Dataset for nucleotide sequence PreS1 of genotype A

[Download (right click)] [Edit] [Sequences] [Repertoires]

1500 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

KP168435_PreS1_P-A      atggggctttcttggacggtccctctcgagtg---gggaaagaatcagtc
JN604218_PreS1_P-A      atgggaggttggtcatcmaaacctcgcaaaggcatggggacgaatctttc
JN604308_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
AB937797_PreS1_P-A      atgggaggttggtcatcmaaacctcgcaaaggcatggggacgaatctttc
EU185786_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604165_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
DQ298161_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
DQ298162_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
DQ298163_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
DQ298164_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
DQ298165_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JN604249_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AJ344115_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477474_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604309_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
MF772348_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604285_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604314_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JN604229_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477477_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477493_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtc
AJ627227_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtc
JN604176_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604220_PreS1_P-A      atgggaggttggccatcaaaacctcgcaaaggcatggggacgaatctttc
AJ309369_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AJ309370_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AJ309371_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439872_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439881_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439877_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439878_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439870_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439869_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439876_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439880_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439875_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439871_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439874_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439879_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439882_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439883_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439873_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX125364_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707599_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707589_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707576_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707608_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707585_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707586_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707592_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707590_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707595_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707604_PreS1_P-A      atgggaggttggtcatcaaaacctcacaaaggcatggggacgaatctttc
JQ707580_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707587_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707606_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707581_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707603_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707583_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707575_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707578_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707598_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707593_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707582_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707607_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707605_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707600_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707596_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707577_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707594_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707601_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707584_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707588_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707591_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707597_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707602_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707574_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707579_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439852_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439867_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439846_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439855_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439850_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439836_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439840_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439843_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439847_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439857_PreS1_P-A      atgggagattggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439841_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439859_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439839_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439858_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439860_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439854_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439856_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439853_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439851_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439835_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439837_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439834_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439845_PreS1_P-A      atgggaggttggtcatcaagacctcgcaaaggcatggggacgaatctttc
JF439848_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439865_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439838_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439833_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439844_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439864_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439849_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439866_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439861_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439868_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439990_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439862_PreS1_P-A      acgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859934_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439949_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718089_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439988_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439976_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439975_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcacggggacgaatctttc
JF439970_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439961_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439958_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439966_PreS1_P-A      atgtgaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439965_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749834_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749846_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749847_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749849_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749839_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KM519454_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439993_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439992_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439991_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439985_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439983_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439982_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439979_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439978_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439972_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439971_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439953_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439952_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439951_PreS1_P-A      atgggaggtcggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439943_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859955_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439984_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439977_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439973_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439968_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439960_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439959_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439957_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439955_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439950_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439947_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439944_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859956_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697493_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439989_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707664_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439987_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439986_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439969_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439963_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439962_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439956_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439954_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439946_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439945_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439964_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439948_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439967_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439974_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439980_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859954_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GU563550_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707676_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707674_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707663_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707658_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AM295798_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtc
AM295799_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtc
AM410963_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtc
JQ707659_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707661_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707662_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707665_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707667_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707669_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707670_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707672_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707675_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707681_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707318_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY152726_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AF090838_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604179_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
X51970_PreS1_P-A        atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707367_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707364_PreS1_P-A      atgggaggttggtcatcaacacctcgcaaaggcatggggacgaatctttc
JQ707349_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707345_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707370_PreS1_P-A      atgggaggttggtcatcaacacctcgcaaaggcatggggacgaatctttc
JQ707368_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggtcgaatctttc
JQ707346_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707354_PreS1_P-A      atgggaggttggtcatcaacacctcgcaaaggcatggggacgaatctttc
JQ707362_PreS1_P-A      atgggaggttggtcatcaacacctcgcaaaggcatggggacgaatctttc
JQ707348_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707357_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707351_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707347_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707361_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707369_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707366_PreS1_P-A      atgggaggttggtcatcaacacctcgcaaaggcatggggacgaatctttc
JQ707358_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707355_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707356_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707363_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707365_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707353_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707350_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707352_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707359_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707360_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707344_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JQ707380_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707324_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707326_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707319_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707339_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707342_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707333_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707320_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707308_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707299_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707302_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707311_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707341_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY233280_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604209_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AF090841_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604190_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779293_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604277_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF440020_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439768_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439769_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439767_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439777_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439774_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779260_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707401_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604188_PreS1_P-A      akgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707337_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcgtggggacgaatctttc
AM282986_PreS1_P-A      atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaatctttc
AY707087_PreS1_P-A      atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaatctttc
JQ707316_PreS1_P-A      atggcaggttggtcatcgaaacctcgcaaaggcatggggacgaatctttc
JN604274_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707325_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707335_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779264_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604317_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604307_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859939_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779365_PreS1_P-A      atgggaggttggtcctccaaacctcgcaaaggcatggggacgaatctttc
JQ707340_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604282_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779234_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779265_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707398_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707305_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779263_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JQ707406_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707322_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707331_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779261_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707372_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707309_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707312_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707301_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707419_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707417_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707411_PreS1_P-A      atgggaggttggtcatcaaaccctcgcaaaggcatggggacgaatctttc
JQ707414_PreS1_P-A      atgggaggttggtcatcaaaccctcgcaaaggcatggggacgaatctttc
JQ707408_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707407_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707415_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707400_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707402_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707403_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707404_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707405_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707409_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707410_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707412_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707413_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707416_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707418_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707420_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707395_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779276_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707397_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707378_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatcttta
JQ707343_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707334_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707332_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707336_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707329_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707327_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707323_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707321_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707313_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707306_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707303_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604299_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604167_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779372_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779349_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779356_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779239_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779269_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779374_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779358_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779331_PreS1_P-A      atgggaggttggtcgtcaaaacctcgcaaaggcatggggacgaatctttc
KF779312_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779359_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707399_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatgcggacgaatctttc
JQ707393_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707391_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707388_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707387_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707386_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707384_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707377_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707375_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707374_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707371_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707373_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707376_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707379_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707381_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707382_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707383_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707385_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707389_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707390_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707392_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707394_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707396_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779249_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779309_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779368_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779335_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779330_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779277_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779328_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779342_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779361_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707338_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707315_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604160_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707307_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604319_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779362_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779363_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779364_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KX827296_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779354_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604306_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604162_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY902775_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779375_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KX827294_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KX827295_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707328_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707304_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707310_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707300_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707314_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707317_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707330_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU185789_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU185787_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU185788_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439931_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439935_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439933_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439942_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439930_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439937_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439941_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439938_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439939_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439919_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439936_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439932_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439929_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439940_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439928_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439934_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439921_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439915_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439912_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439924_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439923_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439920_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439925_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439917_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439916_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439911_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439926_PreS1_P-A      acgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439918_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439913_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439922_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439914_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JF439927_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JN604302_PreS1_P-A      atgggaggttggtcatcaacacctcgcaaaggcatggggacgaatctttc
