HBVdb

Dataset for nucleotide sequence SP of genotype all

[Download (right click)] [Alignment] [Repertoires]

9775 sequence(s)

>gnl|hbvcds|AB014370_SP_P-A Feature FT:CDS AB014370_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11D11HCC). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB064314_SP_P-A Feature FT:CDS AB064314_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggttccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB076678_SP_P-A Feature FT:CDS AB076678_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala14). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB076679_SP_P-A Feature FT:CDS AB076679_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala35). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagagaccgaggcgggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116076_SP_P-A Feature FT:CDS AB116076_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA1911). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgcttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116077_SP_P-A Feature FT:CDS AB116077_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA2126). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcatgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116078_SP_P-A Feature FT:CDS AB116078_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA712). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116079_SP_P-A Feature FT:CDS AB116079_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116080_SP_P-A Feature FT:CDS AB116080_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116081_SP_P-A Feature FT:CDS AB116081_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116082_SP_P-A Feature FT:CDS AB116082_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116083_SP_P-A Feature FT:CDS AB116083_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN36). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116084_SP_P-A Feature FT:CDS AB116084_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN81). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgcgaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116085_SP_P-A Feature FT:CDS AB116085_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN83). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccttgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116086_SP_P-A Feature FT:CDS AB116086_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND18). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116087_SP_P-A Feature FT:CDS AB116087_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND8). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgagtccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116088_SP_P-A Feature FT:CDS AB116088_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP30). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116089_SP_P-A Feature FT:CDS AB116089_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP39). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcgaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116090_SP_P-A Feature FT:CDS AB116090_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP40). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116091_SP_P-A Feature FT:CDS AB116091_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagcacgggaacctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116092_SP_P-A Feature FT:CDS AB116092_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH20). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaagggaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttggggtttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttgtctcagtttactag
>gnl|hbvcds|AB116093_SP_P-A Feature FT:CDS AB116093_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH25). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB116094_SP_P-A Feature FT:CDS AB116094_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaacctgcagaacctgcacgactcctgctcaaggcaactctacgtttccctcatgttgctgtacaaaaccta
cgggtggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB126580_SP_P-A Feature FT:CDS AB126580_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-RU204). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB194950_SP_P-A Feature FT:CDS AB194950_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR983). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|AB194951_SP_P-A Feature FT:CDS AB194951_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR82). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|AB194952_SP_P-A Feature FT:CDS AB194952_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR711). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|AB205118_SP_P-A Feature FT:CDS AB205118_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TJ1-1-2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaacaactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaccaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB222707_SP_P-A Feature FT:CDS AB222707_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate UZTBV102). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB241114_SP_P-A Feature FT:CDS AB241114_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhHCC01). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB241115_SP_P-A Feature FT:CDS AB241115_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhCH09). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB246317_SP_P-A Feature FT:CDS AB246317_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate TA112). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaggacctgcacaactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB246335_SP_P-A Feature FT:CDS AB246335_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB246336_SP_P-A Feature FT:CDS AB246336_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB246337_SP_P-A Feature FT:CDS AB246337_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB246338_SP_P-A Feature FT:CDS AB246338_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB300366_SP_P-A Feature FT:CDS AB300366_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient8). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB300367_SP_P-A Feature FT:CDS AB300367_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient9). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB362931_SP_P-A Feature FT:CDS AB362931_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB453979_SP_P-A Feature FT:CDS AB453979_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB453980_SP_P-A Feature FT:CDS AB453980_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB453981_SP_P-A Feature FT:CDS AB453981_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB453982_SP_P-A Feature FT:CDS AB453982_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB453983_SP_P-A Feature FT:CDS AB453983_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH5). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB453984_SP_P-A Feature FT:CDS AB453984_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH6). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB453986_SP_P-A Feature FT:CDS AB453986_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH8). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB453987_SP_P-A Feature FT:CDS AB453987_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH9). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB453988_SP_P-A Feature FT:CDS AB453988_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH10). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB453989_SP_P-A Feature FT:CDS AB453989_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH11). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgataccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB480036_SP_P-A Feature FT:CDS AB480036_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB480038_SP_P-A Feature FT:CDS AB480038_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB480039_SP_P-A Feature FT:CDS AB480039_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB480040_SP_P-A Feature FT:CDS AB480040_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB480041_SP_P-A Feature FT:CDS AB480041_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB549213_SP_P-A Feature FT:CDS AB549213_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697487_SP_P-A Feature FT:CDS AB697487_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697488_SP_P-A Feature FT:CDS AB697488_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697489_SP_P-A Feature FT:CDS AB697489_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697491_SP_P-A Feature FT:CDS AB697491_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No6). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagargaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697492_SP_P-A Feature FT:CDS AB697492_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No7). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697493_SP_P-A Feature FT:CDS AB697493_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No8). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|AB697495_SP_P-A Feature FT:CDS AB697495_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No10). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697496_SP_P-A Feature FT:CDS AB697496_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No11). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697497_SP_P-A Feature FT:CDS AB697497_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No14). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697498_SP_P-A Feature FT:CDS AB697498_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No15). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697499_SP_P-A Feature FT:CDS AB697499_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No16). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697501_SP_P-A Feature FT:CDS AB697501_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No19). