Dataset for nucleotide sequence SP of genotype A

[Download (right click)] [Edit] [Sequences] [Repertoires]

1415 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

JF439821_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB937797_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttrttagacgamgg
EU185786_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU185787_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU185789_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AJ344115_SP_P-A      atgcccctatcttatcatcacttccggaaactactgttgttagacgacgg
DQ298162_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacgg
DQ298165_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacgg
DQ298161_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacgg
DQ298163_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacgg
DQ298164_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacgg
GQ477474_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacgg
JF439880_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439877_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439878_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439873_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439875_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439872_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439869_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439871_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439874_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439876_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439879_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439881_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439882_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439883_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439870_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AF537372_SP_P-A      atgcccctatcttatcaacacttccggaaactgctgttgttagatgtcgg
JF439846_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439963_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttatacgacga
AY034878_SP_P-A      atgcccctatcttatcaacacttccggaagctactgttgttagacaacgg
JF439954_SP_P-A      atgcccctatcttatcaacacttccggatactactgttgttagacgacga
JF439967_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439961_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439952_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439951_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439852_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439836_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439840_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439850_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439855_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439958_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439990_SP_P-A      atgcccctatcttaccaacacttccggaaactactgttgttagacgacga
JF439982_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439984_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439985_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439988_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT749839_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749834_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439991_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439987_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439983_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439979_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439978_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgacga
JF439975_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439976_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439971_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439970_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttaggcgacga
JF439969_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439966_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439965_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439964_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439943_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439944_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439945_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439946_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439947_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439948_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439949_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439950_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439953_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439955_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439956_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439957_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439959_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439960_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439962_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439968_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439972_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439973_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439974_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439977_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439980_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439986_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439989_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439992_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439993_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439868_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439865_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439864_SP_P-A      atgcccctatcttatcaacactcccggaaactactgttgttagacgacgg
JF439862_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439857_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439854_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439856_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439849_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439861_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439866_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439848_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439845_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439843_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439841_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439838_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439858_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439860_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439833_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439834_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439835_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439837_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439839_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439844_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439847_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439851_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439853_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439859_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439867_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859934_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697493_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718089_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749846_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749847_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749849_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AM410963_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859951_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859954_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859956_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GU563550_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707595_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707638_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707639_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707640_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707641_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707642_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707643_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707644_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707645_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707646_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707647_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707648_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707649_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707650_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707651_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707652_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707653_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707654_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707655_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707656_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707658_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707659_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707661_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707662_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707663_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707664_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707665_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707667_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707669_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707670_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707672_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707675_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707676_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707681_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KM519454_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707674_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477502_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagaccacga
JF439919_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439925_SP_P-A      atgctcctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439926_SP_P-A      atgtccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439923_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439917_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439911_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439912_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439913_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439915_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439916_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439918_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439920_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439921_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439922_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439924_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439927_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439914_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
JF439932_SP_P-A      atgcccctatcttaccaacacttccggaatgtactgttgttagacgaagg
JF439942_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
JF439938_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
JF439937_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
JF439931_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
JF439935_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
JF439928_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
JF439930_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
JF439933_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
JF439939_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
JF439941_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
JF439929_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
JF439934_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
JF439936_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
JF439940_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagg
KT749822_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacaccgg
MF772345_SP_P-A      atgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgg
KJ843172_SP_P-A      atgcccctatcttatcaacacttccggaaattactgttgttagacgacgg
GQ477478_SP_P-A      atgcccctatcttatcaacacttccggaaaatactgttgttagaccacgg
GQ477473_SP_P-A      atgcccctatcttatcaacacttccggaaactgctgttgttagacgtcgg
AY152726_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgg
MF772347_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477469_SP_P-A      atgcccctatcttatcaatccttccggaaactactgttattagacgacgg
JQ707401_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707372_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707368_SP_P-A      atgcccctatcgtatcaacacttccggaaactactgttgttagacgacgg
JQ707335_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AM282986_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AY707087_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779265_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707419_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707407_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
JQ707408_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
JQ707415_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
JF439767_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439768_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439769_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439770_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439771_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439772_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439773_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439774_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439775_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439777_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439778_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF440016_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF440020_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF440018_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707347_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707348_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707351_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707354_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707357_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707361_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707362_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707364_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707367_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707400_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707402_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707403_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707404_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707405_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707406_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707409_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707410_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707411_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707412_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707413_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707414_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707416_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707417_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707418_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707420_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707339_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707308_SP_P-A      atgcccctatcttatcaacacttccggagactactgttgttagacgacgg
JQ707299_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707301_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707302_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707311_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707316_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707319_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707320_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707333_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707337_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707341_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707342_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MF772344_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779276_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779264_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779261_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779239_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707398_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707397_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707387_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707340_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707334_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707329_SP_P-A      atgcccctatcttatcaaaacttccggaaactactgttgttagacgacgg
JQ707327_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707325_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707324_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707326_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707344_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707305_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477496_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MF772348_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AF090838_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AF090841_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AY902775_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707303_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707304_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707307_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707309_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707310_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707312_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707315_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707318_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707321_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707323_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707332_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707336_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707338_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707343_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707371_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707373_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707374_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707375_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707376_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707377_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707378_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707379_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707380_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707381_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707382_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707383_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707384_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707385_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707386_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707388_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707389_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707390_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707391_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707392_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707393_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707394_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707396_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707399_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779234_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779260_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779263_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779269_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779283_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779312_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779331_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779337_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779344_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779345_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779348_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779349_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779351_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779354_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779356_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779358_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779359_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779361_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779374_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779375_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KX827294_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KX827295_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KX827296_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MF772350_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
X51970_SP_P-A        atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MF772346_SP_P-A      atgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgg
JQ707356_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707346_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707345_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707349_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707350_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707352_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707353_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707355_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707358_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707359_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707360_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707363_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707365_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707366_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707369_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707370_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707331_SP_P-A      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgg
