264_SP_P-C Feature FT:CDS FJ562264_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I114). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562265_SP_P-C Feature FT:CDS FJ562265_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I116). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcgtgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562266_SP_P-C Feature FT:CDS FJ562266_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I118). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccaccac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562268_SP_P-C Feature FT:CDS FJ562268_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I121). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562269_SP_P-C Feature FT:CDS FJ562269_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I122). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562270_SP_P-C Feature FT:CDS FJ562270_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I123). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcat
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562272_SP_P-C Feature FT:CDS FJ562272_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I125). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562273_SP_P-C Feature FT:CDS FJ562273_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I127). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562274_SP_P-C Feature FT:CDS FJ562274_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I128). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562275_SP_P-C Feature FT:CDS FJ562275_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I129). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562276_SP_P-C Feature FT:CDS FJ562276_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I130). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagttcactag
>gnl|hbvcds|FJ562279_SP_P-C Feature FT:CDS FJ562279_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I140). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ562280_SP_P-C Feature FT:CDS FJ562280_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I141). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccttgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562281_SP_P-C Feature FT:CDS FJ562281_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I143). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562282_SP_P-C Feature FT:CDS FJ562282_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I144). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562283_SP_P-C Feature FT:CDS FJ562283_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I145). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562284_SP_P-C Feature FT:CDS FJ562284_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I146). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562285_SP_P-C Feature FT:CDS FJ562285_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I147). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562286_SP_P-C Feature FT:CDS FJ562286_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I149). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
gttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacg
cagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggggtactttaccgcaagaa
catattgtactaaaactcaagcaatgttttcgaaaactgcctgtaaatagacctattgattggaaagtgtgtcaaagaat
tgtgggtcttttgggctttgctgccccttttacacaatgtggctatcctgccttaatgcctttatatgcatgtatacaat
ctaagcaggctttcac
>gnl|hbvcds|FJ562288_SP_P-C Feature FT:CDS FJ562288_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I153). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562290_SP_P-C Feature FT:CDS FJ562290_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I162). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562291_SP_P-C Feature FT:CDS FJ562291_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I163). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562292_SP_P-C Feature FT:CDS FJ562292_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I164). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaaccac
gggaccatgcaagacctgcacgattcctgttcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562293_SP_P-C Feature FT:CDS FJ562293_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I167). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562295_SP_P-C Feature FT:CDS FJ562295_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I169). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562297_SP_P-C Feature FT:CDS FJ562297_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I172). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562298_SP_P-C Feature FT:CDS FJ562298_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I174). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagatacctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562299_SP_P-C Feature FT:CDS FJ562299_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I175). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562300_SP_P-C Feature FT:CDS FJ562300_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I182). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacttcaactaccagcac
gggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562301_SP_P-C Feature FT:CDS FJ562301_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I185). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562304_SP_P-C Feature FT:CDS FJ562304_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I190). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacggcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562306_SP_P-C Feature FT:CDS FJ562306_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I196). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaagacatgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562307_SP_P-C Feature FT:CDS FJ562307_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I197). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562308_SP_P-C Feature FT:CDS FJ562308_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I199). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562310_SP_P-C Feature FT:CDS FJ562310_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I201). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgcccaggcaggtccactagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtggggctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562313_SP_P-C Feature FT:CDS FJ562313_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I204). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562315_SP_P-C Feature FT:CDS FJ562315_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I207). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgctgaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562318_SP_P-C Feature FT:CDS FJ562318_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I211). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562319_SP_P-C Feature FT:CDS FJ562319_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I212). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562320_SP_P-C Feature FT:CDS FJ562320_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I213). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ562323_SP_P-C Feature FT:CDS FJ562323_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I217). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562324_SP_P-C Feature FT:CDS FJ562324_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I219). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562325_SP_P-C Feature FT:CDS FJ562325_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I223). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562326_SP_P-C Feature FT:CDS FJ562326_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I227). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctca
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgaacatcaaccaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562327_SP_P-C Feature FT:CDS FJ562327_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I228). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562329_SP_P-C Feature FT:CDS FJ562329_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I230). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562330_SP_P-C Feature FT:CDS FJ562330_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I231). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562331_SP_P-C Feature FT:CDS FJ562331_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I9). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562332_SP_P-C Feature FT:CDS FJ562332_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I42). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562333_SP_P-C Feature FT:CDS FJ562333_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I78). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562334_SP_P-C Feature FT:CDS FJ562334_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I82). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaggacctgcacgaatactgctcaaggaaactctatgtttccctcttgttgctgtaccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562335_SP_P-C Feature FT:CDS FJ562335_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I108). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562337_SP_P-C Feature FT:CDS FJ562337_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I173). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562339_SP_P-C Feature FT:CDS FJ562339_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I205). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccaatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562340_SP_P-C Feature FT:CDS FJ562340_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I220). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaaacacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715341_SP_P-C Feature FT:CDS FJ715341_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC11). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715342_SP_P-C Feature FT:CDS FJ715342_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaatgtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715343_SP_P-C Feature FT:CDS FJ715343_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC13). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccttttcttatcaacactcgcggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
ggaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715344_SP_P-C Feature FT:CDS FJ715344_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC14). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcatgtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715350_SP_P-C Feature FT:CDS FJ715350_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC33). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715351_SP_P-C Feature FT:CDS FJ715351_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC41). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715352_SP_P-C Feature FT:CDS FJ715352_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC42). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715353_SP_P-C Feature FT:CDS FJ715353_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC43). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715355_SP_P-C Feature FT:CDS FJ715355_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC52). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715357_SP_P-C Feature FT:CDS FJ715357_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC54). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715358_SP_P-C Feature FT:CDS FJ715358_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC55). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715359_SP_P-C Feature FT:CDS FJ715359_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC61). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaagttgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715360_SP_P-C Feature FT:CDS FJ715360_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC62). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715364_SP_P-C Feature FT:CDS FJ715364_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC72). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcccgaaactactgttgttagacgacgaggcagttcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccctctcgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715365_SP_P-C Feature FT:CDS FJ715365_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC73). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715366_SP_P-C Feature FT:CDS FJ715366_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC74). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagcttactag
>gnl|hbvcds|FJ715367_SP_P-C Feature FT:CDS FJ715367_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC75). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715368_SP_P-C Feature FT:CDS FJ715368_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC81). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715370_SP_P-C Feature FT:CDS FJ715370_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC83). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715371_SP_P-C Feature FT:CDS FJ715371_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715372_SP_P-C Feature FT:CDS FJ715372_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaacctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715374_SP_P-C Feature FT:CDS FJ715374_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM21). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgcccaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715375_SP_P-C Feature FT:CDS FJ715375_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM22). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715376_SP_P-C Feature FT:CDS FJ715376_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM23). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715377_SP_P-C Feature FT:CDS FJ715377_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM31). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715378_SP_P-C Feature FT:CDS FJ715378_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM32). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715379_SP_P-C Feature FT:CDS FJ715379_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM33). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
aaaactgcacttgtattcccatcccatcatcctggactatcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715380_SP_P-C Feature FT:CDS FJ715380_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM34). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715381_SP_P-C Feature FT:CDS FJ715381_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM41). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715382_SP_P-C Feature FT:CDS FJ715382_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM42). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715383_SP_P-C Feature FT:CDS FJ715383_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM43). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcggacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715389_SP_P-C Feature FT:CDS FJ715389_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM62). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcatatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715390_SP_P-C Feature FT:CDS FJ715390_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM63). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715391_SP_P-C Feature FT:CDS FJ715391_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM64). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcgggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtcccaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715392_SP_P-C Feature FT:CDS FJ715392_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM71). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715395_SP_P-C Feature FT:CDS FJ715395_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM81). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715397_SP_P-C Feature FT:CDS FJ715397_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM83). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715398_SP_P-C Feature FT:CDS FJ715398_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715400_SP_P-C Feature FT:CDS FJ715400_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN13). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715402_SP_P-C Feature FT:CDS FJ715402_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN22). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaaccgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715403_SP_P-C Feature FT:CDS FJ715403_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN23). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcggacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715404_SP_P-C Feature FT:CDS FJ715404_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN31). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgctgcgtcgcagaagatctcaatctcgggaatctcaatgaacaccaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcagacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715405_SP_P-C Feature FT:CDS FJ715405_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN32). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggagtctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715406_SP_P-C Feature FT:CDS FJ715406_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN33). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggagtctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715407_SP_P-C Feature FT:CDS FJ715407_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN41). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715409_SP_P-C Feature FT:CDS FJ715409_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN43). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715415_SP_P-C Feature FT:CDS FJ715415_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN61). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccacgcaagacctgcacgagtcctgctcaaggaacctctatgcttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715416_SP_P-C Feature FT:CDS FJ715416_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN62). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgcttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715418_SP_P-C Feature FT:CDS FJ715418_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN64). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccatttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715421_SP_P-C Feature FT:CDS FJ715421_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN71). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715422_SP_P-C Feature FT:CDS FJ715422_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN72). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttatacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggccttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ715424_SP_P-C Feature FT:CDS FJ715424_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVN74). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcggaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ751770_SP_P-C Feature FT:CDS FJ751770_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787437_SP_P-C Feature FT:CDS FJ787437_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S129-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcagtcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacatgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatctttggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggttcagtttactag
>gnl|hbvcds|FJ787439_SP_P-C Feature FT:CDS FJ787439_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S157-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggttcagtttactag
>gnl|hbvcds|FJ787441_SP_P-C Feature FT:CDS FJ787441_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S157-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
ttactcagtttactag
>gnl|hbvcds|FJ787442_SP_P-C Feature FT:CDS FJ787442_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S171-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|FJ787443_SP_P-C Feature FT:CDS FJ787443_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S171-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|FJ787445_SP_P-C Feature FT:CDS FJ787445_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S425-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ787447_SP_P-C Feature FT:CDS FJ787447_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S461-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgcggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ787448_SP_P-C Feature FT:CDS FJ787448_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S461-3). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttaccaacacttccggaaactactgttgttagacgacgcggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgccgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcattctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ787449_SP_P-C Feature FT:CDS FJ787449_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S567-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787450_SP_P-C Feature FT:CDS FJ787450_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S627-2). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=330 residues).
ctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgc
agacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcacggggcc
atgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaact
gcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctc
agtttactag
>gnl|hbvcds|FJ787451_SP_P-C Feature FT:CDS FJ787451_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S627-3). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tgactcagtttactag
>gnl|hbvcds|FJ787452_SP_P-C Feature FT:CDS FJ787452_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S955-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgaacctcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787453_SP_P-C Feature FT:CDS FJ787453_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1049-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggtttgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787454_SP_P-C Feature FT:CDS FJ787454_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1049-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggtttgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787455_SP_P-C Feature FT:CDS FJ787455_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1092-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcggaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ787456_SP_P-C Feature FT:CDS FJ787456_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1092-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ787457_SP_P-C Feature FT:CDS FJ787457_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1248-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatttcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787458_SP_P-C Feature FT:CDS FJ787458_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1248-9). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787459_SP_P-C Feature FT:CDS FJ787459_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1348-1). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaag
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tgactcagtttactag
>gnl|hbvcds|FJ787461_SP_P-C Feature FT:CDS FJ787461_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1357-2). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgagtgctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tgactcagtttactag
>gnl|hbvcds|FJ787462_SP_P-C Feature FT:CDS FJ787462_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1357-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaagggacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccaccccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tcactcagtttactag
>gnl|hbvcds|FJ787463_SP_P-C Feature FT:CDS FJ787463_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1357-6). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tcactcagtttactag
>gnl|hbvcds|FJ787464_SP_P-C Feature FT:CDS FJ787464_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ787465_SP_P-C Feature FT:CDS FJ787465_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-5). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ787466_SP_P-C Feature FT:CDS FJ787466_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggagcctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ787467_SP_P-C Feature FT:CDS FJ787467_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaataccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ787468_SP_P-C Feature FT:CDS FJ787468_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1426-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787469_SP_P-C Feature FT:CDS FJ787469_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1426-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactcccttg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787470_SP_P-C Feature FT:CDS FJ787470_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1538-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacatcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctca
tggctcagattactag
>gnl|hbvcds|FJ787471_SP_P-C Feature FT:CDS FJ787471_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1538-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacatcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ787474_SP_P-C Feature FT:CDS FJ787474_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1732-6). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcccgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tgactcagtttactag
>gnl|hbvcds|FJ787479_SP_P-C Feature FT:CDS FJ787479_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S157-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggttcagtttactag
>gnl|hbvcds|FJ787481_SP_P-C Feature FT:CDS FJ787481_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S852-2). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactaccgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagttcactag
>gnl|hbvcds|FJ787482_SP_P-C Feature FT:CDS FJ787482_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1158-7). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787483_SP_P-C Feature FT:CDS FJ787483_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1158-8). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccaccccatcatcctgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787484_SP_P-C Feature FT:CDS FJ787484_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1348-3). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgacgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tgactcagtttactag
>gnl|hbvcds|FJ787485_SP_P-C Feature FT:CDS FJ787485_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1656-8). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggccccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787486_SP_P-C Feature FT:CDS FJ787486_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S2235-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787487_SP_P-C Feature FT:CDS FJ787487_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate DMY-1). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787488_SP_P-C Feature FT:CDS FJ787488_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate DMY-5). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccgtgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787489_SP_P-C Feature FT:CDS FJ787489_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate DMY-6). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccgtgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ787490_SP_P-C Feature FT:CDS FJ787490_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LHZ-1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtttcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ899761_SP_P-C Feature FT:CDS FJ899761_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899763_SP_P-C Feature FT:CDS FJ899763_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899764_SP_P-C Feature FT:CDS FJ899764_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899765_SP_P-C Feature FT:CDS FJ899765_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9-13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899767_SP_P-C Feature FT:CDS FJ899767_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C26-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggcccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899768_SP_P-C Feature FT:CDS FJ899768_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C56-7). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgatttctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899769_SP_P-C Feature FT:CDS FJ899769_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899770_SP_P-C Feature FT:CDS FJ899770_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76-4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899771_SP_P-C Feature FT:CDS FJ899771_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899772_SP_P-C Feature FT:CDS FJ899772_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C113-3). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaagacctccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaagccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899773_SP_P-C Feature FT:CDS FJ899773_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C113-6). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=333 residues).
cccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcct
cgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcacggg
accatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaa
actgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttgg
ctcagtttactag
>gnl|hbvcds|FJ899774_SP_P-C Feature FT:CDS FJ899774_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C120-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcgaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899775_SP_P-C Feature FT:CDS FJ899775_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C120-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899776_SP_P-C Feature FT:CDS FJ899776_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C122-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899777_SP_P-C Feature FT:CDS FJ899777_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C127-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899778_SP_P-C Feature FT:CDS FJ899778_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C173-1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacagaaccttcggacg
gaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ899783_SP_P-C Feature FT:CDS FJ899783_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C207-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaattactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899788_SP_P-C Feature FT:CDS FJ899788_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C226-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899789_SP_P-C Feature FT:CDS FJ899789_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C226-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaaccccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
ggaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggattgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ899793_SP_P-C Feature FT:CDS FJ899793_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C122-2). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgaacatcaacaaccagcac
gggaccttgcaagaactgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagcttactag
>gnl|hbvcds|FJ899794_SP_P-C Feature FT:CDS FJ899794_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C122-3). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgaacatcaacaaccagcac
gggaccttgcaagaactgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagcttactag
>gnl|hbvcds|FJ899795_SP_P-C Feature FT:CDS FJ899795_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C122-9). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaagcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaacaaccagcac
gggaccatgcaagaactgcacgattcctgctcaaggaacctctatgtttccctcttgttgcagtacaaaaccttcgggcg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904423_SP_P-C Feature FT:CDS FJ904423_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate A78). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaagggacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ184326_SP_P-C Feature FT:CDS GQ184326_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ZADGM501). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ227692_SP_P-C Feature FT:CDS GQ227692_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z3-1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgtcgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|GQ227693_SP_P-C Feature FT:CDS GQ227693_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggagtctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ227694_SP_P-C Feature FT:CDS GQ227694_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ227695_SP_P-C Feature FT:CDS GQ227695_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-5). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgagggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ227696_SP_P-C Feature FT:CDS GQ227696_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-6). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ227697_SP_P-C Feature FT:CDS GQ227697_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z3-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|GQ259588_SP_P-C Feature FT:CDS GQ259588_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z31-22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ358153_SP_P-C Feature FT:CDS GQ358153_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EIHB006). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ358154_SP_P-C Feature FT:CDS GQ358154_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SLK126). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ358157_SP_P-C Feature FT:CDS GQ358157_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M007). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358158_SP_C-C Feature FT:CDS GQ358158_SP_C-C of [Viruses] Hepatitis B Virus genotype C (isolate M154). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ372968_SP_P-C Feature FT:CDS GQ372968_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6380-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacttgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377514_SP_P-C Feature FT:CDS GQ377514_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J8). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377515_SP_P-C Feature FT:CDS GQ377515_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377517_SP_P-C Feature FT:CDS GQ377517_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377518_SP_P-C Feature FT:CDS GQ377518_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377521_SP_P-C Feature FT:CDS GQ377521_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377523_SP_P-C Feature FT:CDS GQ377523_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377524_SP_P-C Feature FT:CDS GQ377524_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J23). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377526_SP_P-C Feature FT:CDS GQ377526_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377527_SP_P-C Feature FT:CDS GQ377527_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377528_SP_P-C Feature FT:CDS GQ377528_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377529_SP_P-C Feature FT:CDS GQ377529_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377530_SP_P-C Feature FT:CDS GQ377530_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J35). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377531_SP_P-C Feature FT:CDS GQ377531_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J36). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377533_SP_P-C Feature FT:CDS GQ377533_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J39). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377535_SP_P-C Feature FT:CDS GQ377535_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J45). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377536_SP_P-C Feature FT:CDS GQ377536_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J47). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377538_SP_P-C Feature FT:CDS GQ377538_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J52). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377540_SP_P-C Feature FT:CDS GQ377540_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J57). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377541_SP_P-C Feature FT:CDS GQ377541_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J58). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377543_SP_P-C Feature FT:CDS GQ377543_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J63). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377545_SP_P-C Feature FT:CDS GQ377545_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J76). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccatcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377546_SP_P-C Feature FT:CDS GQ377546_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J77). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgttcaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377551_SP_P-C Feature FT:CDS GQ377551_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J82). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377552_SP_P-C Feature FT:CDS GQ377552_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J83). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377553_SP_P-C Feature FT:CDS GQ377553_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J84). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377554_SP_P-C Feature FT:CDS GQ377554_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J85). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377555_SP_P-C Feature FT:CDS GQ377555_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J86). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacttcaactaccagcac
gggaccatgcaagacctgcacgacacctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377557_SP_P-C Feature FT:CDS GQ377557_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J88). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377559_SP_P-C Feature FT:CDS GQ377559_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J92). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377562_SP_P-C Feature FT:CDS GQ377562_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J97). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377563_SP_P-C Feature FT:CDS GQ377563_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J98). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377570_SP_P-C Feature FT:CDS GQ377570_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J110). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttcttc
tggctcagtttactag
>gnl|hbvcds|GQ377571_SP_P-C Feature FT:CDS GQ377571_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J112). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377572_SP_P-C Feature FT:CDS GQ377572_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J113). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377574_SP_P-C Feature FT:CDS GQ377574_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J115). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377575_SP_P-C Feature FT:CDS GQ377575_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J116). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactacagttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377576_SP_P-C Feature FT:CDS GQ377576_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J117). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactacagttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377577_SP_P-C Feature FT:CDS GQ377577_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J118). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377578_SP_P-C Feature FT:CDS GQ377578_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J125). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377579_SP_P-C Feature FT:CDS GQ377579_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J126). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377580_SP_P-C Feature FT:CDS GQ377580_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J127). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377583_SP_P-C Feature FT:CDS GQ377583_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J132). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377584_SP_P-C Feature FT:CDS GQ377584_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J133). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377585_SP_P-C Feature FT:CDS GQ377585_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J134). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377586_SP_P-C Feature FT:CDS GQ377586_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J135). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377591_SP_P-C Feature FT:CDS GQ377591_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J148). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377593_SP_P-C Feature FT:CDS GQ377593_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J150). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377597_SP_P-C Feature FT:CDS GQ377597_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J157). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377598_SP_P-C Feature FT:CDS GQ377598_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J158). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377599_SP_P-C Feature FT:CDS GQ377599_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J160). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377600_SP_P-C Feature FT:CDS GQ377600_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J161). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377601_SP_P-C Feature FT:CDS GQ377601_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J164). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377603_SP_P-C Feature FT:CDS GQ377603_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J166). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377605_SP_P-C Feature FT:CDS GQ377605_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J169). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377608_SP_P-C Feature FT:CDS GQ377608_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J174). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377609_SP_P-C Feature FT:CDS GQ377609_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J176). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377615_SP_P-C Feature FT:CDS GQ377615_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J186). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377616_SP_P-C Feature FT:CDS GQ377616_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J192). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377617_SP_P-C Feature FT:CDS GQ377617_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J193). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377618_SP_P-C Feature FT:CDS GQ377618_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J194). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377619_SP_P-C Feature FT:CDS GQ377619_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J195). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactcccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377620_SP_P-C Feature FT:CDS GQ377620_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J197). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377621_SP_P-C Feature FT:CDS GQ377621_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J206). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377623_SP_P-C Feature FT:CDS GQ377623_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J208). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaattactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgttgcagaagatctcaatctcgggaacctcgatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377624_SP_P-C Feature FT:CDS GQ377624_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J221). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377628_SP_P-C Feature FT:CDS GQ377628_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J232). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377631_SP_P-C Feature FT:CDS GQ377631_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J239). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccaccac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377632_SP_P-C Feature FT:CDS GQ377632_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J240). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377636_SP_P-C Feature FT:CDS GQ377636_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J248). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctccactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377637_SP_P-C Feature FT:CDS GQ377637_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J249). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377640_SP_P-C Feature FT:CDS GQ377640_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J253). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377642_SP_P-C Feature FT:CDS GQ377642_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J256). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475305_SP_P-C Feature FT:CDS GQ475305_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR1CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475306_SP_P-C Feature FT:CDS GQ475306_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR2CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475307_SP_P-C Feature FT:CDS GQ475307_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR3CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475308_SP_P-C Feature FT:CDS GQ475308_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR4CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475309_SP_P-C Feature FT:CDS GQ475309_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR5CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475310_SP_P-C Feature FT:CDS GQ475310_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR6CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475311_SP_P-C Feature FT:CDS GQ475311_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR7CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475312_SP_P-C Feature FT:CDS GQ475312_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR8CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475313_SP_P-C Feature FT:CDS GQ475313_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR9CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475314_SP_P-C Feature FT:CDS GQ475314_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR10CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475315_SP_P-C Feature FT:CDS GQ475315_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR11CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475316_SP_P-C Feature FT:CDS GQ475316_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR12CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtggggctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475317_SP_P-C Feature FT:CDS GQ475317_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR13CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475318_SP_P-C Feature FT:CDS GQ475318_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR14CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475319_SP_P-C Feature FT:CDS GQ475319_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR15CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475320_SP_P-C Feature FT:CDS GQ475320_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR16CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475321_SP_P-C Feature FT:CDS GQ475321_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR17CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475322_SP_P-C Feature FT:CDS GQ475322_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR18LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475323_SP_P-C Feature FT:CDS GQ475323_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR19LC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcaccattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475324_SP_P-C Feature FT:CDS GQ475324_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR20LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475325_SP_P-C Feature FT:CDS GQ475325_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR21LC). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475326_SP_P-C Feature FT:CDS GQ475326_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR22LC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475327_SP_P-C Feature FT:CDS GQ475327_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR23LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtggggctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475328_SP_P-C Feature FT:CDS GQ475328_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR24LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475329_SP_P-C Feature FT:CDS GQ475329_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR25LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475330_SP_P-C Feature FT:CDS GQ475330_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR26LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475331_SP_P-C Feature FT:CDS GQ475331_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR27LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475332_SP_P-C Feature FT:CDS GQ475332_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR28LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475333_SP_P-C Feature FT:CDS GQ475333_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR29LC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475334_SP_P-C Feature FT:CDS GQ475334_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR30LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtggggctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475336_SP_P-C Feature FT:CDS GQ475336_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR32LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475337_SP_P-C Feature FT:CDS GQ475337_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR33LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475338_SP_P-C Feature FT:CDS GQ475338_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR34LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475339_SP_P-C Feature FT:CDS GQ475339_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR35HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475341_SP_P-C Feature FT:CDS GQ475341_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR37HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475342_SP_P-C Feature FT:CDS GQ475342_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR38HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
cggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475343_SP_P-C Feature FT:CDS GQ475343_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR39HCC). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475344_SP_P-C Feature FT:CDS GQ475344_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR40HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475345_SP_P-C Feature FT:CDS GQ475345_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR41HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475346_SP_P-C Feature FT:CDS GQ475346_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR42HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475347_SP_P-C Feature FT:CDS GQ475347_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR43HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475348_SP_P-C Feature FT:CDS GQ475348_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR44HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475349_SP_P-C Feature FT:CDS GQ475349_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR45HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475350_SP_P-C Feature FT:CDS GQ475350_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR46HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtaccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475351_SP_P-C Feature FT:CDS GQ475351_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR47HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475352_SP_P-C Feature FT:CDS GQ475352_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR48HCC). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475353_SP_P-C Feature FT:CDS GQ475353_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR49HCC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagatctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475354_SP_P-C Feature FT:CDS GQ475354_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR50HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475355_SP_P-C Feature FT:CDS GQ475355_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR51HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475356_SP_P-C Feature FT:CDS GQ475356_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR52HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaagggacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ475357_SP_P-C Feature FT:CDS GQ475357_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR53HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ872210_SP_P-C Feature FT:CDS GQ872210_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ872211_SP_P-C Feature FT:CDS GQ872211_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924604_SP_P-C Feature FT:CDS GQ924604_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924609_SP_P-C Feature FT:CDS GQ924609_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtctcctagaagaagaactccctcg
cctcgcagangaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatstcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattactgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924612_SP_P-C Feature FT:CDS GQ924612_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M30a). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924613_SP_P-C Feature FT:CDS GQ924613_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M30b). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924614_SP_P-C Feature FT:CDS GQ924614_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M31). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattactgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924615_SP_P-C Feature FT:CDS GQ924615_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924616_SP_P-C Feature FT:CDS GQ924616_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924619_SP_P-C Feature FT:CDS GQ924619_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M37). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctygcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924620_SP_C-C Feature FT:CDS GQ924620_SP_C-C of [Viruses] Hepatitis B Virus genotype C (isolate M38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaacaagcac
gggaccatgcaagacctgcacaactcmtgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924622_SP_P-C Feature FT:CDS GQ924622_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M40). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctck
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccaccacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924623_SP_P-C Feature FT:CDS GQ924623_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M41). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924629_SP_P-C Feature FT:CDS GQ924629_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M51). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccmtagaagaagaactccctct
tcttgcagaygaaggtctcaatcgycaagtcgcagaagatctcaatgtcgggaatgtcaasgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgcacaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924633_SP_P-C Feature FT:CDS GQ924633_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M56). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924636_SP_P-C Feature FT:CDS GQ924636_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M68). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccatagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatgtcgggaatgtcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924642_SP_P-C Feature FT:CDS GQ924642_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M77). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaaactctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924643_SP_P-C Feature FT:CDS GQ924643_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M78). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924649_SP_P-C Feature FT:CDS GQ924649_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M86). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924650_SP_P-C Feature FT:CDS GQ924650_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M87). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924655_SP_P-C Feature FT:CDS GQ924655_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M92). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
aggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ924658_SP_P-C Feature FT:CDS GQ924658_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M95). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU357845_SP_P-C Feature FT:CDS GU357845_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y1021). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggagcctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU434374_SP_P-C Feature FT:CDS GU434374_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 214-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU563561_SP_P-C Feature FT:CDS GU563561_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BV-153). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU721029_SP_P-C Feature FT:CDS GU721029_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CMCL107). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagttttctag
>gnl|hbvcds|HM011465_SP_P-C Feature FT:CDS HM011465_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM011468_SP_P-C Feature FT:CDS HM011468_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM011472_SP_P-C Feature FT:CDS HM011472_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacgtcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM011479_SP_P-C Feature FT:CDS HM011479_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactrctgttgttagacmacgakgcaggycccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcrrtctcgggawtctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM011481_SP_P-C Feature FT:CDS HM011481_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcckgaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM011486_SP_P-C Feature FT:CDS HM011486_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcratgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctacgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM011488_SP_P-C Feature FT:CDS HM011488_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacyaccagcac
gggaccmtgcaagacctgcacrrtwcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaarattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM011489_SP_P-C Feature FT:CDS HM011489_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM011491_SP_P-C Feature FT:CDS HM011491_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccctgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatctwgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM011493_SP_P-C Feature FT:CDS HM011493_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacttcaactaccagcac
gggaccatgcaagacctgcacgacacctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM011495_SP_P-C Feature FT:CDS HM011495_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacsacgargcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaycycaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtaccaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggsctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM011497_SP_P-C Feature FT:CDS HM011497_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM011500_SP_P-C Feature FT:CDS HM011500_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM011502_SP_P-C Feature FT:CDS HM011502_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggsaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
kaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750131_SP_P-C Feature FT:CDS HM750131_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate QHN-57). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750132_SP_P-C Feature FT:CDS HM750132_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Tibet-165). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccttgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750134_SP_P-C Feature FT:CDS HM750134_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate QHX-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750135_SP_P-C Feature FT:CDS HM750135_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate QHX-14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750136_SP_P-C Feature FT:CDS HM750136_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GSDC-53). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750137_SP_P-C Feature FT:CDS HM750137_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate QHN-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgcttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750138_SP_P-C Feature FT:CDS HM750138_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Tibet-100). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750139_SP_P-C Feature FT:CDS HM750139_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GSD-17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750140_SP_P-C Feature FT:CDS HM750140_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GSD-56). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750141_SP_P-C Feature FT:CDS HM750141_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate QHX-115). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgcacaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ622095_SP_P-C Feature FT:CDS HQ622095_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagatgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ638218_SP_P-C Feature FT:CDS HQ638218_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate A64-1). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaatcctgccaacggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|HQ700456_SP_P-C Feature FT:CDS HQ700456_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_NZL_HA121_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700457_SP_P-C Feature FT:CDS HQ700457_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_NZL_HA71_1997). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctctcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaacctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700475_SP_P-C Feature FT:CDS HQ700475_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_NZL_PA58_1984). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700476_SP_P-C Feature FT:CDS HQ700476_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_NZL_PA58_1999). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggwcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcrccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700490_SP_P-C Feature FT:CDS HQ700490_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_NZL_WH23_1993). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700495_SP_P-C Feature FT:CDS HQ700495_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_F155PF_2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700496_SP_P-C Feature FT:CDS HQ700496_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_F155C_2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggaag
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700502_SP_P-C Feature FT:CDS HQ700502_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_Is_1991). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700504_SP_P-C Feature FT:CDS HQ700504_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_Ve_1992). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcm
tggmkcagtttactag
>gnl|hbvcds|HQ700506_SP_P-C Feature FT:CDS HQ700506_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_NC_TA32_2003). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgcacaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcaatttactag
>gnl|hbvcds|HQ700516_SP_P-C Feature FT:CDS HQ700516_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_PNG_D029_2005). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaagaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctctaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700517_SP_P-C Feature FT:CDS HQ700517_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_PNG_D058A_2005). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcaatttactag
>gnl|hbvcds|HQ700522_SP_P-C Feature FT:CDS HQ700522_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_PNG_H086A_2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacgtcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HQ700529_SP_P-C Feature FT:CDS HQ700529_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_PNG_W083A_2004). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatccactaccagcac
gggaccttgcaagacctgcacgattcctgctcaaggaayctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700543_SP_P-C Feature FT:CDS HQ700543_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_PNG_P124A_2005). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacgtcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HQ700544_SP_P-C Feature FT:CDS HQ700544_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_T003_2A). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700545_SP_P-C Feature FT:CDS HQ700545_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_T015A_). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700555_SP_P-C Feature FT:CDS HQ700555_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BD4171_2001). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700556_SP_P-C Feature FT:CDS HQ700556_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BA4986_2002). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HQ700558_SP_P-C Feature FT:CDS HQ700558_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BD5375_2001). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700559_SP_P-C Feature FT:CDS HQ700559_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BD5561_2001). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tgrctcagtttactag
>gnl|hbvcds|HQ700561_SP_P-C Feature FT:CDS HQ700561_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BF7376_2002). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700562_SP_P-C Feature FT:CDS HQ700562_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tomga_BH5413_2002). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaacyacaagcac
gggaccatgcargacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttrctag
>gnl|hbvcds|HQ700563_SP_P-C Feature FT:CDS HQ700563_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BL9389_2002). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700564_SP_P-C Feature FT:CDS HQ700564_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BQ3589_2001). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700565_SP_P-C Feature FT:CDS HQ700565_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BR6895_2001). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700566_SP_P-C Feature FT:CDS HQ700566_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_JN1142_2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700567_SP_P-C Feature FT:CDS HQ700567_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To268_2006). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700568_SP_P-C Feature FT:CDS HQ700568_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To281_2006). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700569_SP_P-C Feature FT:CDS HQ700569_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To347_2006). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaagaaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtggacctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700570_SP_P-C Feature FT:CDS HQ700570_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To356_2006). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctaaatgaacctcaactacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700571_SP_P-C Feature FT:CDS HQ700571_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To391_2006). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcgagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700572_SP_P-C Feature FT:CDS HQ700572_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To422_2007). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700573_SP_P-C Feature FT:CDS HQ700573_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To426_2007). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700574_SP_P-C Feature FT:CDS HQ700574_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To400_2006). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700575_SP_P-C Feature FT:CDS HQ700575_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To244_2006). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700576_SP_P-C Feature FT:CDS HQ700576_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To250_2006). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaygcagaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcamgattcctgctcaaggaacctctatgtttccctcatgttgctgtwcaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700577_SP_P-C Feature FT:CDS HQ700577_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To293_2006). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaagaaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700578_SP_P-C Feature FT:CDS HQ700578_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To16_2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcggggatctcaatgaacatccactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF436920_SP_P-C Feature FT:CDS JF436920_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SZ6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF828905_SP_P-C Feature FT:CDS JF828905_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagactcctatgggaatgggcctcagtccgtttctca
tggctcagtttgctag
>gnl|hbvcds|JF828906_SP_P-C Feature FT:CDS JF828906_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagactcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828907_SP_P-C Feature FT:CDS JF828907_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-3). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828908_SP_P-C Feature FT:CDS JF828908_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggaatgggcctcagtccgtttctca
tggctcagtttgctag
>gnl|hbvcds|JF828910_SP_P-C Feature FT:CDS JF828910_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-8). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaaaattcctatgggaatgggcctcagtccgtttctca
tggctcagtttgctag
>gnl|hbvcds|JF828911_SP_P-C Feature FT:CDS JF828911_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-9). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828912_SP_P-C Feature FT:CDS JF828912_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-11). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828913_SP_P-C Feature FT:CDS JF828913_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacttcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828915_SP_P-C Feature FT:CDS JF828915_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828916_SP_P-C Feature FT:CDS JF828916_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagactcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF828917_SP_P-C Feature FT:CDS JF828917_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacttcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828918_SP_P-C Feature FT:CDS JF828918_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgtcgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacttcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828919_SP_P-C Feature FT:CDS JF828919_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagactcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF828920_SP_P-C Feature FT:CDS JF828920_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES70-14). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacttcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828921_SP_P-C Feature FT:CDS JF828921_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828922_SP_P-C Feature FT:CDS JF828922_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF828923_SP_P-C Feature FT:CDS JF828923_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828924_SP_P-C Feature FT:CDS JF828924_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828925_SP_P-C Feature FT:CDS JF828925_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828926_SP_P-C Feature FT:CDS JF828926_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828928_SP_P-C Feature FT:CDS JF828928_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF828929_SP_P-C Feature FT:CDS JF828929_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacccgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828930_SP_P-C Feature FT:CDS JF828930_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828931_SP_P-C Feature FT:CDS JF828931_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-15). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttcttag
>gnl|hbvcds|JF828937_SP_P-C Feature FT:CDS JF828937_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES72-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttgctag
>gnl|hbvcds|JF899336_SP_P-C Feature FT:CDS JF899336_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10B3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN315779_SP_P-C Feature FT:CDS JN315779_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN400087_SP_P-C Feature FT:CDS JN400087_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-75-Mother). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatcctgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN400088_SP_P-C Feature FT:CDS JN400088_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-77-Baby). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN400089_SP_P-C Feature FT:CDS JN400089_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-77-Mother). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatcctgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN827414_SP_P-C Feature FT:CDS JN827414_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 0015). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN827415_SP_P-C Feature FT:CDS JN827415_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 0032). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN827416_SP_P-C Feature FT:CDS JN827416_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 0294). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN827417_SP_P-C Feature FT:CDS JN827417_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 0300). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN827418_SP_P-C Feature FT:CDS JN827418_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 0904). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcaa
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaagattcctatgggattgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN827420_SP_P-C Feature FT:CDS JN827420_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4681). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN827421_SP_P-C Feature FT:CDS JN827421_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 5205). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaagattcctatgggattgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN827422_SP_P-C Feature FT:CDS JN827422_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 5494). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN827423_SP_P-C Feature FT:CDS JN827423_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6359). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
gcaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggattgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN827424_SP_P-C Feature FT:CDS JN827424_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2566). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN827425_SP_P-C Feature FT:CDS JN827425_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 3765). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ027317_SP_P-C Feature FT:CDS JQ027317_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ027318_SP_P-C Feature FT:CDS JQ027318_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ027319_SP_P-C Feature FT:CDS JQ027319_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ027320_SP_P-C Feature FT:CDS JQ027320_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaactcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgwttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ027321_SP_P-C Feature FT:CDS JQ027321_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ027322_SP_P-C Feature FT:CDS JQ027322_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaycccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaamctctatgtttccctcttgttgctgtayaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ027323_SP_P-C Feature FT:CDS JQ027323_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ027324_SP_P-C Feature FT:CDS JQ027324_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactrctgttgttagaccacgaggcaggwcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagyccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ027332_SP_P-C Feature FT:CDS JQ027332_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBc, HBx). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaacgaacatcaactaccagtac
gggaccatrcaagacctgcacgactcctgctcaaggaacctctatgagtccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagatacctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ027333_SP_P-C Feature FT:CDS JQ027333_SP_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040127_SP_P-C Feature FT:CDS JQ040127_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 50). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcagaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040129_SP_P-C Feature FT:CDS JQ040129_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 88). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040131_SP_P-C Feature FT:CDS JQ040131_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 125). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040132_SP_P-C Feature FT:CDS JQ040132_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 144). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgaacatcractaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacgggtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tgnnnnnnnnnnnnnn
>gnl|hbvcds|JQ040133_SP_P-C Feature FT:CDS JQ040133_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 160). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040135_SP_P-C Feature FT:CDS JQ040135_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 213). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgttcccctcttgttgttgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcrgtccgtttctcc
tggctcagnnnnnnnn
>gnl|hbvcds|JQ040139_SP_P-C Feature FT:CDS JQ040139_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 256). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacaacgaggcagkycctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagttwactag
>gnl|hbvcds|JQ040141_SP_P-C Feature FT:CDS JQ040141_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 260). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaktcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040143_SP_P-C Feature FT:CDS JQ040143_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 264). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcm
tggctcagtttactag
>gnl|hbvcds|JQ040144_SP_P-C Feature FT:CDS JQ040144_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 272). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040145_SP_P-C Feature FT:CDS JQ040145_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 277). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatctkatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040149_SP_P-C Feature FT:CDS JQ040149_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G76). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ040151_SP_P-C Feature FT:CDS JQ040151_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G79). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040152_SP_P-C Feature FT:CDS JQ040152_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G172). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040154_SP_P-C Feature FT:CDS JQ040154_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G181). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgatgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040155_SP_P-C Feature FT:CDS JQ040155_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G182). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040156_SP_P-C Feature FT:CDS JQ040156_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G186). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatccactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040158_SP_P-C Feature FT:CDS JQ040158_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G192). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040161_SP_P-C Feature FT:CDS JQ040161_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G213). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgtaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgttgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040162_SP_P-C Feature FT:CDS JQ040162_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G216). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040163_SP_P-C Feature FT:CDS JQ040163_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G217). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040164_SP_P-C Feature FT:CDS JQ040164_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G221). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ040165_SP_P-C Feature FT:CDS JQ040165_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G222). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040166_SP_P-C Feature FT:CDS JQ040166_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G223). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ040167_SP_P-C Feature FT:CDS JQ040167_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G225). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgawcatcaacwaccagcac
sggrccatgcaaracctgcacgaykcctgctcaaggaacctctatgtttccctcwtgttgctgtacaaaacctwcggacg
gaaactgcacytgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ040168_SP_P-C Feature FT:CDS JQ040168_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G233). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ040172_SP_P-C Feature FT:CDS JQ040172_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G243). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341611_SP_P-C Feature FT:CDS JQ341611_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno02). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341612_SP_P-C Feature FT:CDS JQ341612_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno03). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcagtgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341613_SP_P-C Feature FT:CDS JQ341613_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno04). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341614_SP_P-C Feature FT:CDS JQ341614_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno05). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagagggcgatgcaggccccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgmgtcgcagargatctccatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgtttccctcttgttgytgtacaaaaccttcggacg
gaaatygcacttgtattcccatcccatcatcttgggctttcgyaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341615_SP_P-C Feature FT:CDS JQ341615_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno06). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcat
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341616_SP_P-C Feature FT:CDS JQ341616_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno07). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341617_SP_P-C Feature FT:CDS JQ341617_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno08). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341618_SP_P-C Feature FT:CDS JQ341618_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno09). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcargacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacytgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341619_SP_P-C Feature FT:CDS JQ341619_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacatcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgccaacggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341620_SP_P-C Feature FT:CDS JQ341620_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagawctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341621_SP_P-C Feature FT:CDS JQ341621_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaygacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341622_SP_P-C Feature FT:CDS JQ341622_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno13). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggraatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341624_SP_P-C Feature FT:CDS JQ341624_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno15). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgagtcctgctcaaggcaactctaygtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgyaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341626_SP_P-C Feature FT:CDS JQ341626_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno17). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattactgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341628_SP_P-C Feature FT:CDS JQ341628_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno19). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccmtgcaagacctgcacgaytcctgctcaaggaamctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341630_SP_P-C Feature FT:CDS JQ341630_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno21). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggsaatctcaatgaacatcaacyamcagcac
gggaccatgcaagacctgcacgacacctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341631_SP_P-C Feature FT:CDS JQ341631_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno22). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacgtcaaccaccagcac
gggaccatgcaagacctgcacarttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341632_SP_P-C Feature FT:CDS JQ341632_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno23). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggcacctctatgattccctcttgttgctgtacaaaaccttcggacg
gaaactgcacatgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341633_SP_P-C Feature FT:CDS JQ341633_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno24). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacawcaaccaccagcac
gggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341634_SP_P-C Feature FT:CDS JQ341634_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno25). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctmaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcgaaacacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341635_SP_P-C Feature FT:CDS JQ341635_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno26). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgaacatcaacgaacagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341636_SP_P-C Feature FT:CDS JQ341636_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno27). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341637_SP_P-C Feature FT:CDS JQ341637_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno28). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341639_SP_P-C Feature FT:CDS JQ341639_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno30). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341641_SP_P-C Feature FT:CDS JQ341641_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno32). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341642_SP_P-C Feature FT:CDS JQ341642_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno33). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341643_SP_P-C Feature FT:CDS JQ341643_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno34). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaaygaacatcaaccamcagcac
ggggccatgcaagacctgcacgaytcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcm
tggctcagtttactag
>gnl|hbvcds|JQ341644_SP_P-C Feature FT:CDS JQ341644_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno35). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341647_SP_P-C Feature FT:CDS JQ341647_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno38). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaacctwcggacg
gaaattgcacytgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341648_SP_P-C Feature FT:CDS JQ341648_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno39). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341649_SP_P-C Feature FT:CDS JQ341649_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno40). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341650_SP_P-C Feature FT:CDS JQ341650_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno41). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcwtgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341651_SP_P-C Feature FT:CDS JQ341651_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno42). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaarattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341652_SP_P-C Feature FT:CDS JQ341652_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno43). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341653_SP_P-C Feature FT:CDS JQ341653_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno44). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccccgaggcaggtcctctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgyaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341654_SP_P-C Feature FT:CDS JQ341654_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno45). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341655_SP_P-C Feature FT:CDS JQ341655_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno46). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341656_SP_P-C Feature FT:CDS JQ341656_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno47). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgaacatcaactamcagcac
gggaccatgcaagacctgcacgartcctgctcaaggaacctctatgtttccctcwtgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341657_SP_P-C Feature FT:CDS JQ341657_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno48). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccmtgcaagacctgcacgacacctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341658_SP_P-C Feature FT:CDS JQ341658_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno49). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341659_SP_P-C Feature FT:CDS JQ341659_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno50). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgawtcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341661_SP_P-C Feature FT:CDS JQ341661_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno52). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341662_SP_P-C Feature FT:CDS JQ341662_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno53). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341663_SP_P-C Feature FT:CDS JQ341663_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno54). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgcacaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341664_SP_P-C Feature FT:CDS JQ341664_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno55). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341665_SP_P-C Feature FT:CDS JQ341665_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno56). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaygwcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341666_SP_P-C Feature FT:CDS JQ341666_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno57). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgasgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341668_SP_P-C Feature FT:CDS JQ341668_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno59). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341669_SP_P-C Feature FT:CDS JQ341669_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno60). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ341670_SP_P-C Feature FT:CDS JQ341670_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Cgeno61). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ429078_SP_P-C Feature FT:CDS JQ429078_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 08.40.117). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagatgccggggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ688403_SP_P-C Feature FT:CDS JQ688403_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ688404_SP_P-C Feature FT:CDS JQ688404_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707707_SP_P-C Feature FT:CDS JQ707707_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_10). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707708_SP_P-C Feature FT:CDS JQ707708_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_12). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707709_SP_P-C Feature FT:CDS JQ707709_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_13). Partial genome (Contains: HBe, HBc, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707710_SP_P-C Feature FT:CDS JQ707710_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_14). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707711_SP_P-C Feature FT:CDS JQ707711_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_15). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707712_SP_P-C Feature FT:CDS JQ707712_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_16). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707713_SP_P-C Feature FT:CDS JQ707713_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_19-5). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707715_SP_P-C Feature FT:CDS JQ707715_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_22). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707716_SP_P-C Feature FT:CDS JQ707716_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_23). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaactcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707717_SP_P-C Feature FT:CDS JQ707717_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_25). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatctcatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707718_SP_P-C Feature FT:CDS JQ707718_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_28). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707719_SP_P-C Feature FT:CDS JQ707719_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_29). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcgacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707720_SP_P-C Feature FT:CDS JQ707720_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_32-14). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707721_SP_P-C Feature FT:CDS JQ707721_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_33). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707722_SP_P-C Feature FT:CDS JQ707722_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_34). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707723_SP_P-C Feature FT:CDS JQ707723_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_35). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707724_SP_P-C Feature FT:CDS JQ707724_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_38). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707725_SP_P-C Feature FT:CDS JQ707725_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_39). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaaatgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707726_SP_P-C Feature FT:CDS JQ707726_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_4). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707727_SP_P-C Feature FT:CDS JQ707727_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_40). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707728_SP_P-C Feature FT:CDS JQ707728_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_41). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707729_SP_P-C Feature FT:CDS JQ707729_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_42). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707730_SP_P-C Feature FT:CDS JQ707730_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_47). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707731_SP_P-C Feature FT:CDS JQ707731_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_5). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707732_SP_P-C Feature FT:CDS JQ707732_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_6). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707733_SP_P-C Feature FT:CDS JQ707733_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S20_8). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707768_SP_P-C Feature FT:CDS JQ707768_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S50_10A-6). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707769_SP_P-C Feature FT:CDS JQ707769_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S50_13A). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707770_SP_P-C Feature FT:CDS JQ707770_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S50_14B). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707771_SP_P-C Feature FT:CDS JQ707771_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S50_20B). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707772_SP_P-C Feature FT:CDS JQ707772_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S50_26A). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707773_SP_P-C Feature FT:CDS JQ707773_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S50_27A). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707774_SP_P-C Feature FT:CDS JQ707774_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S50_C4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801470_SP_P-C Feature FT:CDS JQ801470_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801472_SP_P-C Feature FT:CDS JQ801472_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801473_SP_P-C Feature FT:CDS JQ801473_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801475_SP_P-C Feature FT:CDS JQ801475_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801478_SP_P-C Feature FT:CDS JQ801478_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS21). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ801480_SP_P-C Feature FT:CDS JQ801480_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS24). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801481_SP_P-C Feature FT:CDS JQ801481_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801482_SP_P-C Feature FT:CDS JQ801482_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801483_SP_P-C Feature FT:CDS JQ801483_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS28). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801486_SP_P-C Feature FT:CDS JQ801486_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801487_SP_P-C Feature FT:CDS JQ801487_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS34). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801488_SP_P-C Feature FT:CDS JQ801488_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801489_SP_P-C Feature FT:CDS JQ801489_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS36). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccgcaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801490_SP_P-C Feature FT:CDS JQ801490_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaggacctgcacgaatcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801491_SP_P-C Feature FT:CDS JQ801491_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctattgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801493_SP_P-C Feature FT:CDS JQ801493_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacaaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801495_SP_P-C Feature FT:CDS JQ801495_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801496_SP_P-C Feature FT:CDS JQ801496_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801497_SP_P-C Feature FT:CDS JQ801497_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801499_SP_P-C Feature FT:CDS JQ801499_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL6). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801500_SP_P-C Feature FT:CDS JQ801500_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801501_SP_P-C Feature FT:CDS JQ801501_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801502_SP_P-C Feature FT:CDS JQ801502_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801503_SP_P-C Feature FT:CDS JQ801503_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
ccccgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801504_SP_P-C Feature FT:CDS JQ801504_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801505_SP_P-C Feature FT:CDS JQ801505_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801508_SP_P-C Feature FT:CDS JQ801508_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL16). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatccttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctccatctcggggatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801509_SP_P-C Feature FT:CDS JQ801509_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL17). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801510_SP_P-C Feature FT:CDS JQ801510_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL18). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacaaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcat
gggaccatgcaagacctgcacgacacctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801511_SP_P-C Feature FT:CDS JQ801511_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801513_SP_P-C Feature FT:CDS JQ801513_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801515_SP_P-C Feature FT:CDS JQ801515_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL23). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaacgaagcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801517_SP_P-C Feature FT:CDS JQ801517_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL25). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgacgcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcggaagatctccatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801518_SP_P-C Feature FT:CDS JQ801518_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttgtcaacacgtccggaaactaatgttgttatacgacgaggcaggtcgcatagaagaagaactccctcg
catagcaaacgaaggtctcaatcgtcgcgtagcagaagatgtcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801519_SP_P-C Feature FT:CDS JQ801519_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801520_SP_P-C Feature FT:CDS JQ801520_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaaaaactccctcg
cctcccacacgaaggtctcaatcccctcctcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801521_SP_P-C Feature FT:CDS JQ801521_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL29). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattcctatgggactgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801522_SP_P-C Feature FT:CDS JQ801522_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccgtagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ801523_SP_P-C Feature FT:CDS JQ801523_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL31). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaacacccacg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX026877_SP_P-C Feature FT:CDS JX026877_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-NJ-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JX026878_SP_P-C Feature FT:CDS JX026878_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-NJ-14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattccggctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX026880_SP_P-C Feature FT:CDS JX026880_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-NJ-23). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX026884_SP_P-C Feature FT:CDS JX026884_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-NJ-60). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX026885_SP_P-C Feature FT:CDS JX026885_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-NJ-64). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatctcatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX026888_SP_P-C Feature FT:CDS JX026888_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-NJ-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaactcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccttcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX429903_SP_P-C Feature FT:CDS JX429903_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-42). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX429904_SP_P-C Feature FT:CDS JX429904_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-46). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX429905_SP_P-C Feature FT:CDS JX429905_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-47). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcaccattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX429906_SP_P-C Feature FT:CDS JX429906_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-48). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX429907_SP_P-C Feature FT:CDS JX429907_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-50). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX429909_SP_P-C Feature FT:CDS JX429909_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-59). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX429912_SP_P-C Feature FT:CDS JX429912_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-SD-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX429913_SP_P-C Feature FT:CDS JX429913_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-SD-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttcccttttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX429914_SP_P-C Feature FT:CDS JX429914_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-SD-13). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX429915_SP_P-C Feature FT:CDS JX429915_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-SD-19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX429916_SP_P-C Feature FT:CDS JX429916_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-SD-35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX429917_SP_P-C Feature FT:CDS JX429917_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-SD-36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX429918_SP_P-C Feature FT:CDS JX429918_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-SD-44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX504534_SP_P-C Feature FT:CDS JX504534_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcat
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcaatttactag
>gnl|hbvcds|JX504535_SP_P-C Feature FT:CDS JX504535_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-31). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX504536_SP_P-C Feature FT:CDS JX504536_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgctagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX504537_SP_P-C Feature FT:CDS JX504537_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-49). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacttcaactaccagcac
gggaccatgcaagacctgcacgatacctactcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX504539_SP_P-C Feature FT:CDS JX504539_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-NNJ-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcagtgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX504541_SP_P-C Feature FT:CDS JX504541_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-NNJ-14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccaccatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX504542_SP_P-C Feature FT:CDS JX504542_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-NNJ-17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX504544_SP_P-C Feature FT:CDS JX504544_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-SD-14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagtac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX504545_SP_P-C Feature FT:CDS JX504545_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-SD-37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX504546_SP_P-C Feature FT:CDS JX504546_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-SD-40). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX507211_SP_P-C Feature FT:CDS JX507211_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgsaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX507212_SP_P-C Feature FT:CDS JX507212_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgagkcaggtcccctagaagaagaacctccccg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX507214_SP_P-C Feature FT:CDS JX507214_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 99). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX560519_SP_P-C Feature FT:CDS JX560519_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHH76). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX560520_SP_P-C Feature FT:CDS JX560520_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHH139). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggactgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JX661488_SP_P-C Feature FT:CDS JX661488_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SH1212-C5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX661489_SP_P-C Feature FT:CDS JX661489_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SH1218-C9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX661490_SP_P-C Feature FT:CDS JX661490_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SH1217-C8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX661491_SP_P-C Feature FT:CDS JX661491_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SH1222-C10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX661492_SP_P-C Feature FT:CDS JX661492_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SH1215-C7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX661493_SP_P-C Feature FT:CDS JX661493_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SH1226-C13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX661495_SP_P-C Feature FT:CDS JX661495_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SH1223-C11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX661496_SP_P-C Feature FT:CDS JX661496_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SH1208-C4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaaccac
gggaccatgcaagacctgcacgattcctgctcaagggacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX661497_SP_P-C Feature FT:CDS JX661497_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SH1228-C14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX870000_SP_P-C Feature FT:CDS JX870000_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 245). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagawctccctsg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC315399_SP_P-C Feature FT:CDS KC315399_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M0507). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggccccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaagggacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774179_SP_P-C Feature FT:CDS KC774179_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SX11xa1580). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774180_SP_P-C Feature FT:CDS KC774180_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1002). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774181_SP_P-C Feature FT:CDS KC774181_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1012). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774182_SP_P-C Feature FT:CDS KC774182_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1013). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774184_SP_P-C Feature FT:CDS KC774184_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1022). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774185_SP_P-C Feature FT:CDS KC774185_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1023). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774187_SP_P-C Feature FT:CDS KC774187_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1027). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774189_SP_P-C Feature FT:CDS KC774189_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1030). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774190_SP_P-C Feature FT:CDS KC774190_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1031). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774191_SP_P-C Feature FT:CDS KC774191_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1032). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774192_SP_P-C Feature FT:CDS KC774192_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1034). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774194_SP_P-C Feature FT:CDS KC774194_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1036). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774195_SP_P-C Feature FT:CDS KC774195_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1046). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774196_SP_P-C Feature FT:CDS KC774196_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2015). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcgactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774197_SP_P-C Feature FT:CDS KC774197_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2035). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacctcaactaccagcac
gggaccatgcaagacctgcactattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774199_SP_P-C Feature FT:CDS KC774199_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2040). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774200_SP_P-C Feature FT:CDS KC774200_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2044). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774202_SP_P-C Feature FT:CDS KC774202_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2048). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774203_SP_P-C Feature FT:CDS KC774203_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2051). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774204_SP_P-C Feature FT:CDS KC774204_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2056). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774205_SP_P-C Feature FT:CDS KC774205_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2058). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774206_SP_P-C Feature FT:CDS KC774206_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2079). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcgacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtaccaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774207_SP_P-C Feature FT:CDS KC774207_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2084). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774208_SP_P-C Feature FT:CDS KC774208_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2086). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774209_SP_P-C Feature FT:CDS KC774209_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2087). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactacaagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774210_SP_P-C Feature FT:CDS KC774210_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2098). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774211_SP_P-C Feature FT:CDS KC774211_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2114). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgttctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774213_SP_P-C Feature FT:CDS KC774213_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2123). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagtac
gggaccatgcaagacctgcacgattcctgctcacggaccctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774214_SP_P-C Feature FT:CDS KC774214_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2124). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagtac
gggaccatgcaagacctgcacgattcctgctcacggaccctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774215_SP_P-C Feature FT:CDS KC774215_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2125). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774216_SP_P-C Feature FT:CDS KC774216_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2126). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774217_SP_P-C Feature FT:CDS KC774217_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2129). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggaca
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774218_SP_P-C Feature FT:CDS KC774218_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2134). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774219_SP_P-C Feature FT:CDS KC774219_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2144). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774220_SP_P-C Feature FT:CDS KC774220_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2152). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774221_SP_P-C Feature FT:CDS KC774221_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2153). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774223_SP_P-C Feature FT:CDS KC774223_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2183). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774224_SP_P-C Feature FT:CDS KC774224_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2184). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774225_SP_P-C Feature FT:CDS KC774225_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2188). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774226_SP_P-C Feature FT:CDS KC774226_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2194). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacccttccgaaaactactgttgttaaacaacaaggcaggccccctaaaaaaaaaactccctcc
cctcccaaacaaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggggattcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774227_SP_P-C Feature FT:CDS KC774227_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1009). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774228_SP_P-C Feature FT:CDS KC774228_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1023). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774229_SP_P-C Feature FT:CDS KC774229_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1024). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774231_SP_P-C Feature FT:CDS KC774231_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1028). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774232_SP_P-C Feature FT:CDS KC774232_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1031). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcactattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774233_SP_P-C Feature FT:CDS KC774233_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1035). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774235_SP_P-C Feature FT:CDS KC774235_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1041). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgaacgtcaactaccagcac
gggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774236_SP_P-C Feature FT:CDS KC774236_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1042). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774237_SP_P-C Feature FT:CDS KC774237_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1051). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774238_SP_P-C Feature FT:CDS KC774238_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1052). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcaccattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774239_SP_P-C Feature FT:CDS KC774239_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1063). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774240_SP_P-C Feature FT:CDS KC774240_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1066). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctattttatcaacacttccggaaactactgttgttaaacgacaaggcaggtcccctgaaaaaaaaactccctcg
cctcaaaaacaaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774241_SP_P-C Feature FT:CDS KC774241_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1067). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774242_SP_P-C Feature FT:CDS KC774242_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1070). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacgtcaactaccagcac
gggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774243_SP_P-C Feature FT:CDS KC774243_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1007). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774244_SP_P-C Feature FT:CDS KC774244_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1012). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774245_SP_P-C Feature FT:CDS KC774245_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1013). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgttgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774247_SP_P-C Feature FT:CDS KC774247_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1021). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774248_SP_P-C Feature FT:CDS KC774248_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1026). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774249_SP_P-C Feature FT:CDS KC774249_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1027). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774250_SP_P-C Feature FT:CDS KC774250_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1029). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774251_SP_P-C Feature FT:CDS KC774251_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1030). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774252_SP_P-C Feature FT:CDS KC774252_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1031). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaacatcaatgaacctcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774253_SP_P-C Feature FT:CDS KC774253_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1039). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgccaaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774254_SP_P-C Feature FT:CDS KC774254_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1046). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774255_SP_P-C Feature FT:CDS KC774255_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1050). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774256_SP_P-C Feature FT:CDS KC774256_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1053). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774257_SP_P-C Feature FT:CDS KC774257_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1056). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774259_SP_P-C Feature FT:CDS KC774259_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1061). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774260_SP_P-C Feature FT:CDS KC774260_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1065). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774261_SP_P-C Feature FT:CDS KC774261_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1067). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774262_SP_P-C Feature FT:CDS KC774262_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1068). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774264_SP_P-C Feature FT:CDS KC774264_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1072). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774265_SP_P-C Feature FT:CDS KC774265_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1074). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774266_SP_P-C Feature FT:CDS KC774266_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1075). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774267_SP_P-C Feature FT:CDS KC774267_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1084). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaaccaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774268_SP_P-C Feature FT:CDS KC774268_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1085). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774269_SP_P-C Feature FT:CDS KC774269_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1086). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattgctgccaacggaacctctatgtttccctcttgttgctgtacaaaaccttcggaca
gaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774270_SP_P-C Feature FT:CDS KC774270_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1093). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774271_SP_P-C Feature FT:CDS KC774271_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1094). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattactgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774272_SP_P-C Feature FT:CDS KC774272_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1107). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgctgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774274_SP_P-C Feature FT:CDS KC774274_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1124). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774275_SP_P-C Feature FT:CDS KC774275_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1126). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774276_SP_P-C Feature FT:CDS KC774276_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1128). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774277_SP_P-C Feature FT:CDS KC774277_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww2151). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774278_SP_P-C Feature FT:CDS KC774278_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww2155). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774279_SP_P-C Feature FT:CDS KC774279_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww2157). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgttgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774280_SP_P-C Feature FT:CDS KC774280_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1053). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774281_SP_P-C Feature FT:CDS KC774281_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1058). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
aggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
caaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774282_SP_P-C Feature FT:CDS KC774282_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1060). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774283_SP_P-C Feature FT:CDS KC774283_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1062). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774284_SP_P-C Feature FT:CDS KC774284_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1065). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacaacaactaccagcac
gggaccatgcaagacctgcacgattcctgcacaaggaccctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774285_SP_P-C Feature FT:CDS KC774285_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1067). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774286_SP_P-C Feature FT:CDS KC774286_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1076). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
tggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774287_SP_P-C Feature FT:CDS KC774287_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1087). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774288_SP_P-C Feature FT:CDS KC774288_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1175). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcacaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
ggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774289_SP_P-C Feature FT:CDS KC774289_SP_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1180). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaactaccagcac
gggaccctgcaagacctgcacgaatcctgctcaaaacacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774290_SP_P-C Feature FT:CDS KC774290_SP_P-C of [Viruses]