JF439821_PreS1_P-A      atgggaggttggacatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477473_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MF772347_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MF772345_PreS1_P-A      atgggaggttggtcctcaaaacctcgcaaaggcatggggacgaatctttc
MF772346_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
MF772344_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MF772350_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749822_PreS1_P-A      atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaatctttc
AF537372_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
GQ477476_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477464_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KC875260_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
GQ477463_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477480_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JN604183_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477502_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JN604305_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtc
KF779320_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477494_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY738142_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY738140_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY738141_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AF143302_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
DQ788728_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP995108_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604236_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477495_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB222707_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB205118_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604227_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GU563551_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477475_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477470_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477478_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477500_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477499_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439842_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475994_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476012_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476013_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476002_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475995_PreS1_P-A      atgggaggttggtcatcaaaaccccgcaaaggcatggggacgaatctttc
KF475984_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476008_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476006_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476005_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476003_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475982_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475985_PreS1_P-A      acgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476014_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476007_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476000_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475999_PreS1_P-A      atgggaggttggtcatcaagacctcgcaaaggcatggggacgaatctttc
KF475996_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475992_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475988_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476010_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476009_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476001_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475998_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475997_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475993_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475991_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475989_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475986_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475983_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475987_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF475990_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476004_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476011_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ586809_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AF536524_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KX827297_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX125368_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477501_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY233286_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779295_PreS1_P-A      atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaatctttc
KY382410_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB116076_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
HE576988_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
HE576989_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY738139_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY738143_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477462_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
AJ627226_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604290_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604298_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477469_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
GQ184324_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439823_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439819_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439827_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439820_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439832_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439826_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439822_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439825_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439828_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439829_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439830_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439831_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AJ627228_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477504_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB126580_PreS1_P-A      atgggagggtggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY034878_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604269_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477497_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477465_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
DQ788725_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
X02763_PreS1_C-A        atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439981_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX125367_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779210_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779211_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KX827293_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859951_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859947_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859948_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859940_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859946_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749829_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749844_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859949_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ184323_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB453982_PreS1_P-A      atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaatctttc
AF090839_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AF090840_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
Z72478_PreS1_P-A        atgggaggttggtcattaaaacctcgcaaaggcatggggacgaatctttc
X70185_PreS1_P-A        atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718087_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779298_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604288_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604266_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439824_PreS1_P-A      atgggaggttggtcatcaagacctcgcaaaggcatggggacgaatctttc
EU859944_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AF143298_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB453983_PreS1_P-A      atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaatctttc
AB362931_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749832_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779272_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU747320_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU594387_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604240_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
GQ477490_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604268_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477484_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859950_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604197_PreS1_P-A      atgggaggtcagtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477468_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707635_PreS1_P-A      atgggaggtttatcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477487_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KY886219_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KX827298_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KT749833_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779314_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779311_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779255_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707628_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707537_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707536_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604172_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477498_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477491_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
GQ477472_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AF537371_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697511_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB263406_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749826_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749842_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749825_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477488_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU594386_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB014370_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779221_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707653_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707652_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707651_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707649_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcagggggacgaatctttc
JQ707647_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707644_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707642_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707643_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707645_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707646_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707650_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707656_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707640_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707638_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707639_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707641_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707648_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707654_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707655_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707561_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707571_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MT426099_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MT426097_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MN507849_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718092_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ843184_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ843172_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779383_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779381_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779370_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779324_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779321_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779319_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779316_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779313_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779284_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779283_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779282_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779262_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779232_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476015_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX096952_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707554_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ687533_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604270_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604214_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439762_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477482_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477466_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
EU859938_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859900_PreS1_P-A      atgggaggttggtcatcaaaacctcgccaaggcatggggacgaatctttc
EU594384_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU414133_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EF208113_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697492_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB480040_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB453984_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779280_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779268_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY862867_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB549213_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779274_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779271_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779281_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY862868_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604173_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779256_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604181_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779213_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779215_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
LC517161_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718095_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718100_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718088_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718090_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718091_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718094_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718096_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718097_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718098_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718099_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718101_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ843182_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ843186_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ843218_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ843217_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779257_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779252_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ687529_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707548_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707551_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707573_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707570_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707563_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707562_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707552_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707560_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779286_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779287_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604276_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
L13994_PreS1_P-A        atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
Z35717_PreS1_P-A        atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MT426098_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MT426094_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718102_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779333_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779322_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779315_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779304_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779297_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779291_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779270_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779266_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779259_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779254_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779253_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779238_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779231_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707634_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707550_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707549_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707547_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707545_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707538_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707532_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707531_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604242_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604194_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GU563555_PreS1_P-A      atgggaggttggtcatcaaaacctcgcagaggcatggggacgaatctttc
GQ477486_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
GQ477479_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477467_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
EU859953_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859945_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859907_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU594393_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU594385_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697506_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB480036_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB300366_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB480039_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB116081_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB116077_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB064314_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749838_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604304_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859943_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU594391_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859932_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859933_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859941_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604204_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749824_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779323_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JQ707564_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439753_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX310723_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707572_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779290_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779294_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707559_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707553_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707558_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779336_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779317_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707540_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707539_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707533_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707542_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707535_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707629_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707625_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707614_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707617_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707622_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707631_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779275_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779344_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779345_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779348_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707615_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707627_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707633_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697488_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697489_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697501_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU086721_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779240_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