JQ707300_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707306_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707313_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707314_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707317_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707322_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707328_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707330_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439842_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439832_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439828_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439822_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439820_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439824_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439825_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439826_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439829_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439830_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439831_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779213_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgatagacgacgg
KF779215_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgatagacgacgg
GQ477501_SP_P-A      atgcccctatcttatcaatgcttccggaaactgctgttgttagacgacgg
AJ627228_SP_P-A      atgcccctatcttatcaattcttccggaaactactgttgttagacgacga
GQ477497_SP_P-A      atgcccctatcttatcaacacttccggaatgtactgttattagacgacgg
AY233286_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AJ627227_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttrttagacgamgg
AF537371_SP_P-A      atgcccctatcttatcaacgcttccggaaactactgttgttagacgacgg
AF143302_SP_P-A      atgcccctatcttatcaacacctccggaaactactgttgttagacgacgg
DQ788728_SP_P-A      atgcccctatcttatcaacacctccggaaactactgttgttagacgacgg
AB205118_SP_P-A      atgcccctatcttatcaacacttccggaaacaactgttgttagacgacgg
EU414132_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagaygwcgg
JF439886_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439890_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477480_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgg
GQ477493_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgg
GQ477499_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgg
KP718095_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF779334_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ687533_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779384_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779284_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477484_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacag
KF779272_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779280_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779295_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MN507849_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477498_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgg
GQ477494_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779232_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439887_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439888_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439891_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439892_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439893_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439894_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439895_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439889_SP_P-A      atgcccctatcttatcaacacttacggaaactactgttgttagacgacgg
GQ477476_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477500_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KX827297_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779370_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779329_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707635_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707582_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgg
JQ707594_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgg
JQ707598_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgg
JQ707607_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgg
JQ707581_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439823_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439819_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439827_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477491_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477487_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477472_SP_P-A      atgcccctatcttatcaatacttccggaaactactgttattagacgacgg
GQ477468_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477465_SP_P-A      atgcccctatcttatcaacacttccggaaactactgtttgtagacgacgg
FJ904434_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AF143298_SP_P-A      atgcccctatcttatcaacaattccggaaactactgttgttagacgacgg
AB116076_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgccgg
JQ707395_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB453982_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgg
EU859938_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgg
GQ477466_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgg
GQ477462_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GU563551_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP995108_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779221_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477495_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AJ309370_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacgg
AJ309369_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacgg
AJ309371_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacgg
GQ477504_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KF779270_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
GQ477463_SP_P-A      atgcccctatcttatcaactcttccggaaactactgttgttagacgacgg
FJ904411_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ843182_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ843186_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ843218_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779268_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779210_SP_P-A      atgcccctatcttatcaacacttccggagcctactgttgttagacgacgg
KF779293_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779298_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
HE576988_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
HE576989_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
Z72478_SP_P-A        atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
X02763_SP_C-A        atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
V00866_SP_P-A        atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MT426097_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MT426096_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749833_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718102_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ854709_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgr
KJ843217_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP274925_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ843216_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779308_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779311_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779297_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779294_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779287_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779249_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779231_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ843184_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779211_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KC875260_SP_P-A      atgcccctatcttatcaacacttccggagactactgttgttagacgacgg
JX096952_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707600_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707599_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707589_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707577_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707576_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707585_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707586_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707590_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707592_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707597_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707608_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707575_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707578_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707583_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707603_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707604_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707606_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707550_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707549_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707537_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707554_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707536_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707532_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JF439981_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439752_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439753_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439754_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439755_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439756_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439757_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439758_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439759_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439760_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439761_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439762_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439763_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439764_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439765_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF439766_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF779238_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF779240_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ477488_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779266_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477486_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477477_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477475_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707551_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779381_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477464_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ184324_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859955_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707574_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707579_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707580_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707584_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707587_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707588_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707591_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707593_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707596_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707601_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707602_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707605_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859944_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859912_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttggtagacgacgg
EU747320_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU594388_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749838_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU594386_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU414133_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
DQ788725_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AY738139_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AY738140_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AY738141_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AY738142_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AY738143_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AY233280_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779367_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MT426098_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MT426099_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AJ627226_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AF297622_SP_P-A      atgcccctatcttatcaacacttccggagactactgttgttagacgacgg
AF090839_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AF090840_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB937798_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697511_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697506_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707531_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707533_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707535_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707538_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707539_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707540_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707542_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707543_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707545_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707561_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707569_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707571_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697491_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB453983_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacgg
EU859935_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacgg
EU859936_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacgg
AB362931_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB222707_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB126580_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AF536524_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB116081_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AM295796_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859898_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB116077_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB064314_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB014370_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ184323_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707553_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707556_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707558_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707559_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707572_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779365_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749825_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749826_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749842_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KY886219_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB116078_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB116079_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB116080_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB246337_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB246338_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB300366_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB300367_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB453979_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB453980_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB453981_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB453984_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB480036_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB480038_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB480039_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB480040_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB480041_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB549213_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697487_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697488_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697489_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697492_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697495_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697496_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697497_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697498_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697499_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697501_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697503_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697504_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697505_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697507_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697508_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697509_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB697512_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB775198_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB775199_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB775200_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB775201_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB937792_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB937793_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB937794_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AF043580_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AF297624_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AJ012207_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AM295795_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AM295797_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AY128092_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AY862867_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AY862868_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EF208113_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU086721_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU594383_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU594384_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU594385_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU594387_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU594389_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU594390_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU594391_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU594392_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU594393_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU594394_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU594395_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859899_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859900_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859901_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859902_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859903_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859904_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859905_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859906_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859907_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859908_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859909_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859910_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859911_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859913_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859914_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859915_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859916_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859917_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859918_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859919_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859920_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859921_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859922_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859923_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859924_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859925_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859926_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859927_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859928_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859929_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859930_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859931_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859932_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859933_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859937_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859939_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859940_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859941_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859942_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859943_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859945_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859946_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859947_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859948_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859949_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859950_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU859953_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
FJ349222_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
