HBVdb

Dataset for nucleotide sequence PreS1 of genotype A

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*                       *      *   * *    **             *  *    **  *   *  **  
ATGGGAGGTTGGTCAtCaAAACCTCGCAAAGGCATGGGGACGAAtCTTTCTGTTCCCAAcCCTCTGGGATTCTTTCCCGA
            at c c cg                       c  a     c  a  t  g        tc     
               g g                             g                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *   *  ***  *  *  **    *   *  *   *      **  ** *     *                **     
TCATCAGTTGGACCCTGCATTCGGAGCCAAcTCAAACAATCCAGATTGGGACTTCAACCCCATCAAGGACCACTGGCCAg
      ac    t  g                        g              a gc   a  t         c
               a                                                               a
               c                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
            *       *         * **       *   *  *    **     *    *            * 
cAGCCAAcCAGGTAGGAGTGGGAGCATTCGGGCCAGGGcTCACcCCtCCACACGGcGGTaTTTTGGGGTGGAGCCCTCAG
a      t                    t  c      t    t         a   g  c                 
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                          *        *                            
GCTCAGGGCATATTGaCcACAGTGtCAaCAaTTCCTCCTCCTGCCTCCACCAATCGGCAGTCAGGAAGGCAGCCTACTCC
          cgc  g tcatt  c ggt g g     ca        g          ac       a     c  a  
                 a                                          a                   
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CATCTCTCCACCTCTAAG------AGACAGTCATCCTCAGGCCATGCAGTGGAATTCCACtGCcTTCCACCAAGCTCTGC
   t           g              c           agca       cc     aa t  t      a g  aa
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                *  **    * *  *              **  * *      *     
AgGATCCCAGAGTCAGGGGtCTGTATtTTCCTGCTGGTGGCTCCAGTTCAGGAACAgTaAACCCTGcTCCgAATATTGCC
ta  c   cag    a   c      c c                         t c c       t  aa c  c  ta
                                                        t                       
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * *   *        *       *   * *  *   *          **  *       **       *      * 
TCTCACATCTCGTCAATCTCCgCGAGGACTGGGGACCCTGtgaCGAACATGGAGAACATCACATCAGGATTCCTAGGACC
        a       c    t   c  t           cacta c                      c     a    
                                         tt                                     
                                          g                                     

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  *     * **  * *   *     * **    ** * ***      *     **        *  *         *
CCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTT
                          c                           a                         
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   **                     *  *     ** * *  *****    *** *    *** * ** **  **    
CTCTCAATTTTCTAGGGGGatCACCCGTGTGTCTTGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCC
      g           acc ta       g                                              
                   gg                                                           
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *        **  * * *  *    * *      *   * ** *  **    ** ** ** *** *    ** ***
TGTCCTCCAATTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATATTCCTCTTCATCCTGC---TGCTATG
          c         c     t                                                     
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *             *        *           *                          *                
CCTCATCTTCTTATTGGTTCTTCTGGATTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCa------ACAA
            g     a  g     c gc  g                                   c      g   
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *                * **        *  *     *   ***     *  ** *     **       
CAACCAGTACGGGACCaTGCAAAACCTGCACGACTCCTGCTCAAGGCAACTCTATGTTTCCCTCATGTTGCTGTACAAAA
 c     c      a c    gg                         c       a       c     t     c   
                                                                                
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  **  *  *   ****           ***      *  **  *  *  **  * * ******  *  * *  ** 
CCTACGGAtGGAAATTGCACCTGTATTCCCATCCCATCgTCcTGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGT
    t  cc         t                 a                 t                  c
                                                                                
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*    **      * ** *   *  * *   *     * **  *    *         * *        *  *  *   *
CCGTTTCTCtTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGcTA
         a                                     c   c              c       t  t  
         c                                                                      
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     * * *    *     *  *     *                                                  
TaTGGATGATGTGGTAtTGGGGGCCAAGTCTGTACAgCATCgTGAGtCCCTTTATACCGCTGTTACCAATTTTCTTTTGT
 g        a t   c          aa   ct  a  c t    g                   t         a t 
          t c                                                                   
                                                                                

      1210        
....:....|....:...
                  
CTcTGGGTATACATTTAA
  t    c      c   
                  
                  
© 1998-2020Legal notice