LC311241_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
LC311242_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MH932713_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697512_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
OK106253_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MT426095_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
LC458431_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KU605532_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749835_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749831_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749830_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749843_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP274927_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP274925_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KM606746_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KM606742_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ854708_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcttggggacgaatctttc
KJ854709_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcttggggacgaatctttc
KJ843216_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ843188_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ843166_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ843173_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ843215_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779386_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779385_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779379_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779371_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779367_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779366_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779351_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779337_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779334_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779329_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779326_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779347_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779325_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779310_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779279_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779273_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779305_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779306_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779307_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779308_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779258_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779338_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779339_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF779251_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779246_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779247_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779248_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP718093_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX310730_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX310722_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX096953_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707636_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707630_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707616_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707609_PreS1_P-A      atgggaggttggccatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707567_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707568_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707557_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707556_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707544_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707543_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707569_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707541_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707534_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604300_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604294_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604293_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604292_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707610_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707611_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707612_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707613_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707618_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707619_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707620_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707621_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707623_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707624_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707626_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707632_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707637_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ843192_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ843214_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604257_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604247_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604216_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604185_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604180_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604164_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GU563562_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749840_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GU563557_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MT426096_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GU563553_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477503_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604200_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604297_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604315_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779346_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779352_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779373_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477496_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ414522_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX310721_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KM606749_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859937_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859924_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859923_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859921_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU594389_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU594383_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU414132_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY128092_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AM295795_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtc
AM295797_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtc
AJ012207_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KY003230_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB937798_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB775199_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697509_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697495_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB775198_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB775200_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB775201_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB937792_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB937793_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB937794_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604283_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707546_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707555_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707565_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JQ707566_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779243_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779244_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779245_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779299_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779350_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779355_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779360_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779378_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
LC430617_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
LC458430_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
LC592168_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
LC592169_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
LC592170_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697487_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB480041_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB300367_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB246337_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JN604178_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
JN604303_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
MT426093_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
AB116080_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB116078_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604273_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB116079_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB246338_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB453979_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB453980_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB453981_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB480038_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697491_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697496_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697497_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697498_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697499_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697503_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697504_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697505_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697507_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB697508_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AF043580_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU594388_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU594390_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU594392_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU594394_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU594395_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859898_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859899_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859901_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859902_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859903_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859904_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859905_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859906_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859908_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859909_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859910_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859911_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859912_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859913_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859914_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859915_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859916_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859917_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859918_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859919_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859920_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859922_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859925_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859926_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859927_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859928_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859929_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859930_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859931_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859935_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859936_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU859942_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
FJ349224_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GQ477461_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GU563546_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GU563554_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GU563558_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439752_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439754_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439755_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439756_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439757_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439758_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439759_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439760_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439761_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439763_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439764_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439765_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JF439766_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604158_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604184_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604191_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604228_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604262_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604279_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604291_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX310724_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX310725_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX310731_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX310732_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779227_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF779369_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ854710_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KP274928_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749836_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749837_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT749850_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
LC074724_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
LC311243_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
LT992448_PreS1_P-A      atgggaggttggtcctcaaaacctcgaaaaggcatggggacgaatctgtc
MN585097_PreS1_P-A      atgggaggttggctacccaaacctcgcaaaggcatggggacgaatctttc
FN545837_PreS1_P-A      atgggaggttggttgccaaaacctcgcaaaggcatggggacgaatctttc
AY934763_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
LT992441_PreS1_P-A      atgggaggttggtcttcaaaacctcgcaaaggcatggggacgaatctttc
FN545838_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctttc
FN545830_PreS1_P-A      atgggaggttcgttgccaaaacctcgcaaaggcatggggacgaatctttc
AB194950_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctgtc
AM180624_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
AM184125_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctttc
AM184126_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctttc
EU054331_PreS1_C-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctttc
AY934764_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctatc
GQ161813_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctatc
MW567972_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439725_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439728_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439731_PreS1_P-A      aggggaggttggttacccaaacctcgcaaaggcatggggacgaatctttc
JF439720_PreS1_P-A      aggggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439742_PreS1_P-A      aggggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439722_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439739_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439734_PreS1_P-A      aggggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439744_PreS1_P-A      aggggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439727_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439741_PreS1_P-A      atgggaggttggctaccaaaacctcgcaaaggcatggggacgaatctttc
JF439743_PreS1_P-A      atgggaggttggttaccaaaaccgcgcaaaggcatggggacgaatctttc
JF439740_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439748_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439746_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439730_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439726_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439729_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439906_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439898_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439899_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439901_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439910_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439908_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439900_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439724_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439747_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439735_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439737_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439721_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439736_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439896_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439909_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439738_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439903_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439905_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439907_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439904_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439897_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JF439902_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
MW567976_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
MW567975_PreS1_P-A      aagggaggttggttacccaaacctcgcaaaggcatggggacgaatctttc
KM606737_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
MW567973_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
AB194951_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
AB194952_PreS1_P-A      atgggaggtcggttaccaaaacctcgcaaaggcatggggacgaatctttc
MT622525_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
HM363612_PreS1_P-A      atgggaggttggatatcaaaacctcgcaaaggcatggggacgaatctgtc
FJ692554_PreS1_P-A      atgggaggttggatatcaaaacctcgcaatggcatggggacgaatctttc
LC462120_PreS1_P-A      atgggaggttggataggaaaacctcgcaaaggcatggggacgaatctttc
FN545831_PreS1_P-A      atgggaggttggatatcaaaacctcgcaaaggcatggggacgaatctttc
FN545836_PreS1_P-A      atgggaggttggatagcaaaacctcgcaaaggcatggggacgaatctttc
MN544634_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
FN545825_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
HM363613_PreS1_P-A      atgggaggtcggttaccaaaacctcgcaaaggcatggggacgaatctttc
FJ692603_PreS1_P-A      atgggaggtcggayatcaacacctcgcaaaggcatggggacgaatctttc
FJ692595_PreS1_P-A      atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttc
JN604217_PreS1_P-A      atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctgtc
FJ692613_PreS1_P-A      atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttc
FJ692606_PreS1_P-A      atgggaggttggatatcaactcctcgcaaaggcatggggacgaatctttc
FJ692609_PreS1_P-A      atgggaggtcggatatcaacaccccgcaaaggcatggggacgaatctttc
FJ692610_PreS1_P-A      atgggaggtcggatatcaacaccccgcaaaggcatggggacgaatctttc
FJ692611_PreS1_P-A      atgggaggtcggmtatcaacacctcgcaaaggcatggggacgaatctttc
FJ692599_PreS1_P-A      atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttc
FJ692598_PreS1_P-A      atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttc
FJ692608_PreS1_P-A      atgggaggttggatatcaactcctcgcaaaggcatggggacgaatctttc
FJ692593_PreS1_P-A      atgggaggttggatatcagcacctcgcaaaggcatggggacgaatctttc
FJ692605_PreS1_P-A      atgggaggtyggatatcaacacctcgcaaaggcatggggacgaatctttc
FJ692597_PreS1_P-A      atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttc
FJ692607_PreS1_P-A      atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttc
FJ692600_PreS1_P-A      atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttc
FJ692612_PreS1_P-A      atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttc
FJ692602_PreS1_P-A      atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttc
FJ692604_PreS1_P-A      atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttc
FJ692596_PreS1_P-A      atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttc
FJ692601_PreS1_P-A      atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttc
FN545833_PreS1_P-A      atgggaggttcgttaccaaaacctcgcaaaggcatggggacgaatctttc
FN545834_PreS1_P-A      atgggaggtycgttaymaaaacctcgcaaaggcatggggacgaatctttc
FN545840_PreS1_P-A      atgggaggttggttgccaaaacctcgcaaaggcatggggacgaatctttc
MH580627_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
MH580639_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
MH580642_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
MH580643_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
FN545832_PreS1_P-A      atgggaggttggttgccaaaacctcgcaaaggcatggggacgaatctttc
FN545829_PreS1_P-A      atgggaggttggttgccaaaacctcgcaaaggcatggggacgaatctttc
FN545828_PreS1_P-A      atgggaggttggttgccaaaacctcgcaaaggcatggggacgaatctgtc
FN545835_PreS1_P-A      atgggaggttggttgccaaaacctcgcaaaggcatggggacgaatctgtc
MT210034_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KF922431_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AB076679_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
KF922433_PreS1_P-A      atnnnnnnnnnnnnnnnnnnnnntcgcaaaggcatggggacgaatctttc
KF922434_PreS1_P-A      atnnnnnnnnnnnnnnnnnnnnntcgcaaaggcatggggacgaatctttc
FJ692592_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
MK512455_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN604157_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
KP168427_PreS1_P-A      atgggaggttggtcttcaaaacctcgcaaaggcatggggacgaatctttc
MK512462_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
MK512471_PreS1_P-A      atgggaggttcgttaccaaaacctcgcaaaggcatggggacgaatctttc
MK512456_PreS1_P-A      atgggaggttgtacatcaaaacttcgcaaaggcaaggggaagaatgtatt
MT426092_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
