HBVdb

Dataset for nucleotide sequence C of genotype all

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
ATG------------------------------------GA------------------------------------CAT
   gatagaacaactttgccatatggcctttttggctta                                         
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TGACCCgTATAAAGAATTT--GGAGCTtCTGT-----------GGAGTTACTCTC------tTTTTTGCCTTCTGACTTC
c  taat                   aa c c              a  g           g         gac  t  t
      a                                                      a         a g      
      c                                                                c        

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TTTCCtT--CtaTtcGaGATCTcCTcGAcACCGCCTCaG-----CTCTgTATCGGGAgGCC-----TTAGAGTCTCCgGA
 ac  ga  aag aa g  c  t  a  t  a  ta t       ct actca a  at t     c g  a  at t  
     a    c  c  t     a  t     t  ag c          c        t  a             c  a  
          g  g        g                                                         

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
aCATTGtTCACCTCACCATACaGCACTCAGGCAAGCtATTcTgTGtTGGGGtGAgtTgATGA---aTCTaGCc----ACC
g     ca ggaga t  c  t  ta a        cg cg t  c    tg  ac a   t   cct g  t    t  
t        t  c        g              a  at c        a  cg                a       
         c           c                    a           t                         

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TGGGTGGGaag-------------------TAATTTGGAAGAtCCAgCATCcAGGGAatTAGTAGTcagcTATGTcAAtg
        tga                   a  c  ac c  c atattg tc a  cccga g  agat     t  ca
        c t                   c        g     g     a     tg    t  t             
          c                                                                     

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
tT-AAtATGGGccT---------------AAAaaTcAGaC---AAcT-AtTGTGGTTTCAcATtTCcTGtCTtACTTTTG
c  c cg    tt                g  gt t  g      t  cc a     c  tg a  t  ca c  c  c 
           aa                    c           a  g              c           g    
                                                t                               

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
GaAGAGAaACtGTtcTtGAgTATTTGGTgTCTTTtGGAGTGTGGATTCGCACTCCTcCtGCtTAtAGACCACCAAATGCC
 g a c ggtg  ca a  a        c  c  c                 a  caaac a  c      tat      
       t  a  at c           a                          agtc  c                  
       c  c  gg             t                             g                     

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CCTATCTTATCAACACTTCCGGAaACTACTGTTGTTA------GA------CGA------cg---------AG------G
      c    c  g        g a gg    a                 ta       a-ggaccg    t       
                           t                       g        - a   a             
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CAGGTCCCCT---AGAAGAAGAACTCCCTCGCCTCGCAGACGAAGgTCTCAATCGCCGCGTCGC-------------AGA
    a        c                a           c  a        a                      c  
                                                                                
                                                                                

       730       740       750       760 
....:....|....:....|....:....|....:....|.
                                         
AGATCTCAATCTCGGG---a---ATCtCA-ATGTTAG----
   a  ac     ca    c   tc ct      --a    
      g            g   c            -    
                                         
© 1998-2020Legal notice