FJ349224_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ414522_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477461_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477467_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477470_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477479_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477482_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477490_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ477503_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GU563546_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GU563553_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GU563554_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GU563555_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GU563557_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GU563558_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GU563562_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ687529_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707534_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707541_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707544_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707546_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707547_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707548_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707552_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707555_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707557_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707560_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707562_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707563_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707564_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707565_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707566_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707567_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707568_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707570_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707573_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707609_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707610_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707611_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707612_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707613_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707614_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707615_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707616_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707617_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707618_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707619_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707620_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707621_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707622_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707623_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707624_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707625_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707626_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707627_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707628_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707629_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707630_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707631_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707632_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707633_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707634_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707636_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JQ707637_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JX096953_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JX310721_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JX310722_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JX310723_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JX310724_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
JX310725_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779227_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779243_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779244_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779245_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779246_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779247_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779248_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779251_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779252_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779253_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779254_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779255_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779256_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779257_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779258_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779259_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779262_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779271_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779273_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779274_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779275_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779277_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779279_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779281_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779282_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779286_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779290_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779291_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779299_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779304_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779305_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779306_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779307_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779309_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779310_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779313_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779314_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779315_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779316_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779317_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779319_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779320_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779321_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779322_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779323_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779324_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779325_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779326_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779328_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779330_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779333_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779335_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779336_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779338_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779339_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779342_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779346_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779347_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779350_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779352_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779355_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779362_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779363_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779364_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779366_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779368_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779369_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779371_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779372_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779373_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779378_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779379_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779383_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779385_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779386_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ586809_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ843166_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ843173_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ843188_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ843192_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ843214_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ843215_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ854708_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KJ854710_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KM606742_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KM606746_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KM606749_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP274927_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP274928_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718087_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718088_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718090_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718091_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718092_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718093_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718094_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718096_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718097_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718098_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718099_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718100_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP718101_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749824_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749829_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749830_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749831_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749832_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749835_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749836_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749837_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749840_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749843_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749844_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KT749850_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KU605532_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KX827293_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KX827298_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KY003230_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KY382410_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
L13994_SP_P-A        atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
LC074724_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
LC311241_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
LC311242_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
LC311243_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
LC430617_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
LC458430_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
LC458431_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
LC517161_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
LC592168_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
LC592169_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
LC592170_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MH932713_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MT426093_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MT426094_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MT426095_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
OK106253_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
X70185_SP_P-A        atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
Z35717_SP_P-A        atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KF779360_SP_P-A      atgctcctatcttatcaacacttccggaaactactgttgttagacgacgg
MW567968_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY934763_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MW567969_SP_P-A      atgcccctatcttatcaacacttccggaaactgctgttgttagatgtcga
JQ023662_SP_P-A      aggcccctatcttatcaacacttccggaaactactgttgtttgacgacga
JQ023663_SP_P-A      aggcccctatcttatcaacacttccggaaactactgttgtttgacgacga
FJ692567_SP_P-A      atgcccctatcttatcaacacttccggagactactgttgttagatgtcga
FJ692586_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
MH464807_SP_P-A      atgcccctatcttatcaatacttccggagacttctgttgttagatgtcga
FJ692555_SP_P-A      atgcccctatcttatcaacacttccggaaactrctgttgttagatgtcgg
MN585097_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MK512455_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
GQ331046_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
EU859952_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
GQ331047_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
LT992448_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacg-
EU304331_SP_P-A      atgcccctatcttatcaacacttccggaaactgctgttgttagacaacga
MG877723_SP_P-A      atgcccctatcttatcaacacttccggaaactgctgttgttagacaacga
MG877724_SP_P-A      atgcccctatcttatcaacacttccggaaactgctgttgttagacaacga
MG877725_SP_P-A      atgcccctatcttatcaacacttccggaaactgctgttgttagacaacga
FN545826_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MH464809_SP_P-A      atgcccctatcctatcaacacttccggaaactactgttgttagatgccga
MH464823_SP_P-A      atgcccctatcctatcaacacttccggaaactactgttgttagatgccga
KR905425_SP_P-A      atgcccctatcttatcaacacttccggaaattgctgttgttagacgacga
KT366466_SP_P-A      atgcccctatcttatcaacacttccggaaattgctgttgttagacgacga
LT992441_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacg-
KR905429_SP_P-A      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacga
KP168427_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF214662_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB246317_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB116094_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB116092_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB116087_SP_P-A      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacga
KF214666_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacga---
FJ692561_SP_P-A      atgcccctatcttatcaacacttccggaractgctgttgttagatgtcga
KT151612_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagaggaaga
KT151617_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagaggaaga
KF922429_SP_P-A      atgcccctatcttatcaactcttccggagactactgttgttagacgacga
KF922430_SP_P-A      atgcccctatcttatcaactcttccggagactactgttgttagacgacga
KF922431_SP_P-A      atgcccctatcttatcaactcttccggagactactgttgttagacgacga
MH464811_SP_P-A      atgcccctatcctatcaacacttccggaaactactgttgttagatgccga
MH464817_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX648547_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX648549_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
EF103278_SP_P-A      atgcccctatcttatcaacacttccggagactactgttgttagatgtcga
KF922418_SP_P-A      atgcccctatcttatcatcacttccggaaactactgttgttagacgacga
KF922417_SP_P-A      atgcccctatcttatcatcacttccggaaactactgttgttagacgatga
KF922414_SP_P-A      atgcccctatcttatcatcacttccggaaactactgttgttagacgacga
KF922415_SP_P-A      atgcccctatcttatcatcacttccggaaactactgttgttagacgacga
KF922416_SP_P-A      atgcccctatcttatcatcacttccggaaactactgttgttagacgacga
KF922419_SP_P-A      atgcccctatcttatcatcacttccggaaactactgttgttagacgacga
KF922420_SP_P-A      atgcccctatcttatcatcacttccggaaactactgttgttagacgacga
KF922421_SP_P-A      atgcccctatcttatcatcacttccggaaactactgttgttagacgacga
KR905426_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT366467_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512477_SP_P-A      atgcccctatcttatcaacacttccggaaactgctgttgttagatgtcga
FM199980_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692572_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
MT114170_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512463_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464808_SP_P-A      atgcccctatcttatcaacacttcckgaaactactgttgttagacgacga
MF925373_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
KX276769_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KR905427_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
KP168435_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP168428_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgtcgc
KP168426_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854689_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF779332_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF214659_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
HM011485_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692573_SP_P-A      atgcccctatcttatcatcacttccggaaactactgttgttagacgacga
FJ692565_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY233285_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB937795_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB116091_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB116088_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacaacga
AB116085_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB076679_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ349296_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtagg
MN585096_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
FJ692592_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
FM199975_SP_P-A      atgcccctatcttrtcaacacttccggaaactactgttgttagatgtcga
MK512462_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY161142_SP_P-A      atgcccctatcttatcagcacttccggaaactactgttgttagacgacga
MH464820_SP_P-A      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
AY233287_SP_P-A      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
AY233276_SP_P-A      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
AY233279_SP_P-A      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
JN182334_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182331_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182330_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182318_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182319_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182321_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182322_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182323_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182325_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182326_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182327_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182328_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182329_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182332_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182333_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182320_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN182324_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512460_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF925362_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
KP168422_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagaygwcga
FJ692577_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgg
AY233281_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AM494718_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY233288_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY934773_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB076678_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MT426090_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MT426091_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF925400_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
AY903452_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatg----
EU366129_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
MT210034_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MT210032_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512475_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512468_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512464_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttcttagacgacga
MH464825_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LT992440_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KX357649_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgtcga
KX357644_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
KP168431_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP168424_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854701_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854685_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgtcga
KF214660_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
HM535205_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692576_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagaggacga
FJ692575_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692564_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692559_SP_P-A      atgcccctatcttatcaacrcttccggaaactactgttgttagacgacga
FJ692558_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY934772_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY934768_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY233275_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AF297623_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgccga
AB116083_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB116082_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
AB453989_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacaacga
KF922435_SP_P-A      atgcccctatcttatcaatccttccggaaactactgttgttagacgacga
KF922436_SP_P-A      atgcccctatcttatcaatccttccggaaactactgttgttagacgacga
KF922437_SP_P-A      atgcccctatcttatcaatccttccggaaactactgttgttagacgacga
KT151611_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MN053840_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP168434_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KU605533_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KU605534_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854706_SP_P-A      atgcccctatcttatcaacgcttccggaaactactgttgttagacgacga
KJ854704_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ854703_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854686_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ843183_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854697_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MN476101_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB116086_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AF043560_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854691_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854692_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854694_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854696_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854702_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854705_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512471_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GU563547_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FM199974_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