MK512475_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT347091_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
KF922429_PreS1_P-A      atgggaggttggtcagcaaaacctcgcaaaggcatggggacgaatctttc
KF922430_PreS1_P-A      atgggaggttggtcagcaaaacctcgcaaaggcatggggacgaatctttc
KJ010777_PreS1_P-A      atgggaggttggtcagcaaaacctcgcaaaggcatggggacgaatctttc
KP168422_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MT426091_PreS1_P-A      atgggaggttggtcatcaacacctcgcaaaggcatggggacgaacctttc
KU605534_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttt
KF476018_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
KU605533_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
MH464825_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
KF476019_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
HM535205_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
KT347092_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
KF476016_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
KF476020_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
AY233274_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
KJ010776_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
KJ010778_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
AY233282_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
MH464812_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
MH464810_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
MH464830_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
MF979146_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
KF922409_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
AY233289_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
AY233285_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
KF476021_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
KF476017_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
KF922407_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
KF922406_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
KF922408_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
MF979144_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
MH464829_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
MH464813_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
MH464814_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
MH464818_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
MH464819_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
MH464821_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
MH464822_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
MH464826_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
MH464827_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
MH464824_PreS1_P-A      atgggaggttggtcagccaagcctcgcaaaggcatggggacgaatctttc
HM535200_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
MF979151_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
AY233283_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
KX648548_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
MH464815_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
KT347088_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
KU605535_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
MH464828_PreS1_P-A      atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttc
AY233275_PreS1_P-A      atgggaggttggtcctcaacacctcgcaaaggcatggggacgaatctttc
AY233281_PreS1_P-A      atgggaggttggtcctcaaaacctcgcaaaggcatggggacgaatctttc
AY233288_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
AM494718_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
AY934773_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
AB076678_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182334_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182319_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182332_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182323_PreS1_P-A      atgggaggttggttaccaaaacctcgcaagggcatggggacgaatctttc
JN182320_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182327_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182324_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182333_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182331_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182328_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182318_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182330_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182326_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182321_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182322_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182325_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
JN182329_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
AY233284_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT347087_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
DQ020002_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
AY934772_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctttc
KP168424_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctgtc
KP168425_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctgtc
MK512472_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
KU736918_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
KU736919_PreS1_P-A      atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttc
FM199974_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
KX357646_PreS1_P-A      atgggaggttggtcttcaaaacctcgcaaaggcatggggacgaatctttc
KP168426_PreS1_P-A      atgggaggttggtcttcaaaacctcgcaaaggcatggggacgaatctttc
AY934766_PreS1_P-A      atgggaggttggtcttcaaaacctcgcaaaggcatggggacgaatctttc
JN604169_PreS1_P-A      atgggaggttggtcttcaaaacctcgcaaaggcatggggacgaatctttc
MK512457_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
KP168423_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX154579_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX154580_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX154581_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JX154582_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MK512464_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MK512465_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
GU563547_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
FM199981_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
FM199976_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
FM199980_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
MK512467_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
FM199977_PreS1_P-A      atgggaggttggrcatcaaaacctcgcaaaggcatggggacgaatctatc
MK512474_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
MK512468_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
MK512470_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
FM199978_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
GU563545_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
GU563548_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
MK512460_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
FM199979_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
MK512473_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
KX357640_PreS1_P-A      atgggaggttggacatcaacacctcgcaaaggcatggggacgaacctttc
MT114170_PreS1_P-A      atgggaggttggtcatcaaaacctcacaaaggcatggggacgaacctttc
AY233290_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MF979149_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MH464817_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF922417_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF922418_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF922419_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF922414_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF922415_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF922416_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF922420_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KF922421_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MT210032_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF922435_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF922437_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF922436_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MF979143_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
MF979153_PreS1_P-A      atgggaggttggtcatcmaaacctcgcaaaggcatggggacgaatctttc
KF476025_PreS1_P-A      atgggaggttggtcatcaaaacctcgcgaaggcatggggacgaatctttc
KF476023_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476026_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476022_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476027_PreS1_P-A      acgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF476024_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KU605536_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KU605537_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KU605538_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KU605539_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT151612_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KT151617_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KF779384_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttc
KT151614_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JN604193_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB116092_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AY373432_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KF214662_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaacctttc
DQ315784_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB116088_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB453986_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AY373429_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KF214666_PreS1_P-A      atgggaggttggacatcaaaacctcgcaaaggcatggggacgaatctttc
KF214659_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MF925373_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KR905426_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KT366467_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KT151615_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KR905429_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KR905425_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KT366466_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ194506_PreS1_P-A      atgggaggttggtcatgaaaacctcgcaaaggcatggggacgaacctttc
AB116082_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB116085_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MF925372_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB116089_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB116087_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KR905427_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KF214665_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JN604252_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JN604156_PreS1_P-A      atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaacctttc
KF214661_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KF214660_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
M57663_PreS1_P-A        atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB241114_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB246335_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MT426088_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KT366471_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AF090842_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KF214663_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
OK274310_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KR905430_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KT366468_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KT366470_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MF925361_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KT366469_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JN604171_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JN604261_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692558_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
EU304331_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
GQ331046_PreS1_P-A      atgggaggttggtcatcaactcctcgcaaaggcatggggacaaatctttc
FJ349296_PreS1_P-A      atgggaggttggacatcaaaacctcgcaaaggcatggggacgaatctttc
FN545826_PreS1_P-A      atgggaggttggacatcaaaacctcgcaaaggcatggggacgaatctttc
EU859952_PreS1_P-A      atgggaggttggtcatcaacacctcgcataggcatggggacgaatctttc
GQ331047_PreS1_P-A      atgggaggttggtcatcaacacctcgcataggcatggggacgaatctttc
JQ023660_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JQ023662_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KX276769_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KF922424_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KF922425_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
HM011485_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JN604155_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB246336_PreS1_P-A      atgggaggttggtcatcaaaacctcacaaaggcatggggacgaacctttc
AB116091_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB453989_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692567_PreS1_P-A      atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaacctttc
AB241115_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaaccttgc
FJ692561_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692576_PreS1_P-A      atgggaggttggtcatcaacacctcgcaaaggcatggggacgaacctttc
JN604241_PreS1_P-A      atgggaggttggtcatccaaacctcgcaaaggcatggggacgaacctttc
FJ692562_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692572_PreS1_P-A      atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaacctttc
KJ854688_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692559_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692578_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692579_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692580_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692581_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692582_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692583_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692584_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692585_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692577_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692571_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692557_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692574_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692563_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JQ023661_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB453988_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB116093_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB116086_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MH464816_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
FJ692591_PreS1_P-A      atgggaggttggwcatcaaaacctcgcaaaggcatggggacgaayctttc
JQ023663_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692565_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692564_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692588_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692590_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KM519452_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KM519453_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY233278_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB937791_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB937796_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KF922426_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KF922427_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KF922428_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB937795_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
LT992440_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604128_PreS1_P-A      atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaatctttc
MH464808_PreS1_P-A      atgggaggttggtcagcaaaacctcgcaaaggcatggggacgaatctttc
EU366129_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KF779332_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
JN604150_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KR139744_PreS1_P-A      atgggaggttggtcagcaaaacctcgcaaaggcatggggacgaatctttc
EF103278_PreS1_P-A      atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaacctttc
JN604251_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JN604186_PreS1_P-A      atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaacctttc
JN604163_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KR139742_PreS1_P-A      atgggaggttggccagcaaaacctcgcaatggcatggggacgaatctttc
MH464809_PreS1_P-A      atgggaggttggccagcaaaacctcgcaatggcatggggacgaatctttc
MH464823_PreS1_P-A      atgggaggttggccagcaaaacctcgsaatggcatggggacgaatctttc
AB116094_PreS1_P-A      atgggaggttggacatcaacacctcgcaaaggcatggggacgaacctttc
MG877723_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MG877725_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692575_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AY233287_PreS1_P-A      atgggaggttggtcaacaaaacctcgcaaaggcatggggacgaatctttc
AY233279_PreS1_P-A      atgggaggttggccagcaaaacctcgcaaaggcatggggacgaatctttc
AY233276_PreS1_P-A      atgggaggttggtcagcaaaacctcgcaaaggcatggggacgaatctttc
MH464820_PreS1_P-A      atgggaggttggtcagcaaaacctcgcaaaggcatggggacgaatctttc
KP168431_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB116083_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MH464811_PreS1_P-A      atgggaggttggtcaacaaaacctcgcaaaggcatggggacgaatctttc
AY373428_PreS1_P-A      atgggaggttggacatcaaaacctcgcaaaggcatggggacgaacctttc
AY161138_PreS1_P-A      atgggaggttggacatcaaaacctcgcaaaggcatggggacgaacctttc
AY161139_PreS1_P-A      atgggaggttggacatcaaaacctcgcaaaggcatggggacgaacctttc
KR139743_PreS1_P-A      atgggaggttggtcagcaaaacctcgcaaaggcatggggacgaatctttc
KJ854701_PreS1_P-A      atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaacctttc
KP168428_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KX357649_PreS1_P-A      atgggaggttggtcatcaacacctcgcaaaggcatggggacgaacctttc
MF925385_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MF925407_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB116084_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MF925362_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KP168432_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MN476102_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JN604136_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KP168429_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KC875254_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MN476101_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KX357647_PreS1_P-A      atgggaggttggtcatcaacacctcgcaaaggcatggggacgaacctttc
KP168434_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AY934771_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MF925368_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctatc
AY934765_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854699_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KF170754_PreS1_P-A      atgggaggttggtcttcaaaacctcgcaaaggcatggggacgaacctttc
KC875259_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854685_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
DQ315786_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JN604230_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KC875252_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
FJ692566_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
LC051141_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AY934768_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AY934767_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
AY934769_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AY934770_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KX357642_PreS1_P-A      atgggaggttggtcatcaactcctcgcaaaggcatggggacgaacctttc
KX357643_PreS1_P-A      atgggaggttggtcatcaactcctcgcaaaggcatggggacgaacctttc
KC875258_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KC875255_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854695_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctgtc
KJ854693_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AB453987_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctgtc
KC875253_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KC875257_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KC875251_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KC875256_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KM606748_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JN604145_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854691_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
DQ020003_PreS1_P-A      atgggaggttggtcagcaaaacctcgcaaaggcatggggacgaatctatc
MF925400_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatc
KX357650_PreS1_P-A      atgggaggttggtcatcaacacctcgcaaaggcatggggacgaacctttc
KX357645_PreS1_P-A      atgggaggttggtcatcaacacctcgcaaaggcatggggacgaacctttc
KP168433_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854706_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ854689_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JN604237_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
JN604260_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854686_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AY934774_PreS1_P-A      ataggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
EU410082_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KU736920_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ843183_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854697_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MN053840_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ854707_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854690_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AY903452_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KP718086_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KP718085_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854700_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854694_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854698_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MF772353_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
MF772351_PreS1_P-A      atgggaggttggtcatcaaaacctcgcacaggcatggggacgaacctttc
KP168430_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854687_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854696_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttc
KJ854703_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854692_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
AF043560_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854702_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854704_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
KJ854705_PreS1_P-A      atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttc
                        *                       *      *   * *    **      

KP168435_PreS1_P-A      caccagcaatcccctgggattttttcccgaccaccagttggatccagctt
JN604218_PreS1_P-A      tgttcccaaycctctgggattctttcccgatcatcagttggaccctgcat
JN604308_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
AB937797_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU185786_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JN604165_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
DQ298161_PreS1_P-A      agttcccaacccgctgggattctttcccgatcatcagttggaccctgcat
DQ298162_PreS1_P-A      agttcccaacccgctgggattctttcccgatcatcagttggaccctgcat
DQ298163_PreS1_P-A      agttcccaacccgctgggattctttcccgatcatcagttggaccctgcat
DQ298164_PreS1_P-A      agttcccaacccgctgggattctttcccgatcatcagttggaccctgcat