KT347091_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT347092_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512456_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512461_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX357640_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512476_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ315785_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ194506_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512469_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB116084_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgc
FJ692566_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF925385_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY161138_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AY161139_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP168433_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ093431_SP_P-A      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MF925372_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
M57663_SP_P-A        atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT151613_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT151614_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT151615_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT151616_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT151618_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KR905430_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KR905431_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT366468_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT366470_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ315784_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY161143_SP_P-A      atgcccctatcttatcagcacttccggaaactactgttgttagacgacga
AY161144_SP_P-A      atgcccctatcttatcagcacttccggaaactactgttgttagacgacga
AB116089_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB241114_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB246335_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB453986_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AF090842_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY373432_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF214657_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF214661_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF214663_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF214665_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KM243029_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT366469_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT366471_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF925361_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MT426088_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY373429_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC875259_SP_P-A      atgcccctatcttatcaacacttccggaaacttgtgttgttagacgacga
MN476102_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX357646_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KU736919_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP168429_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC875258_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC875257_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC875254_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC875252_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ315786_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ020002_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KU736918_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY934765_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB116090_SP_P-A      atgcccctatcttatccacacttccggaaactactgttgttagacgacga
AY373428_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY934766_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC875251_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC875253_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC875255_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC875256_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF214658_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854687_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854688_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854690_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP168430_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP168432_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF925407_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MT426092_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464816_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX357647_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KU605536_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KU605537_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KU605538_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KU605539_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692590_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692591_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY233290_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB241115_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AF297621_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
OK274310_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692588_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF922433_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ023661_SP_P-A      aggcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ023660_SP_P-A      aggcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF922409_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF922407_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY233284_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF922406_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF922408_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ010776_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ010777_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ010778_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692587_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgc
MK512474_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512466_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464829_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464812_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464810_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464813_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464814_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464818_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464819_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464821_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464822_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464824_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464826_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464827_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464830_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF772353_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX648548_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX357650_SP_P-A      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
KX357645_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX357643_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854699_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF922434_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT347087_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JX154579_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FM199981_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FM199977_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FM199976_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692578_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692579_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692580_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692581_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692582_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692583_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692584_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692585_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854698_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692571_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692570_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU410082_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ020003_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgt
AY934769_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY934770_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY934771_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JX154580_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JX154581_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JX154582_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KU736920_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX357642_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY934767_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY233289_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY233283_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY233274_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB453988_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB116093_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB246336_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB453987_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB937791_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB937796_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AF297625_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY233278_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY233282_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY934774_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692557_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692562_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692563_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692574_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FM199978_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FM199979_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GU563545_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GU563548_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
HM535200_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF922424_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF922425_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF922426_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF922427_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF922428_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854693_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854695_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854700_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ854707_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KM519452_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KM519453_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KM606748_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP168423_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP168425_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP718085_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP718086_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT347088_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KU605535_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF772351_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF925368_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464815_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH464828_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512457_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512458_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512459_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512465_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512467_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512470_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512472_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK512473_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC051141_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FN545830_SP_P-A      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagg
FJ692613_SP_P-A      atgcccctatcttatcaacacttccggagactactgttattagacgacga
FJ692595_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacaacga
FJ692599_SP_P-A      atgcccctatcctatcgacacttcctgaaactactgttgttagacgacga
FJ692607_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgagga
FJ692597_SP_P-A      atgcccctatcttatcaacacttccggaaactgctgttgttagacwacga
FJ692609_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692610_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692612_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692611_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692605_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692603_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692600_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692593_SP_P-A      atgcccctatcttatcaacacttccggaaactrctgttgttagacga---
FJ692608_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692606_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692596_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692598_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692601_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692602_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ692604_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FN545837_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
FN545838_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagactacgg
FN545833_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FN545834_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB194950_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
AM180624_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AM184125_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AM184126_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
EU054331_SP_C-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
FN545828_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
FN545835_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
FN545839_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagakgtagg
MW567976_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagaagtcgg
JF439748_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439734_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439726_SP_P-A      atgcccctatcttatcgacacttcctgaaactactgttgttagacgacgg
JF439731_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439744_SP_P-A      atgcccctatcttatcaacacttcctcaaactactgttgttagacgacgg
JF439743_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439739_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439729_SP_P-A      atgcccctatcttatcaacacttcctcaaactactgttgttagacgacgg
JF439720_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439722_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439730_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439742_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439745_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439746_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439732_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439733_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439725_SP_P-A      atgcccctatcttatcaacacttcctcaaactactgttgttagacgacgg
JF439728_SP_P-A      atgcccctatcttatcaacacttcctcaaactactgttgttagacgacgg
JF439727_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439741_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439750_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439740_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439906_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439747_SP_P-A      atgcccctatcttatcgacacttcctgaaactactgttgttagacgacgg
JF439724_SP_P-A      atgcccctatcttatcaacacttcctcaaactactgttgttagacgacgg
JF439751_SP_P-A      atgcccctatcttatcaacacttcctcaaactactgttgttagacgacgg
JF439721_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439735_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439736_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439737_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439738_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439896_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439897_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439898_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439899_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439900_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439901_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439902_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439903_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439904_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439905_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439907_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439908_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439909_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439910_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
JF439723_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
FJ692554_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
FN545831_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
FN545836_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
LC462120_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MW567972_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
FN545825_SP_P-A      atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgg
AY934764_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
GQ161813_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KM606737_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MW567975_SP_P-A      atgcccctatcttatcaacacttccggaaaatactgttgttagacgacgg
MH580627_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MH580639_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MH580642_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MH580643_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MW567973_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB194952_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
HM363613_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
HM363612_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MT622525_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB194951_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
MN544634_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
FN545832_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagaygmagg
FN545829_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
FN545840_SP_P-A      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
                     * *  ****** *  *        *  *      * **  *         

JF439821_SP_P-A      gaccg---acgccggttccctaaaagaagaactccctcgcctcgcagacg
AB937797_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU185786_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU185787_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU185789_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AJ344115_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
DQ298162_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
DQ298165_SP_P-A      gaccg---aggctggtcccatagaagaagaactccctcgcctcgcagacg
DQ298161_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
DQ298163_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
DQ298164_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477474_SP_P-A      gaccg---agtcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439880_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439877_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439878_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439873_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439875_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439872_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439869_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439871_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439874_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439876_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439879_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439881_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439882_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439883_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439870_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF537372_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439846_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439963_SP_P-A      gactg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY034878_SP_P-A      gaccg---acgcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439954_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439967_SP_P-A      gaccg---aggcacgtcccctacaacaagaactccctcgcctcgcagacg
JF439961_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439952_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgccttgcagacg
JF439951_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439852_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439836_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439840_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439850_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439855_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439958_SP_P-A      gaccg---aggcaggtcccctagaggaggaactccctcgcctcgcagacg
JF439990_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439982_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439984_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439985_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439988_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749839_SP_P-A      gaccg---aggcaggtcccctagaacaagaactccctcgcctcgcagacg
KT749834_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcatacg
JF439991_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439987_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439983_SP_P-A      gaccg---aggcaggtcccctagaagaggaactccctcgcctcgcagacg
JF439979_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439978_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439975_SP_P-A      gaccg---aggcaggtcccctagaagaagaactctctcgcctcgcagacg
JF439976_SP_P-A      gaccg---aggcaggtcccctagaagaagaactctctcgcctcgcagacg
JF439971_SP_P-A      gaccg---aggcaggtcccctagaagaaggactccctcgcctcgcagacg
JF439970_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439969_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439966_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439965_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439964_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439943_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439944_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439945_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439946_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439947_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439948_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439949_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439950_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439953_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439955_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439956_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439957_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439959_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439960_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439962_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439968_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439972_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439973_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439974_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439977_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439980_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439986_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439989_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439992_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439993_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439868_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439865_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439864_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439862_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439857_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439854_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439856_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439849_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439861_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439866_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439848_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439845_SP_P-A      gaccg---aggcaggtcccctagaagaagagctccctcgcctcgcagacg
JF439843_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439841_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439838_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439858_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439860_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439833_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439834_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439835_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439837_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439839_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439844_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439847_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439851_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439853_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439859_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439867_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859934_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697493_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718089_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749846_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749847_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749849_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AM410963_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859951_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859954_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859956_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GU563550_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707595_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707638_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707639_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707640_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707641_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707642_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707643_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707644_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707645_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707646_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707647_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707648_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707649_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707650_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707651_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707652_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707653_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707654_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707655_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707656_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707658_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707659_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707661_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707662_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707663_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707664_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707665_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707667_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707669_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707670_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707672_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707675_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707676_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707681_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KM519454_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707674_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477502_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439919_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439925_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439926_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439923_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439917_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439911_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439912_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439913_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439915_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439916_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439918_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439920_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439921_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439922_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439924_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439927_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439914_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439932_SP_P-A      gaccg---agtcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439942_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439938_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439937_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439931_SP_P-A      gacca---gggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439935_SP_P-A      gacca---gggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439928_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439930_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439933_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439939_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439941_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439929_SP_P-A      gaccg---gggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439934_SP_P-A      gaccg---gggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439936_SP_P-A      gaccg---gggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439940_SP_P-A      gaccg---gggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749822_SP_P-A      gaccg---aggcaggtctcctagaagaagaactccctcgcctcgcagacg
MF772345_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843172_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477478_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477473_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY152726_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MF772347_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477469_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707401_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707372_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707368_SP_P-A      gaccg---aggcaggttccctagaagaagaactccctcgcctcgcagacg
JQ707335_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AM282986_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY707087_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779265_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707419_SP_P-A      gaccg---gggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707407_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707408_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707415_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439767_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439768_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439769_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439770_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439771_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439772_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439773_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439774_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439775_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439777_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439778_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF440016_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF440020_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF440018_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707347_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707348_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707351_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707354_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707357_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707361_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707362_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707364_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707367_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707400_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707402_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707403_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707404_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707405_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707406_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707409_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707410_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707411_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707412_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707413_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707414_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707416_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707417_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707418_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707420_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707339_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707308_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707299_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707301_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707302_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707311_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707316_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707319_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707320_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707333_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707337_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707341_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707342_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MF772344_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779276_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779264_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779261_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779239_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcatacg
JQ707398_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707397_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707387_SP_P-A      gaccg---aggcaggtcccctagaagaagaactcccgcgcctcgcagacg
JQ707340_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707334_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707329_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707327_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707325_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707324_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707326_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707344_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707305_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477496_SP_P-A      gaccg---agtcaggtcccctagaagaagaactccctcgcctcgcagacg
MF772348_SP_P-A      gaccg---agtcaggtcccctagaagaagaactccctcgcctcgcagacg
AF090838_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF090841_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY902775_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707303_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707304_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707307_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707309_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707310_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707312_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707315_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707318_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707321_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707323_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707332_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707336_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707338_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707343_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707371_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707373_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707374_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707375_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707376_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707377_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707378_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707379_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707380_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707381_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707382_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707383_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707384_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707385_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707386_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707388_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707389_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707390_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707391_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707392_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707393_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707394_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707396_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707399_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779234_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779260_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779263_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779269_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779283_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779312_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779331_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779337_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779344_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779345_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779348_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779349_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779351_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779354_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779356_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779358_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779359_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779361_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779374_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779375_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX827294_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX827295_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX827296_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MF772350_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
X51970_SP_P-A        gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MF772346_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707356_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707346_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707345_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707349_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707350_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707352_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707353_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707355_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707358_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707359_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707360_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707363_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707365_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707366_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707369_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707370_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707331_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707300_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707306_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707313_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707314_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707317_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707322_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707328_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707330_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439842_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439832_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439828_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439822_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439820_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439824_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439825_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439826_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439829_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439830_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439831_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779213_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779215_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477501_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AJ627228_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477497_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233286_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AJ627227_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF537371_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF143302_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
DQ788728_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB205118_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU414132_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439886_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439890_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477480_SP_P-A      gaccg---acgcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477493_SP_P-A      gaccg---acgccggtcccctagaagaagaactccctcgcctcgcagacg
GQ477499_SP_P-A      gaccg---acgcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718095_SP_P-A      ggcag---aggcaggtcccctagaagaagaaccccctcgcctcgcagacg
KF779334_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ687533_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcaaacg
KF779384_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779284_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagtct
GQ477484_SP_P-A      caccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779272_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779280_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779295_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MN507849_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477498_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477494_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779232_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439887_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439888_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439891_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439892_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439893_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439894_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439895_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439889_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477476_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477500_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX827297_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779370_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779329_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707635_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgccacgcagacg
JQ707582_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707594_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707598_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707607_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707581_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439823_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439819_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439827_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477491_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477487_SP_P-A      gaccg---aggccggtcccctagaggaagaactccctcgcctcgcagacg