DQ298165_PreS1_P-A      agttcccaacccgctgggattctttcccgatcatcagttgggccctgcat
JN604249_PreS1_P-A      tgttcccaaccctctgggattccttcccgatcatcagttggaccctgcat
AJ344115_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477474_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JN604309_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF772348_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604285_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604314_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccygcat
JN604229_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477477_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477493_PreS1_P-A      tgttcccaacccgctgggattctttcccgatcatcagttggaccctgcat
AJ627227_PreS1_P-A      kgtycccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604176_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604220_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AJ309369_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AJ309370_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AJ309371_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439872_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439881_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439877_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439878_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439870_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439869_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439876_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439880_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439875_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439871_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439874_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439879_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439882_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439883_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JF439873_PreS1_P-A      tgttcccaaccctctgggattttttcccgatcatcaattggaccctgcat
JX125364_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707599_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707589_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707576_PreS1_P-A      tgtttccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707608_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707585_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707586_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707592_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707590_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707595_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707604_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707580_PreS1_P-A      tgtttccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707587_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707606_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707581_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707603_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707583_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707575_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707578_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707598_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707593_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707582_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707607_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707605_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707600_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707596_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707577_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707594_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707601_PreS1_P-A      tgttcccaatcctctgggattctttcccggtcatcagttggaccctgcat
JQ707584_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707588_PreS1_P-A      tgtttccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707591_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707597_PreS1_P-A      tgtttccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707602_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707574_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707579_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JF439852_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439867_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439846_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439855_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439850_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439836_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439840_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439843_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439847_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439857_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439841_PreS1_P-A      tgtttccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439859_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439839_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439858_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439860_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439854_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439856_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439853_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439851_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439835_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439837_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439834_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439845_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439848_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439865_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439838_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439833_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439844_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439864_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439849_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439866_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439861_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439868_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439990_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439862_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859934_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439949_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
KP718089_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439988_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439976_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccccgcat
JF439975_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439970_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439961_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccccgcat
JF439958_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439966_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439965_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
KT749834_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749846_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749847_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749849_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749839_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KM519454_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439993_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439992_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439991_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439985_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439983_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439982_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439979_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439978_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggacccagcat
JF439972_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439971_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439953_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439952_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439951_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439943_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
EU859955_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439984_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439977_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439973_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439968_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439960_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439959_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439957_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439955_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439950_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439947_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439944_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
EU859956_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697493_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JF439989_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JQ707664_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439987_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439986_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439969_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439963_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439962_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439956_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439954_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439946_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439945_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439964_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439948_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439967_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439974_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JF439980_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
EU859954_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GU563550_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707676_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707674_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707663_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707658_PreS1_P-A      tgttcacaaccctctgggattctttcccgatcatcagttggaccctgcat
AM295798_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AM295799_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AM410963_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707659_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707661_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707662_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707665_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707667_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707669_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707670_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707672_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707675_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707681_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707318_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY152726_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcaattggaccctgcat
AF090838_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604179_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
X51970_PreS1_P-A        tgttcccaaccctctgggattctttcccgatcatcagttggaccctgtat
JQ707367_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707364_PreS1_P-A      tgttcccaaccctctgggattctttcccgaccatcagttggacccggcat
JQ707349_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggacccggcat
JQ707345_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707370_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707368_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707346_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggacccggcat
JQ707354_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707362_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707348_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707357_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707351_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707347_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707361_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707369_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707366_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707358_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707355_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707356_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707363_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707365_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707353_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707350_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707352_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707359_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707360_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707344_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707380_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggacccggcat
JQ707324_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggacccggcat
JQ707326_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
JQ707319_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707339_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707342_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707333_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707320_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707308_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707299_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707302_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707311_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707341_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY233280_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604209_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AF090841_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
JN604190_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779293_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcaattggaccctgcat
JN604277_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JF440020_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439768_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439769_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439767_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439777_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439774_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779260_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707401_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604188_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707337_PreS1_P-A      tgtccccaaccatctgggattctttcccgatcatcagttggaccctgcat
AM282986_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY707087_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707316_PreS1_P-A      agttcccaaccatctgggattctttcccgatcatcagttggaccctgcat
JN604274_PreS1_P-A      ggttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707325_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707335_PreS1_P-A      tgttcccatccctctgggattctttcccgatcatcagttggaccctgcat
KF779264_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604317_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604307_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859939_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779365_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707340_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604282_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779234_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779265_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707398_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707305_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779263_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707406_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707322_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707331_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779261_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707372_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707309_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707312_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707301_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707419_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707417_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707411_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707414_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707408_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707407_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707415_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707400_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttgggccctgcat
JQ707402_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707403_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707404_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707405_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707409_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707410_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707412_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707413_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707416_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707418_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707420_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707395_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779276_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707397_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707378_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707343_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707334_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707332_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707336_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707329_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707327_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707323_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707321_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707313_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707306_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707303_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604299_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604167_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779372_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779349_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779356_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779239_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779269_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779374_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779358_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779331_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779312_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779359_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707399_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707393_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707391_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707388_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707387_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707386_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707384_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707377_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707375_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707374_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707371_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707373_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707376_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707379_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707381_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707382_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707383_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707385_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707389_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707390_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707392_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707394_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707396_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779249_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779309_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779368_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779335_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779330_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779277_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779328_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779342_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779361_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707338_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707315_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604160_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707307_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604319_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779362_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779363_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779364_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KX827296_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779354_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604306_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604162_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY902775_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779375_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KX827294_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KX827295_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707328_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707304_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707310_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707300_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707314_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707317_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707330_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU185789_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU185787_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU185788_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439931_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439935_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439933_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439942_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439930_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439937_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439941_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439938_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439939_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439919_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439936_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439932_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439929_PreS1_P-A      tattcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439940_PreS1_P-A      tgttcccaaccctctggggttctttcccgatcatcagttggaccctgcat