GQ477472_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477468_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477465_SP_P-A      gtccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ904434_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF143298_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116076_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707395_SP_P-A      gaccg---cggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB453982_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859938_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477466_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477462_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GU563551_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP995108_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779221_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477495_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AJ309370_SP_P-A      gaccg---aggcaggtcccctagaagaagaaccccctcgcctcgcagacg
AJ309369_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AJ309371_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477504_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779270_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477463_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ904411_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843182_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843186_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843218_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779268_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779210_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779293_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcggctcgcagacg
KF779298_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcggctcgcagacg
HE576988_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
HE576989_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
Z72478_SP_P-A        gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
X02763_SP_C-A        gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
V00866_SP_P-A        gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MT426097_SP_P-A      gaccg---aggcaggccccctagaagaagaactccctcgcctcgcagacg
MT426096_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcaggcg
KT749833_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718102_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccytcgcctcgcagacg
KJ854709_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843217_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP274925_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843216_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779308_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779311_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779297_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779294_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcggctcgcagacg
KF779287_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779249_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779231_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843184_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779211_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KC875260_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JX096952_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707600_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707599_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707589_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707577_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707576_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707585_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707586_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707590_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707592_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707597_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707608_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707575_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707578_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707583_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707603_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707604_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707606_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707550_SP_P-A      gatcg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707549_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707537_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707554_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707536_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707532_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439981_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439752_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439753_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439754_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439755_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439756_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439757_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439758_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439759_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439760_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439761_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439762_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439763_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439764_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439765_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439766_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779238_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779240_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477488_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779266_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477486_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477477_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477475_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707551_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
KF779381_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477464_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ184324_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859955_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707574_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707579_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707580_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707584_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707587_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707588_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707591_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707593_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707596_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707601_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707602_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707605_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859944_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859912_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU747320_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU594388_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749838_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU594386_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU414133_SP_P-A      aaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
DQ788725_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY738139_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY738140_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY738141_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY738142_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY738143_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233280_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779367_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MT426098_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MT426099_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AJ627226_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF297622_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF090839_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF090840_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB937798_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697511_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697506_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707531_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707533_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707535_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707538_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707539_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707540_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707542_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707543_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707545_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707561_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707569_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707571_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697491_SP_P-A      gaccg---aggcaggtcccctagaagargaactccctcgcctcgcagacg
AB453983_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859935_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859936_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB362931_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB222707_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB126580_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF536524_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116081_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcaaacg
AM295796_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcaaacg
EU859898_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcaaacg
AB116077_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB064314_SP_P-A      gaccg---aggcaggttccctagaagaagaactccctcgcctcgcagacg
AB014370_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ184323_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707553_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707556_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707558_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707559_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707572_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779365_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749825_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749826_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749842_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KY886219_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116078_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116079_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116080_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB246337_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB246338_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB300366_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB300367_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB453979_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB453980_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB453981_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB453984_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB480036_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB480038_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB480039_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB480040_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB480041_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB549213_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697487_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697488_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697489_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697492_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697495_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697496_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697497_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697498_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697499_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697501_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697503_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697504_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697505_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697507_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697508_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697509_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB697512_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB775198_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB775199_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB775200_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB775201_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB937792_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB937793_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB937794_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF043580_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF297624_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AJ012207_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AM295795_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AM295797_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY128092_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY862867_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY862868_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EF208113_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU086721_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU594383_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU594384_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU594385_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU594387_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU594389_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU594390_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU594391_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU594392_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU594393_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU594394_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU594395_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859899_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859900_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859901_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859902_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859903_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859904_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859905_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859906_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859907_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859908_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859909_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859910_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859911_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859913_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859914_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859915_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859916_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859917_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859918_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859919_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859920_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859921_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859922_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859923_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859924_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859925_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859926_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859927_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859928_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859929_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859930_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859931_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859932_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859933_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859937_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859939_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859940_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859941_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859942_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859943_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859945_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859946_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859947_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859948_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859949_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859950_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859953_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ349222_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ349224_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ414522_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477461_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477467_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477470_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477479_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477482_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477490_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ477503_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GU563546_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GU563553_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GU563554_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GU563555_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GU563557_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GU563558_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GU563562_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ687529_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707534_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707541_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707544_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707546_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707547_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707548_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707552_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707555_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707557_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707560_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707562_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707563_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707564_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707565_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707566_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707567_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707568_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707570_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707573_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707609_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707610_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707611_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707612_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707613_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707614_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707615_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707616_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707617_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707618_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707619_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707620_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707621_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707622_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707623_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707624_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707625_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707626_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707627_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707628_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707629_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707630_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707631_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707632_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707633_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707634_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707636_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ707637_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JX096953_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JX310721_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JX310722_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JX310723_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JX310724_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JX310725_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779227_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779243_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779244_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779245_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779246_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779247_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779248_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779251_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779252_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779253_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779254_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779255_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779256_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779257_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779258_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779259_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779262_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779271_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779273_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779274_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779275_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779277_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779279_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779281_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779282_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779286_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779290_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779291_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779299_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779304_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779305_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779306_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779307_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779309_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779310_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779313_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779314_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779315_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779316_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779317_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779319_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779320_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779321_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779322_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779323_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779324_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779325_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779326_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779328_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779330_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779333_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779335_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779336_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779338_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779339_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779342_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779346_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779347_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779350_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779352_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779355_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779362_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779363_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779364_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779366_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779368_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779369_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779371_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779372_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779373_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779378_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779379_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779383_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779385_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779386_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ586809_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843166_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843173_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843188_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843192_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843214_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843215_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854708_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854710_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KM606742_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KM606746_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KM606749_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP274927_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP274928_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718087_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718088_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718090_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718091_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718092_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718093_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718094_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718096_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718097_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718098_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718099_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718100_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718101_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749824_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749829_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749830_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749831_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749832_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749835_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749836_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749837_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749840_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749843_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749844_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT749850_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KU605532_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX827293_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX827298_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KY003230_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KY382410_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
L13994_SP_P-A        gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LC074724_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LC311241_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LC311242_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LC311243_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LC430617_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LC458430_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LC458431_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LC517161_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LC592168_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LC592169_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LC592170_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH932713_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MT426093_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MT426094_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MT426095_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
OK106253_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
X70185_SP_P-A        gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
Z35717_SP_P-A        gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779360_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MW567968_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
AY934763_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MW567969_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ023662_SP_P-A      gaccg---aggcaggtcccctaaaagaagaactccctcgcctcgcagacg
JQ023663_SP_P-A      gaccg---aggccggtcccctaaaagaagaactccctcgcctcgcaaacg
FJ692567_SP_P-A      aaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692586_SP_P-A      aaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464807_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692555_SP_P-A      gaccg---aggcaggtcctctagaagaagaactccctcacctcgcagacg
MN585097_SP_P-A      ggaca---tggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512455_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ331046_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU859952_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
GQ331047_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
LT992448_SP_P-A      --------aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU304331_SP_P-A      caccg---aggcaggtcccctagaggaagaactccctcgcctcgcagacs
MG877723_SP_P-A      caccg---aggcaggtcccctagaggaagaactccctcgcctcgcagacg
MG877724_SP_P-A      caccg---aggcaggtcccctagaggaagaactccctcgcctcgcagacg
MG877725_SP_P-A      caccg---aggcaggtcccctagaggaagaactccctcgcctcgcagacg
FN545826_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464809_SP_P-A      gctcg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464823_SP_P-A      gctcg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KR905425_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT366466_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LT992441_SP_P-A      --------aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KR905429_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP168427_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF214662_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
AB246317_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
AB116094_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116092_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116087_SP_P-A      gtccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF214666_SP_P-A      ---cg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692561_SP_P-A      gcccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT151612_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT151617_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922429_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922430_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922431_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464811_SP_P-A      gctcg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464817_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX648547_SP_P-A      ggcyg---cggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX648549_SP_P-A      gaccg---aggcaggkcccctagaagaagaactccctcgcctcgcagacg
EF103278_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922418_SP_P-A      ggccg---aggcaggtcccctggaagaagaactccctcgcctcgcagacg
KF922417_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922414_SP_P-A      ggccg---agacaggtcccctagaagaagaactccctcgcctcgcagacg
KF922415_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922416_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922419_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922420_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922421_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KR905426_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT366467_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512477_SP_P-A      gtccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FM199980_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692572_SP_P-A      aaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MT114170_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512463_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagaca
MH464808_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MF925373_SP_P-A      gaccg---aggcagggcccctagaagaagaactccctcgcctcgcagacg
KX276769_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KR905427_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP168435_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP168428_SP_P-A      gaccg---aggyaggtcccctagaagaagaactccctcgcctcgcagacg
KP168426_SP_P-A      gaccg---aggcaggwcccctagaagaagaactccctcgcctcgcmgacg
KJ854689_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF779332_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF214659_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
HM011485_SP_P-A      gacca---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692573_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692565_SP_P-A      grccg---aggcaggtcccctmgaagaagaactccctcgcctcgcagacg
AY233285_SP_P-A      gaccg---aggcaggacccctagaagaagaactccctcgcctcgcagacg
AB937795_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116091_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
AB116088_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116085_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB076679_SP_P-A      gaccg---aggcgggtcccctagaagaagaactccctcgcctcgcagacg
FJ349296_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MN585096_SP_P-A      ggaca---tggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692592_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FM199975_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512462_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
AY161142_SP_P-A      gaccg---aggcaggtcccctagaagaagactcccttcgccttgcagacg
MH464820_SP_P-A      gatcg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233287_SP_P-A      gatcg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233276_SP_P-A      gatcg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233279_SP_P-A      gatcg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JN182334_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182331_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182330_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182318_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182319_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182321_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182322_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182323_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182325_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182326_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182327_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182328_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182329_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182332_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182333_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182320_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
JN182324_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
MK512460_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcaaaca
MF925362_SP_P-A      ggcca---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP168422_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692577_SP_P-A      gaccg---acgcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233281_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AM494718_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233288_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY934773_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB076678_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MT426090_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MT426091_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MF925400_SP_P-A      aaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY903452_SP_P-A      --ccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU366129_SP_P-A      gtccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MT210034_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
MT210032_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512475_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512468_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512464_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464825_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LT992440_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX357649_SP_P-A      gacag---aggcaggtccactagaagaagaactccctcgcctcgcagacg
KX357644_SP_P-A      aacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP168431_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP168424_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854701_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854685_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF214660_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
HM535205_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcggacg
FJ692576_SP_P-A      ccccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692575_SP_P-A      gaccg---aggyaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692564_SP_P-A      ggccg---aggcaggtcccctcgaagaagaactccctcgcctcgcagacg
FJ692559_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692558_SP_P-A      gaccg---tggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY934772_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
AY934768_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233275_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF297623_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116083_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116082_SP_P-A      aaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB453989_SP_P-A      taccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922435_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922436_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922437_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT151611_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MN053840_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP168434_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KU605533_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KU605534_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854706_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854704_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854703_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854686_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ843183_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854697_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MN476101_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116086_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF043560_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854691_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854692_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854694_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854696_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854702_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854705_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512471_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GU563547_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
FM199974_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT347091_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT347092_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512456_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512461_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX357640_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512476_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
DQ315785_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ194506_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512469_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116084_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692566_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MF925385_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY161138_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY161139_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP168433_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MZ093431_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MF925372_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
M57663_SP_P-A        gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT151613_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT151614_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT151615_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT151616_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT151618_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KR905430_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KR905431_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT366468_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT366470_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
DQ315784_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY161143_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY161144_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116089_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB241114_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB246335_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB453986_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF090842_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY373432_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF214657_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF214661_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF214663_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF214665_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KM243029_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT366469_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT366471_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MF925361_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MT426088_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY373429_SP_P-A      gaccg---aggcaggtcccctagtagaagaactccctcgcctcgcagacg
KC875259_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MN476102_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX357646_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KU736919_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP168429_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KC875258_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KC875257_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KC875254_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KC875252_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
DQ315786_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