JF439928_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439934_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439921_PreS1_P-A      tgttcccaaccttctgggattctttcccgatcatcagttggaccccgcat
JF439915_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439912_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439924_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439923_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439920_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439925_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439917_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439916_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439911_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439926_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439918_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439913_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439922_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439914_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439927_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604302_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439821_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477473_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
MF772347_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF772345_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF772346_PreS1_P-A      ggttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF772344_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
MF772350_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749822_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AF537372_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477476_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477464_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KC875260_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477463_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477480_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604183_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
GQ477502_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604305_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779320_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
GQ477494_PreS1_P-A      ggttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY738142_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY738140_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY738141_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AF143302_PreS1_P-A      tgttctcaaccctctgggattctttcccgatcatcagttggaccctgcat
DQ788728_PreS1_P-A      tgttctcaaccctctgggattctttcccgatcatcagttggaccctgcat
KP995108_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604236_PreS1_P-A      tgttcccaacccgctgggattctttcccgatcatcagttggaccctgcat
GQ477495_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
AB222707_PreS1_P-A      cgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB205118_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604227_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GU563551_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
GQ477475_PreS1_P-A      cgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
GQ477470_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477478_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477500_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477499_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439842_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF475994_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476012_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476013_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476002_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475995_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475984_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476008_PreS1_P-A      tgttcccaaccttctgggattctttcccgatcatcagttggacccagcat
KF476006_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476005_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476003_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475982_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475985_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476014_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476007_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476000_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475999_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475996_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475992_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475988_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476010_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476009_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476001_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475998_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475997_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475993_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475991_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475989_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475986_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475983_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475987_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF475990_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476004_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KF476011_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccagcat
KJ586809_PreS1_P-A      tgttcccaaccctctgggattctttcccgaccatcagctggatcctgcat
AF536524_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KX827297_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX125368_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477501_PreS1_P-A      ggttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY233286_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779295_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KY382410_PreS1_P-A      tgttcccaaccctctgggattccttcccgatcatcagttggaccctgcat
AB116076_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
HE576988_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
HE576989_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY738139_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY738143_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477462_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AJ627226_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcaattggaccctgcat
JN604290_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604298_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
GQ477469_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ184324_PreS1_P-A      tgttcccaaccctccgggattctttcccgatcatcagttggaccctgcat
JF439823_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439819_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439827_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439820_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439832_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439826_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439822_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439825_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439828_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439829_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439830_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439831_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AJ627228_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477504_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB126580_PreS1_P-A      tggttccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY034878_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604269_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477497_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477465_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
DQ788725_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
X02763_PreS1_C-A        tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JF439981_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
JX125367_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779210_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779211_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KX827293_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859951_PreS1_P-A      tgttcccaaccctctgggattctttcccaatcatcagttggaccctgcat
EU859947_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859948_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859940_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859946_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749829_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749844_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859949_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ184323_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB453982_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AF090839_PreS1_P-A      ggttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AF090840_PreS1_P-A      ggttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
Z72478_PreS1_P-A        tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
X70185_PreS1_P-A        tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718087_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
KF779298_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604288_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604266_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439824_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859944_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AF143298_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB453983_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB362931_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749832_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779272_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU747320_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU594387_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcaattggaccctgcat
JN604240_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccttgcat
GQ477490_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604268_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477484_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859950_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604197_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477468_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707635_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
GQ477487_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KY886219_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KX827298_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749833_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779314_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779311_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779255_PreS1_P-A      tgttcccaatcctctgggattctttcccgaacatcagttggaccctgcat
JQ707628_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707537_PreS1_P-A      tgtttccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707536_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604172_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477498_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477491_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477472_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AF537371_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697511_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB263406_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749826_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749842_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749825_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477488_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU594386_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB014370_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779221_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcagcacttggaccctgcat
JQ707653_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707652_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707651_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707649_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707647_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707644_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707642_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707643_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707645_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707646_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707650_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707656_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707640_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707638_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707639_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707641_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707648_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707654_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707655_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707561_PreS1_P-A      tgtttccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707571_PreS1_P-A      tgtttccaatcctctgggattctttcccgatcatcagttggaccctgcat
MT426099_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MT426097_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
MN507849_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718092_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843184_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843172_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779383_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779381_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779370_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779324_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779321_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779319_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779316_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779313_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779284_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779283_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779282_PreS1_P-A      ggttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779262_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779232_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF476015_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX096952_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707554_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ687533_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604270_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604214_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439762_PreS1_P-A      tgttcccaaccctctgggattcttttccgatcatcagttggaccctgcat
GQ477482_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477466_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859938_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859900_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU594384_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU414133_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EF208113_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697492_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB480040_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB453984_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779280_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779268_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AY862867_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB549213_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779274_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779271_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779281_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY862868_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604173_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779256_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604181_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779213_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779215_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
LC517161_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718095_PreS1_P-A      tgttcccaaycctctgggattctttcccgatcatcagttggaccctgcat
KP718100_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718088_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718090_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718091_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718094_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718096_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718097_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718098_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718099_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718101_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843182_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843186_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843218_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843217_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779257_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779252_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ687529_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707548_PreS1_P-A      tgtttccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707551_PreS1_P-A      tgtttccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707573_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707570_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707563_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707562_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707552_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707560_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779286_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779287_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604276_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
L13994_PreS1_P-A        tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
Z35717_PreS1_P-A        tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MT426098_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MT426094_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718102_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779333_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779322_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779315_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779304_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779297_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779291_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779270_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779266_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779259_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779254_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779253_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779238_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779231_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707634_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707550_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707549_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707547_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707545_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707538_PreS1_P-A      tgttcccaatcctctgggattccttcccgatcatcagttggaccctgcat
JQ707532_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707531_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604242_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604194_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GU563555_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477486_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477479_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477467_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859953_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859945_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859907_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU594393_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU594385_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697506_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB480036_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB300366_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB480039_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116081_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116077_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB064314_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749838_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604304_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859943_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU594391_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859932_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859933_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859941_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604204_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749824_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779323_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707564_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JF439753_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX310723_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707572_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779290_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779294_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707559_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707553_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707558_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779336_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779317_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707540_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707539_PreS1_P-A      tgtttccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707533_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707542_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707535_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707629_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707625_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707614_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707617_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707622_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707631_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779275_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779344_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779345_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779348_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707615_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707627_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707633_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AB697488_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697489_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697501_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU086721_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779240_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