DQ020002_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KU736918_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY934765_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116090_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY373428_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY934766_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KC875251_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KC875253_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KC875255_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KC875256_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF214658_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854687_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854688_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854690_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP168430_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP168432_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MF925407_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MT426092_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464816_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX357647_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KU605536_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KU605537_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KU605538_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KU605539_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692590_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692591_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233290_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB241115_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF297621_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
OK274310_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692588_SP_P-A      gaccggcaaggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922433_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ023661_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JQ023660_SP_P-A      gaccg---aggcaagtcccctagaagaagaactccctcgcctcgcagacg
KF922409_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922407_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233284_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922406_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922408_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ010776_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ010777_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ010778_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692587_SP_P-A      aaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512474_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgccccgcagacg
MK512466_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464829_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464812_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464810_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464813_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464814_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464818_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464819_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464821_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464822_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464824_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464826_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464827_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464830_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MF772353_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX648548_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX357650_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX357645_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgccgacg
KX357643_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854699_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922434_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT347087_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JX154579_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FM199981_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FM199977_SP_P-A      gaccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FM199976_SP_P-A      gaccg---aggyaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692578_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692579_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692580_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692581_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692582_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692583_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692584_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692585_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854698_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692571_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692570_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU410082_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
DQ020003_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY934769_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY934770_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY934771_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JX154580_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JX154581_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JX154582_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KU736920_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KX357642_SP_P-A      gacag---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY934767_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233289_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233283_SP_P-A      gaccg---aggcaggccccctagaagaagaactccctcgcctcgcagacg
AY233274_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB453988_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB116093_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB246336_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB453987_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB937791_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB937796_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AF297625_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233278_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY233282_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY934774_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692557_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692562_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692563_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692574_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FM199978_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FM199979_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GU563545_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GU563548_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
HM535200_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922424_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922425_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922426_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922427_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KF922428_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854693_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854695_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854700_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KJ854707_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KM519452_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KM519453_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KM606748_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP168423_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP168425_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718085_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KP718086_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KT347088_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KU605535_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MF772351_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MF925368_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464815_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH464828_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512457_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512458_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512459_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512465_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512467_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512470_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512472_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MK512473_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LC051141_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FN545830_SP_P-A      gaccg---aggtcggtcccctagaagaagaactccctcgcctcgcagacg
FJ692613_SP_P-A      gatcg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692595_SP_P-A      taccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692599_SP_P-A      gaccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692607_SP_P-A      gaccg---aggcaggtcccttagaagacgaactccctcgcctcgcagacg
FJ692597_SP_P-A      mtccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692609_SP_P-A      gaccg---aggcaggtcccctagaagacgtactccctcgcctcgcagacg
FJ692610_SP_P-A      grccg---aggcaggtcccctagaagacgtactccctcgcctcgcagacg
FJ692612_SP_P-A      gaccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692611_SP_P-A      gaccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692605_SP_P-A      gaccg---aggcaggtcccctagaagacgtactccctcgcctcgcagacg
FJ692603_SP_P-A      gaccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692600_SP_P-A      saccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692593_SP_P-A      ---cg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692608_SP_P-A      gaccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692606_SP_P-A      gaccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692596_SP_P-A      gaccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692598_SP_P-A      gaccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692601_SP_P-A      gaccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692602_SP_P-A      gaccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FJ692604_SP_P-A      gaccg---aggcaggtcccctagaagacgaactccctcgcctcgcagacg
FN545837_SP_P-A      gaccg---aggtcggtcccctagaagaagaactccctcgcctcgcagacg
FN545838_SP_P-A      aaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FN545833_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
FN545834_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
AB194950_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AM180624_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AM184125_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AM184126_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
EU054331_SP_C-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FN545828_SP_P-A      gaccc---aggccggtcccctagaagaagaactccctcgcctcgcagacg
FN545835_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
FN545839_SP_P-A      gaccg---aggccggtcccctagaagaagaactccctcgcctcgcagacg
MW567976_SP_P-A      ggccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439748_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439734_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439726_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439731_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439744_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439743_SP_P-A      gaccg---aggcaggccccctagaagaagaactccctcgcctcgcagacg
JF439739_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439729_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439720_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439722_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439730_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439742_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439745_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439746_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439732_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439733_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439725_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439728_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439727_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439741_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439750_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439740_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439906_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439747_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439724_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439751_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439721_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439735_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439736_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439737_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439738_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439896_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439897_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439898_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439899_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439900_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439901_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439902_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439903_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439904_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439905_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439907_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439908_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439909_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439910_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
JF439723_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FJ692554_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FN545831_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FN545836_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
LC462120_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MW567972_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FN545825_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AY934764_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
GQ161813_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
KM606737_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MW567975_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH580627_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH580639_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH580642_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MH580643_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MW567973_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB194952_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
HM363613_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
HM363612_SP_P-A      gaccg---aggtaggtcccctagaagaagaactccctcgcctcgcagacg
MT622525_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
AB194951_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
MN544634_SP_P-A      gaccg---aggcaggtcccctagaagaagaactccctcgcctcgcagacg
FN545832_SP_P-A      gaccg---aggtcggtcccctagaagaagaactccctcgcctcgcagacg
FN545829_SP_P-A      gaccg---agctcggtcccctagaagaagaactccctcgcctcgcagacg
FN545840_SP_P-A      gaccg---aggtcggtcccctagaagaagaactccctcgcctcgcagacg
                                   *     *     * *    *   *  *  **   * 

JF439821_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcamtctcgggaatctcaat
AB937797_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaat
EU185786_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
EU185787_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
EU185789_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
AJ344115_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
DQ298162_SP_P-A      cagatttcaatcgccgcgtcacagaagatctcgatctcggggatcccaat
DQ298165_SP_P-A      cagatcccaatcgccgcgtcgcagaagatctcaatctcggggatcccaat
DQ298161_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaat
DQ298163_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaat
DQ298164_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaat
GQ477474_SP_P-A      cmgatctcaatcgccgcgtcgcagaagatctccatctcgggaacctcaat
JF439880_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439877_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439878_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439873_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaat
JF439875_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaat
JF439872_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439869_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439871_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439874_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439876_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439879_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439881_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439882_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439883_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439870_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
AF537372_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
JF439846_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439963_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacttcaat
AY034878_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439954_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcgatctcgggaatctcaat
JF439967_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439961_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439952_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439951_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439852_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaac
JF439836_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439840_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439850_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439855_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439958_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439990_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439982_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaat
JF439984_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439985_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439988_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
KT749839_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
KT749834_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439991_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439987_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439983_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439979_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439978_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439975_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439976_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439971_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439970_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439969_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccat
JF439966_SP_P-A      cagatcccaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439965_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439964_SP_P-A      cagatctcgatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439943_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439944_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439945_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439946_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439947_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439948_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439949_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439950_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439953_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439955_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439956_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439957_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439959_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439960_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439962_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439968_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439972_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439973_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439974_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439977_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439980_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439986_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439989_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439992_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439993_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439868_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439865_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439864_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439862_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaat
JF439857_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439854_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439856_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439849_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439861_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439866_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439848_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
JF439845_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439843_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439841_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439838_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439858_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439860_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439833_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439834_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439835_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439837_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439839_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439844_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439847_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439851_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439853_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439859_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JF439867_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
EU859934_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
AB697493_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
KP718089_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
KT749846_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
KT749847_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
KT749849_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
AM410963_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
EU859951_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
EU859954_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
EU859956_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
GU563550_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JQ707595_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JQ707638_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
JQ707639_SP_P-A      cagatctcaatcgccgcgtcgcagaagatctcaatc