LC311241_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
LC311242_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH932713_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697512_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
OK106253_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MT426095_PreS1_P-A      tgttcccaaccctctgggattccttcccgatcatcagttggaccctgcat
LC458431_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KU605532_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749835_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749831_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749830_PreS1_P-A      tgttcccaaccctctgggattccttcccgatcatcagttggaccctgcat
KT749843_PreS1_P-A      tgttcccaaccctctgggattccttcccgatcatcagttggaccctgcat
KP274927_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP274925_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KM606746_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KM606742_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854708_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854709_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843216_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843188_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843166_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843173_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843215_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779386_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779385_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779379_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779371_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779367_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779366_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779351_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779337_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779334_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779329_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779326_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779347_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779325_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779310_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779279_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779273_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779305_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779306_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779307_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779308_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779258_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779338_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779339_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779251_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779246_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779247_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779248_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718093_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX310730_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX310722_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX096953_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttgggccctgcat
JQ707636_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707630_PreS1_P-A      tgttcccaaacctctgggattctttcccgatcatcagttggaccctgcat
JQ707616_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707609_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707567_PreS1_P-A      tgtttccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707568_PreS1_P-A      tgtttccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707557_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707556_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707544_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707543_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707569_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707541_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707534_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604300_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604294_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604293_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604292_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707610_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707611_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707612_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707613_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707618_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707619_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707620_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707621_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707623_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707624_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707626_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707632_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ707637_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843192_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843214_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604257_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604247_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604216_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604185_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604180_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604164_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GU563562_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749840_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GU563557_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MT426096_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GU563553_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477503_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604200_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604297_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604315_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779346_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779352_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779373_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477496_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ414522_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX310721_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KM606749_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859937_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859924_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859923_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859921_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU594389_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU594383_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU414132_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY128092_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AM295795_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AM295797_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AJ012207_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KY003230_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB937798_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB775199_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AB697509_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697495_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AB775198_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AB775200_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AB775201_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AB937792_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AB937793_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AB937794_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604283_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707546_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707555_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707565_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JQ707566_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779243_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779244_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779245_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779299_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779350_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779355_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779360_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779378_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
LC430617_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
LC458430_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
LC592168_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
LC592169_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
LC592170_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AB697487_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB480041_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB300367_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB246337_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604178_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604303_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MT426093_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116080_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116078_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604273_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116079_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB246338_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB453979_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB453980_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB453981_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB480038_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697491_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697496_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697497_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697498_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697499_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697503_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697504_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697505_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697507_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB697508_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AF043580_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU594388_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU594390_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU594392_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU594394_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU594395_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859898_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859899_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859901_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859902_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859903_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859904_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859905_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859906_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859908_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859909_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859910_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859911_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859912_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859913_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859914_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859915_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859916_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859917_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859918_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859919_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859920_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859922_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859925_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859926_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859927_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859928_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859929_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859930_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859931_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859935_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859936_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859942_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ349224_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ477461_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GU563546_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GU563554_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GU563558_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439752_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439754_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439755_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439756_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439757_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439758_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439759_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439760_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439761_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439763_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439764_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439765_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439766_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604158_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604184_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604191_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604228_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604262_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604279_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604291_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX310724_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX310725_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX310731_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX310732_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779227_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF779369_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854710_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP274928_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749836_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749837_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT749850_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
LC074724_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
LC311243_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
LT992448_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
MN585097_PreS1_P-A      agttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FN545837_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggatccagcat
AY934763_PreS1_P-A      tgttcccaaccctctgggattctttcccgaacatcagttggaccctgcat
LT992441_PreS1_P-A      tgttcccaaccctctgggattccttcccgatcatcagttggaccctgcat
FN545838_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
FN545830_PreS1_P-A      tgttccaaaccctctgggattctttcccgatcatcagttggaccctgcat
AB194950_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AM180624_PreS1_P-A      tgttcccaaycctctgggattctttcccgatcatcagttggaccctgcat
AM184125_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AM184126_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
EU054331_PreS1_C-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AY934764_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ161813_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MW567972_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439725_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439728_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439731_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439720_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439742_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439722_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439739_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439734_PreS1_P-A      tgttcccaaccctctggcattctttcccgatcatcagttggaccctgcat
JF439744_PreS1_P-A      tgttcccaaccctctggcattctttcccgatcatcagttggaccctgcat
JF439727_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439741_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439743_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439740_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439748_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439746_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439730_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439726_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439729_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439906_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439898_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439899_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439901_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439910_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439908_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439900_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439724_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439747_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439735_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439737_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439721_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439736_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439896_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439909_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439738_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439903_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439905_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439907_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439904_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439897_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JF439902_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MW567976_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
MW567975_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KM606737_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MW567973_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB194951_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB194952_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MT622525_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
HM363612_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
FJ692554_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
LC462120_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FN545831_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FN545836_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MN544634_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FN545825_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
HM363613_PreS1_P-A      tgttcccaaccctctgggattctttcccgatctcaatttggaccctgcat
FJ692603_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccygcat
FJ692595_PreS1_P-A      tgttcccaaycctctgggattcyttcccgatcatcagttggaccctgcat
JN604217_PreS1_P-A      tgttcccaaycctctgggattctttcccgaycatcagttggaccctgcat
FJ692613_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
FJ692606_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692609_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692610_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692611_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692599_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
FJ692598_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692608_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692593_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692605_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692597_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692607_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692600_PreS1_P-A      kgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692612_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692602_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692604_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcaattggaccctgcat
FJ692596_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692601_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FN545833_PreS1_P-A      tgtgcccaaccctctgggattttttcccgatcatcagttggaccctgcat
FN545834_PreS1_P-A      tgtgcccaaccctctgggattttttcccgatcatcagttggaccctgcat
FN545840_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
MH580627_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH580639_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH580642_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH580643_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FN545832_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FN545829_PreS1_P-A      ggttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FN545828_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
FN545835_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MT210034_PreS1_P-A      tgttccnaaccctctgggattctttcccgatcatcagttggaccccgcat
KF922431_PreS1_P-A      tgttccaaaccccctggggttctttcccgatcatcagttggaccctgcat
AB076679_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF922433_PreS1_P-A      tgttcccaaccctctgggattccttcccgatcatcagctggaccctgcat
KF922434_PreS1_P-A      tgttcccaaccctctgggattccttcccgatcatcagctggaccctgcat
FJ692592_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MK512455_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604157_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcaattggaccctgcat
KP168427_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
MK512462_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
MK512471_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
MK512456_PreS1_P-A      tgttcccaaccctatgggattctttcccgatcttcagttggaccaggcat
MT426092_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
MK512475_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT347091_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF922429_PreS1_P-A      tgttccaaaccccctggggttctttcccgatcatcagttggaccctgcat
KF922430_PreS1_P-A      tgttccaaaccccctggggttctttcccgatcatcagttggaccctgcat
KJ010777_PreS1_P-A      tgttccaaaccccctggggttctttcccgatcatcagttggaccctgcat
KP168422_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MT426091_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KU605534_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF476018_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KU605533_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464825_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF476019_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
HM535205_PreS1_P-A      tgttcccaaccctctgggattctttcccgctcatcagttggaccctgcat
KT347092_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF476016_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF476020_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY233274_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ010776_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ010778_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY233282_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464812_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464810_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464830_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF979146_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF922409_PreS1_P-A      tgttcccaaccccctggggttctttcccgatcatcagttggaccctgcat
AY233289_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY233285_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF476021_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF476017_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF922407_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
KF922406_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF922408_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF979144_PreS1_P-A      ggttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464829_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464813_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464814_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464818_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464819_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464821_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464822_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464826_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464827_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464824_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
HM535200_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF979151_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY233283_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KX648548_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464815_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT347088_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KU605535_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464828_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY233275_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY233281_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AY233288_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
AM494718_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY934773_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB076678_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182334_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182319_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182332_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182323_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182320_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182327_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcaccagttggaccctgcat
JN182324_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182333_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182331_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182328_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182318_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182330_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182326_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182321_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182322_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182325_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN182329_PreS1_P-A      tgtccccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY233284_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT347087_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
DQ020002_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY934772_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KP168424_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KP168425_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
MK512472_PreS1_P-A      tgttcccaacccgctgggattctttcccgatcatcagttggaccctgcat
KU736918_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KU736919_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FM199974_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KX357646_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP168426_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY934766_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604169_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MK512457_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP168423_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX154579_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX154580_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX154581_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JX154582_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MK512464_PreS1_P-A      ggttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MK512465_PreS1_P-A      tgttcccaaccccctgggattctttcccgatcatcagttggaccctgcat
GU563547_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccccgcat
FM199981_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcaattggaccctgcat
FM199976_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
FM199980_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MK512467_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggacccggcat
FM199977_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcaattggaccctgcat
MK512474_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MK512468_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MK512470_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FM199978_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GU563545_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GU563548_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MK512460_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FM199979_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MK512473_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KX357640_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MT114170_PreS1_P-A      tgtgcccaatcctctgggattctttcccgatcatcagttggacccagcat
AY233290_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
MF979149_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcagttggaccctgcat
MH464817_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
KF922417_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcagttggaccctgcat
KF922418_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcagttggaccctgcat
KF922419_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcagttggaccctgcat
KF922414_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcagttggaccctgcat
KF922415_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcagttggaccctgcat
KF922416_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcagttggaccctgcat
KF922420_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcagttggaccctgcat
KF922421_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcagttggaccctgcat
MT210032_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
KF922435_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcagttggaccctgcat
KF922437_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcagttggaccctgcat
KF922436_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcagttggaccctgcat
MF979143_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
MF979153_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
KF476025_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
KF476023_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
KF476026_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
KF476022_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
KF476027_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
KF476024_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
KU605536_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
KU605537_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
KU605538_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
KU605539_PreS1_P-A      tgttccaaaccctctgggattccttcccgatcatcaactggaccctgcat
KT151612_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KT151617_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779384_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KT151614_PreS1_P-A      tgttcccaacccgctgggattctttcccgatcatcagttggacccagcat
JN604193_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116092_PreS1_P-A      tgttcccaacccgctgggattctttcccgatcatcagttggaccctgcat
AY373432_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF214662_PreS1_P-A      tgttcccaatccgctgggattctttcccgatcatcagttggaccctgcat
DQ315784_PreS1_P-A      tgttccaaatcctctgggattctttcccgatcatcagttggaccctgcat
AB116088_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
AB453986_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY373429_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF214666_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF214659_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF925373_PreS1_P-A      tgttcccaacccgctgggattctttcccgatcatcagttggaccctgcat
KR905426_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT366467_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT151615_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KR905429_PreS1_P-A      ggttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KR905425_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KT366466_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KJ194506_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AB116082_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116085_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF925372_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116089_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116087_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KR905427_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF214665_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604252_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604156_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF214661_PreS1_P-A      tgttcccaacccgctgggattctttcccgatcatcagttggaccctgcat
KF214660_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
M57663_PreS1_P-A        tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB241114_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB246335_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MT426088_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
KT366471_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AF090842_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF214663_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcaccagttggaccctgcat
OK274310_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KR905430_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT366468_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT366470_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF925361_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KT366469_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604171_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604261_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692558_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU304331_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
GQ331046_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ349296_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FN545826_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU859952_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
GQ331047_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ023660_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ023662_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KX276769_PreS1_P-A      tgttcccaacccgctgggattctttcccgatcatcagttggaccctgcat
KF922424_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF922425_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
HM011485_PreS1_P-A      tgttcccaacccgctgggattctttcccgatcatcagttggaccctgcat
JN604155_PreS1_P-A      tgttcccaaycckctgggattctttcccgatcatcagttggaccctgcat
AB246336_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AB116091_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
AB453989_PreS1_P-A      tgttcccaacccgctgggattcttccccgatcatcagttggaccctgcat
FJ692567_PreS1_P-A      tgttcccaaycctctgggattctttcccgatcatcagttggaccctgcat
AB241115_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692561_PreS1_P-A      tgttcccaaycctctgggattctttcccgatcatcagttggaccctgcat
FJ692576_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604241_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
FJ692562_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692572_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854688_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692559_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcaattggaccccgcat
FJ692578_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
FJ692579_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
FJ692580_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
FJ692581_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
FJ692582_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
FJ692583_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
FJ692584_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
FJ692585_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
FJ692577_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692571_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692557_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692574_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692563_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ023661_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB453988_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116093_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116086_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcaattggaccctgcat
MH464816_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692591_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JQ023663_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692565_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692564_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692588_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692590_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KM519452_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KM519453_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY233278_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB937791_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB937796_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF922426_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF922427_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KF922428_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB937795_PreS1_P-A      cgttcccaaccctctgggattctttcccgrtcatcagttggaccctgcat
LT992440_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604128_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464808_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU366129_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KF779332_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
JN604150_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KR139744_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EF103278_PreS1_P-A      tgttcccaaccctctgggatactttcccgatcatcagttggaccctgcat
JN604251_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcaattggaccctgcat
JN604186_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604163_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KR139742_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464809_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464823_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116094_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MG877723_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
MG877725_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
FJ692575_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccccgcat
AY233287_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY233279_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY233276_PreS1_P-A      tgttcccaaccccctgggattctttcccgatcatcagttggaccctgcat
MH464820_PreS1_P-A      tgttcccaaccccctgggattctttcccgatcatcagttggaccctgcat
KP168431_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116083_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MH464811_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY373428_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY161138_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY161139_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KR139743_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854701_PreS1_P-A      ggttcccaaccctctgggattctttcccgatcatcagttggatcccgcat
KP168428_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggacccggcat
KX357649_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF925385_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF925407_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AB116084_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
MF925362_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP168432_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MN476102_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604136_PreS1_P-A      tgttcccaaycctctgggattcyttcccgatcatcagttggaccctgcat
KP168429_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KC875254_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MN476101_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KX357647_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggaccctgcat
KP168434_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY934771_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
MF925368_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY934765_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854699_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
KF170754_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KC875259_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854685_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
DQ315786_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604230_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KC875252_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
FJ692566_PreS1_P-A      tgttcccaaccctctgggattccttcccgatcatcagttggaccctgcat
LC051141_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY934768_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY934767_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY934769_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AY934770_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KX357642_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KX357643_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KC875258_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KC875255_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854695_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
KJ854693_PreS1_P-A      tgttcccaaccctctgggattcttccccgatcatcagttggatccagcat
AB453987_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KC875253_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KC875257_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KC875251_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KC875256_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KM606748_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
JN604145_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854691_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
DQ020003_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF925400_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KX357650_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KX357645_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP168433_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854706_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854689_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604237_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
JN604260_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854686_PreS1_P-A      tgtcccaaaccctctgggattctttcccgatcatcagttggaccctgcat
AY934774_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
EU410082_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KU736920_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ843183_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KJ854697_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MN053840_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854707_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
KJ854690_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
AY903452_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP718086_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
KP718085_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
KJ854700_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
KJ854694_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
KJ854698_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggatcctgcat
MF772353_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
MF772351_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KP168430_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854687_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854696_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854703_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854692_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
AF043560_PreS1_P-A      tgttcccaatcctctgggattctttcccgatcatcagttggaccctgcat
KJ854702_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854704_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
KJ854705_PreS1_P-A      tgttcccaaccctctgggattctttcccgatcatcagttggaccctgcat
                               *  *    **  *   *  **   *   *  ***  *  *  *

KP168435_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccaacaaggac
JN604218_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccawcaagrac
JN604308_PreS1_P-A      tcggagccaactcaaacaatccagattgggatttcaaccccatcaaggac
AB937797_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
EU185786_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaatcccatcaaggac
JN604165_PreS1_P-A      tcggagccaaytcaaacaatccagattgggacttcaaccccatcaaggac
DQ298161_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
DQ298162_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
DQ298163_PreS1_P-A      tcggagccaactcaaacaatccagattgggatttcaaccccatcaaggac
DQ298164_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaagaac
DQ298165_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
JN604249_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
AJ344115_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
GQ477474_PreS1_P-A      tcggagccaactcaaacaatccggattgggacttcaaccccatcaaggac
JN604309_PreS1_P-A      tcggagccaactcaaacaacccagattgggatttcaaccccatcaaggat
MF772348_PreS1_P-A      tcggagccaactcaaacaatcaagattgggacttcaaccccatcaaggat
JN604285_PreS1_P-A      tcggagccaactcaaacaatccagattgggacytcaaccccatcaaggay
JN604314_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
JN604229_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
GQ477477_PreS1_P-A      tcggagccaactcaaacaatcccgattgggacttcaaccccatcaaggac
GQ477493_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccctcaaggac
AJ627227_PreS1_P-A      tcggagccaactcaaacaacccagattgggacttcaatcccatcaaggac
JN604176_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
JN604220_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
AJ309369_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
AJ309370_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
AJ309371_PreS1_P-A      tcgaagccaactcaaacaatccagattgggacttcaaccccatcaaggac
JF439872_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
JF439881_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
JF439877_PreS1_P-A      tcggagccaactcaaacaatccagattgggacttcaaccccatcaaggac
JF439878_PreS1_P-A      tcggagccaactcaaa