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697503_SP_P-A Feature FT:CDS AB697503_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No22). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697504_SP_P-A Feature FT:CDS AB697504_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No23). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697505_SP_P-A Feature FT:CDS AB697505_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No25). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697506_SP_P-A Feature FT:CDS AB697506_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697507_SP_P-A Feature FT:CDS AB697507_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No29). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697508_SP_P-A Feature FT:CDS AB697508_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No31). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697509_SP_P-A Feature FT:CDS AB697509_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No32). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697511_SP_P-A Feature FT:CDS AB697511_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No36). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgttaccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB697512_SP_P-A Feature FT:CDS AB697512_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No37). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB775198_SP_P-A Feature FT:CDS AB775198_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0707). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB775199_SP_P-A Feature FT:CDS AB775199_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0708). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB775200_SP_P-A Feature FT:CDS AB775200_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0925). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB775201_SP_P-A Feature FT:CDS AB775201_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0929). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB937791_SP_P-A Feature FT:CDS AB937791_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB05-0890). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB937792_SP_P-A Feature FT:CDS AB937792_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1205). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB937793_SP_P-A Feature FT:CDS AB937793_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0302). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB937794_SP_P-A Feature FT:CDS AB937794_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0666). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB937795_SP_P-A Feature FT:CDS AB937795_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1191). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatrtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB937796_SP_P-A Feature FT:CDS AB937796_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1196). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB937797_SP_P-A Feature FT:CDS AB937797_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1204). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacgamgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgatcaacakcaaa
cartacgggasgrtgcaaaayctgcacgaytcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB937798_SP_P-A Feature FT:CDS AB937798_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB14-0383). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcgaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF043560_SP_P-A Feature FT:CDS AF043560_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF043580_SP_P-A Feature FT:CDS AF043580_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF090838_SP_P-A Feature FT:CDS AF090838_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF090839_SP_P-A Feature FT:CDS AF090839_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF090840_SP_P-A Feature FT:CDS AF090840_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF090841_SP_P-A Feature FT:CDS AF090841_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF090842_SP_P-A Feature FT:CDS AF090842_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF143298_SP_P-A Feature FT:CDS AF143298_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacaattccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgttgccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF143302_SP_P-A Feature FT:CDS AF143302_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacctccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatttcgggaatctcaatgatcaacaacaac
cagtacgggaccgtgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF297621_SP_P-A Feature FT:CDS AF297621_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 78). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF297622_SP_P-A Feature FT:CDS AF297622_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 79). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF297623_SP_P-A Feature FT:CDS AF297623_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 83). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgccgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF297624_SP_P-A Feature FT:CDS AF297624_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 80). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF297625_SP_P-A Feature FT:CDS AF297625_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 84). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF536524_SP_P-A Feature FT:CDS AF536524_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF537371_SP_P-A Feature FT:CDS AF537371_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgatcaacaacaac
cagtacggaaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AF537372_SP_P-A Feature FT:CDS AF537372_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagatgtcggggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcaacgacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AJ012207_SP_P-A Feature FT:CDS AJ012207_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AJ309369_SP_P-A Feature FT:CDS AJ309369_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cggtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AJ309370_SP_P-A Feature FT:CDS AJ309370_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaacc
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AJ309371_SP_P-A Feature FT:CDS AJ309371_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AJ344115_SP_P-A Feature FT:CDS AJ344115_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBsAg negative patient X27). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcatcacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaac
cagtacgggatcatgcaaaacctgcacgattcctgctcgcggcaaatctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaagctacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AJ627226_SP_P-A Feature FT:CDS AJ627226_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 20952). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcaatttactag
>gnl|hbvcds|AJ627227_SP_P-A Feature FT:CDS AJ627227_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 21077). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacgamgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggwccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AJ627228_SP_P-A Feature FT:CDS AJ627228_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 34408). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaattcttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AM180624_SP_P-A Feature FT:CDS AM180624_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAE168). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgatccamaaccac
cagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|AM184125_SP_P-A Feature FT:CDS AM184125_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate O64). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|AM184126_SP_P-A Feature FT:CDS AM184126_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N35). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|AM282986_SP_P-A Feature FT:CDS AM282986_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctt
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AM295795_SP_P-A Feature FT:CDS AM295795_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AM295796_SP_P-A Feature FT:CDS AM295796_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AM295797_SP_P-A Feature FT:CDS AM295797_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AM410963_SP_P-A Feature FT:CDS AM410963_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|AM494718_SP_P-A Feature FT:CDS AM494718_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAR204). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggrgtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY034878_SP_P-A Feature FT:CDS AY034878_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVKL). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaagctactgttgttagacaacgggaccgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|AY128092_SP_P-A Feature FT:CDS AY128092_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY152726_SP_P-A Feature FT:CDS AY152726_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8.22). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
aagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgttgccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY161138_SP_P-A Feature FT:CDS AY161138_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY161139_SP_P-A Feature FT:CDS AY161139_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY161142_SP_P-A Feature FT:CDS AY161142_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcagcacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagactc
ccttcgccttgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY161143_SP_P-A Feature FT:CDS AY161143_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcagcacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY161144_SP_P-A Feature FT:CDS AY161144_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcagcacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233274_SP_P-A Feature FT:CDS AY233274_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 0962). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaggagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233275_SP_P-A Feature FT:CDS AY233275_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 163). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatctacaacaac
gagtacgggaccttgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233276_SP_P-A Feature FT:CDS AY233276_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1839). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233278_SP_P-A Feature FT:CDS AY233278_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233279_SP_P-A Feature FT:CDS AY233279_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233280_SP_P-A Feature FT:CDS AY233280_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233281_SP_P-A Feature FT:CDS AY233281_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 303). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatctacaacaac
gagtacgggaccttgcaagacctgcacgactcctgctcaaaacaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233282_SP_P-A Feature FT:CDS AY233282_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 306). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233283_SP_P-A Feature FT:CDS AY233283_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4038). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggccccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233284_SP_P-A Feature FT:CDS AY233284_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5283). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatctacaacaac
gagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233285_SP_P-A Feature FT:CDS AY233285_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 795). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccccgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233286_SP_P-A Feature FT:CDS AY233286_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 818). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacggggccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaacaccta
cggatggaaattgcacctgtattcccatcccatcgtcctggactttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233287_SP_P-A Feature FT:CDS AY233287_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8225). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggtctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233288_SP_P-A Feature FT:CDS AY233288_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 823). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233289_SP_P-A Feature FT:CDS AY233289_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 833). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY233290_SP_P-A Feature FT:CDS AY233290_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 85). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccaccatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY373428_SP_P-A Feature FT:CDS AY373428_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY373429_SP_P-A Feature FT:CDS AY373429_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagtagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY373432_SP_P-A Feature FT:CDS AY373432_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY707087_SP_P-A Feature FT:CDS AY707087_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-N10). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctt
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY738139_SP_P-A Feature FT:CDS AY738139_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY738140_SP_P-A Feature FT:CDS AY738140_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY738141_SP_P-A Feature FT:CDS AY738141_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY738142_SP_P-A Feature FT:CDS AY738142_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY738143_SP_P-A Feature FT:CDS AY738143_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY862867_SP_P-A Feature FT:CDS AY862867_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY862868_SP_P-A Feature FT:CDS AY862868_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY902775_SP_P-A Feature FT:CDS AY902775_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MTB162). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY903452_SP_P-A Feature FT:CDS AY903452_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatccacaacaaccagtac
gggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY934763_SP_P-A Feature FT:CDS AY934763_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ik3346). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacggggccttgcagaagctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|AY934764_SP_P-A Feature FT:CDS AY934764_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9210699). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|AY934765_SP_P-A Feature FT:CDS AY934765_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24306). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaagatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY934766_SP_P-A Feature FT:CDS AY934766_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24233). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY934767_SP_P-A Feature FT:CDS AY934767_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27178). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY934768_SP_P-A Feature FT:CDS AY934768_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 25830). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtactggaccctgcaaaacctgcacgactcctgctcaaggcaactctatggttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY934769_SP_P-A Feature FT:CDS AY934769_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 23719). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY934770_SP_P-A Feature FT:CDS AY934770_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 953642). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY934771_SP_P-A Feature FT:CDS AY934771_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27439). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY934772_SP_P-A Feature FT:CDS AY934772_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1908). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY934773_SP_P-A Feature FT:CDS AY934773_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9414346). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AY934774_SP_P-A Feature FT:CDS AY934774_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9615549). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|DQ020002_SP_P-A Feature FT:CDS DQ020002_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 380). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|DQ020003_SP_P-A Feature FT:CDS DQ020003_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5780). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgtgaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|DQ298161_SP_P-A Feature FT:CDS DQ298161_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccatcatgttgctgtacaaaaccta
cggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|DQ298162_SP_P-A Feature FT:CDS DQ298162_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatttcaatcgccgcgtcacagaagatctcgatctcggggatcccaatgatcaacaactac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccatcatgttgctgtacaaaaccta
cggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|DQ298163_SP_P-A Feature FT:CDS DQ298163_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaaccta
cggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|DQ298164_SP_P-A Feature FT:CDS DQ298164_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacgaaaccta
cggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|DQ298165_SP_P-A Feature FT:CDS DQ298165_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggctggtcccatagaagaagaact
ccctcgcctcgcagacgcagatcccaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaaccta
cggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|DQ315784_SP_P-A Feature FT:CDS DQ315784_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI03101). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|DQ315785_SP_P-A Feature FT:CDS DQ315785_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI0386). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagcacgggaccttgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|DQ315786_SP_P-A Feature FT:CDS DQ315786_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI057). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|DQ788725_SP_P-A Feature FT:CDS DQ788725_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 07/92). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|DQ788728_SP_P-A Feature FT:CDS DQ788728_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 05/96). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacctccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatttcgggaatctcaatgatcaacaacaac
cagtacgggaccgtgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EF103278_SP_P-A Feature FT:CDS EF103278_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ran60). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgtcgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ctctcttggctcagtttactag
>gnl|hbvcds|EF208113_SP_P-A Feature FT:CDS EF208113_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient B, serum 05/93). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU054331_SP_C-A Feature FT:CDS EU054331_SP_C-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|EU086721_SP_P-A Feature FT:CDS EU086721_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HRO/w4601-2002). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU185786_SP_P-A Feature FT:CDS EU185786_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU11). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtasaawaccta
cggatgraarttgcacctgtaywscsrtcccatcgtcctgggcttkcgcaaaatacctatgggagtggggctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU185787_SP_P-A Feature FT:CDS EU185787_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaarttgcacctgtaywscsatcccatcgtcctgggcttkcgcaaaatacctatgggagtggggctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU185789_SP_P-A Feature FT:CDS EU185789_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU8). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaarttgcacctgtaywscsrtcccatcgtcctgggcttkcgcaaaatacctatgggagtggggctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU304331_SP_P-A Feature FT:CDS EU304331_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA84). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacaacgacaccgaggcaggtcccctagaggaagaact
ccctcgcctcgcagacsaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU366129_SP_P-A Feature FT:CDS EU366129_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA92). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgagtccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU410082_SP_P-A Feature FT:CDS EU410082_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ph81). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU414132_SP_P-A Feature FT:CDS EU414132_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaygwcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatytyaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU414133_SP_P-A Feature FT:CDS EU414133_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacggaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU594383_SP_P-A Feature FT:CDS EU594383_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU594384_SP_P-A Feature FT:CDS EU594384_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU594385_SP_P-A Feature FT:CDS EU594385_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU594386_SP_P-A Feature FT:CDS EU594386_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacatgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU594387_SP_P-A Feature FT:CDS EU594387_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU594388_SP_P-A Feature FT:CDS EU594388_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU594389_SP_P-A Feature FT:CDS EU594389_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU594390_SP_P-A Feature FT:CDS EU594390_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU594391_SP_P-A Feature FT:CDS EU594391_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU594392_SP_P-A Feature FT:CDS EU594392_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU594393_SP_P-A Feature FT:CDS EU594393_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU594394_SP_P-A Feature FT:CDS EU594394_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU594395_SP_P-A Feature FT:CDS EU594395_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU747320_SP_P-A Feature FT:CDS EU747320_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate V51). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859898_SP_P-A Feature FT:CDS EU859898_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P45). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859899_SP_P-A Feature FT:CDS EU859899_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P44). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859900_SP_P-A Feature FT:CDS EU859900_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P42). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859901_SP_P-A Feature FT:CDS EU859901_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P37). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859902_SP_P-A Feature FT:CDS EU859902_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P32). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859903_SP_P-A Feature FT:CDS EU859903_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859904_SP_P-A Feature FT:CDS EU859904_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P39). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859905_SP_P-A Feature FT:CDS EU859905_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P38). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859906_SP_P-A Feature FT:CDS EU859906_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859907_SP_P-A Feature FT:CDS EU859907_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859908_SP_P-A Feature FT:CDS EU859908_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859909_SP_P-A Feature FT:CDS EU859909_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859910_SP_P-A Feature FT:CDS EU859910_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859911_SP_P-A Feature FT:CDS EU859911_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P26). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859912_SP_P-A Feature FT:CDS EU859912_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P23). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttggtagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859913_SP_P-A Feature FT:CDS EU859913_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859914_SP_P-A Feature FT:CDS EU859914_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859915_SP_P-A Feature FT:CDS EU859915_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P07). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859916_SP_P-A Feature FT:CDS EU859916_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P03). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859917_SP_P-A Feature FT:CDS EU859917_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P13). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859918_SP_P-A Feature FT:CDS EU859918_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P17). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859919_SP_P-A Feature FT:CDS EU859919_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859920_SP_P-A Feature FT:CDS EU859920_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P21). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859921_SP_P-A Feature FT:CDS EU859921_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P08). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859922_SP_P-A Feature FT:CDS EU859922_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P09). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859923_SP_P-A Feature FT:CDS EU859923_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P15). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859924_SP_P-A Feature FT:CDS EU859924_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859925_SP_P-A Feature FT:CDS EU859925_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P22). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859926_SP_P-A Feature FT:CDS EU859926_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P06). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859927_SP_P-A Feature FT:CDS EU859927_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P25). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859928_SP_P-A Feature FT:CDS EU859928_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P01). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859929_SP_P-A Feature FT:CDS EU859929_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P43). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859930_SP_P-A Feature FT:CDS EU859930_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C126). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859931_SP_P-A Feature FT:CDS EU859931_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C96). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859932_SP_P-A Feature FT:CDS EU859932_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C69). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859933_SP_P-A Feature FT:CDS EU859933_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C67). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859934_SP_P-A Feature FT:CDS EU859934_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C60). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatgcaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|EU859935_SP_P-A Feature FT:CDS EU859935_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C14). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859936_SP_P-A Feature FT:CDS EU859936_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C10). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859937_SP_P-A Feature FT:CDS EU859937_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C40). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859938_SP_P-A Feature FT:CDS EU859938_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C133). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859939_SP_P-A Feature FT:CDS EU859939_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C130). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859940_SP_P-A Feature FT:CDS EU859940_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C122). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859941_SP_P-A Feature FT:CDS EU859941_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C153). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859942_SP_P-A Feature FT:CDS EU859942_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C110). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859943_SP_P-A Feature FT:CDS EU859943_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C109). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859944_SP_P-A Feature FT:CDS EU859944_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C105). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859945_SP_P-A Feature FT:CDS EU859945_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C102). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859946_SP_P-A Feature FT:CDS EU859946_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C155). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859947_SP_P-A Feature FT:CDS EU859947_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C85). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859948_SP_P-A Feature FT:CDS EU859948_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C151). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859949_SP_P-A Feature FT:CDS EU859949_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C152). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859950_SP_P-A Feature FT:CDS EU859950_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C64). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859951_SP_P-A Feature FT:CDS EU859951_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C62). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|EU859952_SP_P-A Feature FT:CDS EU859952_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C56). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgaaccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|EU859953_SP_P-A Feature FT:CDS EU859953_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C55). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|EU859954_SP_P-A Feature FT:CDS EU859954_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C42). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|EU859955_SP_P-A Feature FT:CDS EU859955_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C39). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|EU859956_SP_P-A Feature FT:CDS EU859956_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C35). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|FJ349222_SP_P-A Feature FT:CDS FJ349222_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H20). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ349224_SP_P-A Feature FT:CDS FJ349224_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H71). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ349296_SP_P-A Feature FT:CDS FJ349296_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FJ692554_SP_P-A Feature FT:CDS FJ692554_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24063). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcaaaagctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FJ692555_SP_P-A Feature FT:CDS FJ692555_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24074). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactrctgttgttagatgtcgggaccgaggcaggtcctctagaagaagaact
ccctcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaycac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtataaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692557_SP_P-A Feature FT:CDS FJ692557_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48004). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692558_SP_P-A Feature FT:CDS FJ692558_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48008). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgtggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692559_SP_P-A Feature FT:CDS FJ692559_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48032). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacrcttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692561_SP_P-A Feature FT:CDS FJ692561_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48040). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaractgctgttgttagatgtcgagcccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692562_SP_P-A Feature FT:CDS FJ692562_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48044). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692563_SP_P-A Feature FT:CDS FJ692563_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48049). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692564_SP_P-A Feature FT:CDS FJ692564_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48074). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggccgaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692565_SP_P-A Feature FT:CDS FJ692565_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48077). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagrccgaggcaggtcccctmgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggsaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692566_SP_P-A Feature FT:CDS FJ692566_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48090). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692567_SP_P-A Feature FT:CDS FJ692567_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48113). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgtcgaaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacmtcaatgatcaacaaccac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692570_SP_P-A Feature FT:CDS FJ692570_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50010). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcaygactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692571_SP_P-A Feature FT:CDS FJ692571_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50011). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccacgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692572_SP_P-A Feature FT:CDS FJ692572_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50013). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatryttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692573_SP_P-A Feature FT:CDS FJ692573_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50014). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcatcacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgcctcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692574_SP_P-A Feature FT:CDS FJ692574_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50015). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692575_SP_P-A Feature FT:CDS FJ692575_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50020). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggyaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692576_SP_P-A Feature FT:CDS FJ692576_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50022). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggacgaccccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692577_SP_P-A Feature FT:CDS FJ692577_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50024). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692578_SP_P-A Feature FT:CDS FJ692578_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50083). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692579_SP_P-A Feature FT:CDS FJ692579_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50084). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692580_SP_P-A Feature FT:CDS FJ692580_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50085). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692581_SP_P-A Feature FT:CDS FJ692581_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50086). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692582_SP_P-A Feature FT:CDS FJ692582_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50088). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692583_SP_P-A Feature FT:CDS FJ692583_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50089). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692584_SP_P-A Feature FT:CDS FJ692584_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50090). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692585_SP_P-A Feature FT:CDS FJ692585_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50091). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692586_SP_P-A Feature FT:CDS FJ692586_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50099). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagrtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacgac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692587_SP_P-A Feature FT:CDS FJ692587_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50115). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgcaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692588_SP_P-A Feature FT:CDS FJ692588_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50119). Complete genome. [Hepadnaviridae] (length=345 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccggcaaggcaggtcccctagaagaaga
actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaac
aaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaac
ctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtc
cgtttctcttggctcagtttactag
>gnl|hbvcds|FJ692590_SP_P-A Feature FT:CDS FJ692590_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50152). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692591_SP_P-A Feature FT:CDS FJ692591_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50167). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692592_SP_P-A Feature FT:CDS FJ692592_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50175). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692593_SP_P-A Feature FT:CDS FJ692593_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48054). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactrctgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaaccaccagtac
gggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ692595_SP_P-A Feature FT:CDS FJ692595_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48093). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgataccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692596_SP_P-A Feature FT:CDS FJ692596_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48103). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692597_SP_P-A Feature FT:CDS FJ692597_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48125). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacwacgamtccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692598_SP_P-A Feature FT:CDS FJ692598_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50018). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692599_SP_P-A Feature FT:CDS FJ692599_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50033). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcctatcgacacttcctgaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692600_SP_P-A Feature FT:CDS FJ692600_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50034). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgasaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgyaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692601_SP_P-A Feature FT:CDS FJ692601_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50035). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692602_SP_P-A Feature FT:CDS FJ692602_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50041). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692603_SP_P-A Feature FT:CDS FJ692603_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50050). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagaactcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcactactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692604_SP_P-A Feature FT:CDS FJ692604_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50052). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692605_SP_P-A Feature FT:CDS FJ692605_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50059). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgtact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaayctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692606_SP_P-A Feature FT:CDS FJ692606_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50061). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccam
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692607_SP_P-A Feature FT:CDS FJ692607_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50068). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaggagaccgaggcaggtcccttagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692608_SP_P-A Feature FT:CDS FJ692608_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50075). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692609_SP_P-A Feature FT:CDS FJ692609_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50098). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgtact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
tggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692610_SP_P-A Feature FT:CDS FJ692610_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50104). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagrccgaggcaggtcccctagaagacgtact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
tggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692611_SP_P-A Feature FT:CDS FJ692611_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50127). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692612_SP_P-A Feature FT:CDS FJ692612_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50132). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaayctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatwcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ692613_SP_P-A Feature FT:CDS FJ692613_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50156). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgagatcgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcactgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatattaccctcatgttgctgtaccaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ904411_SP_P-A Feature FT:CDS FJ904411_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A55). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FJ904434_SP_P-A Feature FT:CDS FJ904434_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate B21). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FM199974_SP_P-A Feature FT:CDS FM199974_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FM199975_SP_P-A Feature FT:CDS FM199975_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttrtcaacacttccggaaactactgttgttagatgtcgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FM199976_SP_P-A Feature FT:CDS FM199976_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggyaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FM199977_SP_P-A Feature FT:CDS FM199977_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FM199978_SP_P-A Feature FT:CDS FM199978_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FM199979_SP_P-A Feature FT:CDS FM199979_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FM199980_SP_P-A Feature FT:CDS FM199980_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcamctctatgtttccctcatgttgctgtacaaaacyta
cggctggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|FM199981_SP_P-A Feature FT:CDS FM199981_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccrcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|FN545825_SP_P-A Feature FT:CDS FN545825_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagawctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FN545826_SP_P-A Feature FT:CDS FN545826_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacgac
cagtacaggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgytgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FN545828_SP_P-A Feature FT:CDS FN545828_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggacccaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcytggctcagtttactag
>gnl|hbvcds|FN545829_SP_P-A Feature FT:CDS FN545829_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgagctcggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgttcccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FN545830_SP_P-A Feature FT:CDS FN545830_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagggaccgaggtcggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacgaccac
cagyacgggaccctgccgaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccctcatcatgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FN545831_SP_P-A Feature FT:CDS FN545831_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FN545832_SP_P-A Feature FT:CDS FN545832_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaygmagggaccgaggtcggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctmaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtataaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FN545833_SP_P-A Feature FT:CDS FN545833_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcrtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FN545834_SP_P-A Feature FT:CDS FN545834_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaratwcctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FN545835_SP_P-A Feature FT:CDS FN545835_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FN545836_SP_P-A Feature FT:CDS FN545836_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaactac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FN545837_SP_P-A Feature FT:CDS FN545837_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtcggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggamcctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FN545838_SP_P-A Feature FT:CDS FN545838_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagactacggaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FN545839_SP_P-A Feature FT:CDS FN545839_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagakgtagggaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|FN545840_SP_P-A Feature FT:CDS FN545840_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtcggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|GQ161813_SP_P-A Feature FT:CDS GQ161813_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GU1021). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|GQ184323_SP_P-A Feature FT:CDS GQ184323_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1121). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ184324_SP_P-A Feature FT:CDS GQ184324_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1122). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgacttctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ331046_SP_P-A Feature FT:CDS GQ331046_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-188). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgaaccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|GQ331047_SP_P-A Feature FT:CDS GQ331047_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-56). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatcccaatgaaccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|GQ414522_SP_P-A Feature FT:CDS GQ414522_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477461_SP_P-A Feature FT:CDS GQ477461_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477462_SP_P-A Feature FT:CDS GQ477462_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477463_SP_P-A Feature FT:CDS GQ477463_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaactcttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactgg
>gnl|hbvcds|GQ477464_SP_P-A Feature FT:CDS GQ477464_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P8). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477465_SP_P-A Feature FT:CDS GQ477465_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P10). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgtttgtagacgacgggtccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477466_SP_P-A Feature FT:CDS GQ477466_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P12). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477467_SP_P-A Feature FT:CDS GQ477467_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P14). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477468_SP_P-A Feature FT:CDS GQ477468_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcagaacctgcacgactcctgctcaaagcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477469_SP_P-A Feature FT:CDS GQ477469_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaatccttccggaaactactgttattagacgacgggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477470_SP_P-A Feature FT:CDS GQ477470_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477472_SP_P-A Feature FT:CDS GQ477472_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaatacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcatgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477473_SP_P-A Feature FT:CDS GQ477473_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgtcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgatccacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477474_SP_P-A Feature FT:CDS GQ477474_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgcmgatctcaatcgccgcgtcgcagaagatctccatctcgggaacctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcatgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477475_SP_P-A Feature FT:CDS GQ477475_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477476_SP_P-A Feature FT:CDS GQ477476_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgtctcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagttcactag
>gnl|hbvcds|GQ477477_SP_P-A Feature FT:CDS GQ477477_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgagcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477478_SP_P-A Feature FT:CDS GQ477478_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P34). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaaatactgttgttagaccacggggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgattcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477479_SP_P-A Feature FT:CDS GQ477479_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477480_SP_P-A Feature FT:CDS GQ477480_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P41). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477482_SP_P-A Feature FT:CDS GQ477482_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P46). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477484_SP_P-A Feature FT:CDS GQ477484_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P54). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacagcaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477486_SP_P-A Feature FT:CDS GQ477486_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P57). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgtaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477487_SP_P-A Feature FT:CDS GQ477487_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P60). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggccggtcccctagaggaagaact
ccctcgcctcgcagacgcagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477488_SP_P-A Feature FT:CDS GQ477488_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P64). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcatgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477490_SP_P-A Feature FT:CDS GQ477490_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P74). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477491_SP_P-A Feature FT:CDS GQ477491_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P75). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477493_SP_P-A Feature FT:CDS GQ477493_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P79). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgccggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477494_SP_P-A Feature FT:CDS GQ477494_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P80). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacggggccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477495_SP_P-A Feature FT:CDS GQ477495_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P89). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaaacagctctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477496_SP_P-A Feature FT:CDS GQ477496_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P94). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477497_SP_P-A Feature FT:CDS GQ477497_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P98). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcactgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477498_SP_P-A Feature FT:CDS GQ477498_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P100). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477499_SP_P-A Feature FT:CDS GQ477499_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P105). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgcaaatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477500_SP_P-A Feature FT:CDS GQ477500_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P107). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagttcactag
>gnl|hbvcds|GQ477501_SP_P-A Feature FT:CDS GQ477501_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P116). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaatgcttccggaaactgctgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccattgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477502_SP_P-A Feature FT:CDS GQ477502_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P123). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477503_SP_P-A Feature FT:CDS GQ477503_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P130). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GQ477504_SP_P-A Feature FT:CDS GQ477504_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P131). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacaggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GU563545_SP_P-A Feature FT:CDS GU563545_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-5). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GU563546_SP_P-A Feature FT:CDS GU563546_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-66). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GU563547_SP_P-A Feature FT:CDS GU563547_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-23). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GU563548_SP_P-A Feature FT:CDS GU563548_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-108). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GU563550_SP_P-A Feature FT:CDS GU563550_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-204). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|GU563551_SP_P-A Feature FT:CDS GU563551_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-124). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GU563553_SP_P-A Feature FT:CDS GU563553_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-10). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GU563554_SP_P-A Feature FT:CDS GU563554_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-25). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GU563555_SP_P-A Feature FT:CDS GU563555_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-35). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GU563557_SP_P-A Feature FT:CDS GU563557_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-78). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GU563558_SP_P-A Feature FT:CDS GU563558_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-90). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|GU563562_SP_P-A Feature FT:CDS GU563562_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-189). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|HE576988_SP_P-A Feature FT:CDS HE576988_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5.9). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggaaggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|HE576989_SP_P-A Feature FT:CDS HE576989_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P2.2.11). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggaaggaaattgcacctgtattcccatcccattgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|HM011485_SP_P-A Feature FT:CDS HM011485_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccaaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccatgcaaaacctgcacgacttctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|HM363612_SP_P-A Feature FT:CDS HM363612_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|HM363613_SP_P-A Feature FT:CDS HM363613_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate V103). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|HM535200_SP_P-A Feature FT:CDS HM535200_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 947 Harare). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|HM535205_SP_P-A Feature FT:CDS HM535205_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 72 Mutare). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcggacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439720_SP_P-A Feature FT:CDS JF439720_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL437). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgtcgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439721_SP_P-A Feature FT:CDS JF439721_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL444). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439722_SP_P-A Feature FT:CDS JF439722_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL445). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439723_SP_P-A Feature FT:CDS JF439723_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL448). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacggctcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439724_SP_P-A Feature FT:CDS JF439724_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL450). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctcaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439725_SP_P-A Feature FT:CDS JF439725_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL451). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctcaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtgcaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctagctcagtctactag
>gnl|hbvcds|JF439726_SP_P-A Feature FT:CDS JF439726_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL452). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcgacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggccttagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439727_SP_P-A Feature FT:CDS JF439727_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL453). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctagctcagtttactag
>gnl|hbvcds|JF439728_SP_P-A Feature FT:CDS JF439728_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL454). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctcaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtgcaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctagctcagtctactag
>gnl|hbvcds|JF439729_SP_P-A Feature FT:CDS JF439729_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL455). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctcaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439730_SP_P-A Feature FT:CDS JF439730_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL456). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439731_SP_P-A Feature FT:CDS JF439731_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL458). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggccttagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439732_SP_P-A Feature FT:CDS JF439732_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL459). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccaccatcctgggctttcgcaaaatacctatgggagtgggccccagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439733_SP_P-A Feature FT:CDS JF439733_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL460). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccaccatcctgggctttcgcaaaatacctatgggagtgggccccagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439734_SP_P-A Feature FT:CDS JF439734_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL461). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggccttagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439735_SP_P-A Feature FT:CDS JF439735_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL462). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439736_SP_P-A Feature FT:CDS JF439736_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL463). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439737_SP_P-A Feature FT:CDS JF439737_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL465). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439738_SP_P-A Feature FT:CDS JF439738_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL466). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439739_SP_P-A Feature FT:CDS JF439739_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL467). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcgaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439740_SP_P-A Feature FT:CDS JF439740_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL468). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctagctcagtctactag
>gnl|hbvcds|JF439741_SP_P-A Feature FT:CDS JF439741_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL469). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctagctcagtttactag
>gnl|hbvcds|JF439742_SP_P-A Feature FT:CDS JF439742_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL471). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439743_SP_P-A Feature FT:CDS JF439743_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL472). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggccccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439744_SP_P-A Feature FT:CDS JF439744_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL473). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctcaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggccttagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439745_SP_P-A Feature FT:CDS JF439745_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL474). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439746_SP_P-A Feature FT:CDS JF439746_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL485). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439747_SP_P-A Feature FT:CDS JF439747_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL489). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcgacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439748_SP_P-A Feature FT:CDS JF439748_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL490). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatcccaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcggaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|JF439750_SP_P-A Feature FT:CDS JF439750_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL498). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctagctcagtttactag
>gnl|hbvcds|JF439751_SP_P-A Feature FT:CDS JF439751_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL499). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctcaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439752_SP_P-A Feature FT:CDS JF439752_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439753_SP_P-A Feature FT:CDS JF439753_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439754_SP_P-A Feature FT:CDS JF439754_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439755_SP_P-A Feature FT:CDS JF439755_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A4). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439756_SP_P-A Feature FT:CDS JF439756_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A5). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439757_SP_P-A Feature FT:CDS JF439757_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A7). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439758_SP_P-A Feature FT:CDS JF439758_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A9). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439759_SP_P-A Feature FT:CDS JF439759_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439760_SP_P-A Feature FT:CDS JF439760_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439761_SP_P-A Feature FT:CDS JF439761_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439762_SP_P-A Feature FT:CDS JF439762_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439763_SP_P-A Feature FT:CDS JF439763_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439764_SP_P-A Feature FT:CDS JF439764_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B5). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439765_SP_P-A Feature FT:CDS JF439765_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B6). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439766_SP_P-A Feature FT:CDS JF439766_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B7). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439767_SP_P-A Feature FT:CDS JF439767_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B8). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439768_SP_P-A Feature FT:CDS JF439768_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B9). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439769_SP_P-A Feature FT:CDS JF439769_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439770_SP_P-A Feature FT:CDS JF439770_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B12). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439771_SP_P-A Feature FT:CDS JF439771_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C3). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439772_SP_P-A Feature FT:CDS JF439772_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C5). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439773_SP_P-A Feature FT:CDS JF439773_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C7). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439774_SP_P-A Feature FT:CDS JF439774_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C8). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439775_SP_P-A Feature FT:CDS JF439775_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C9). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439777_SP_P-A Feature FT:CDS JF439777_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05D2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439778_SP_P-A Feature FT:CDS JF439778_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05D3). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439819_SP_P-A Feature FT:CDS JF439819_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97A1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagaacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439820_SP_P-A Feature FT:CDS JF439820_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97B1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacggggacatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439821_SP_P-A Feature FT:CDS JF439821_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97B2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgacgccggttccctaaaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcamtctcgggaatctcaatgatcagcaacaac
cagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccaccgtccggggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctattggctcagtttactag
>gnl|hbvcds|JF439822_SP_P-A Feature FT:CDS JF439822_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97C1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatttcgggaatctcaatgatcagcaacaac
cagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439823_SP_P-A Feature FT:CDS JF439823_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97C2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagaacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaagttgcacctgtatccccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439824_SP_P-A Feature FT:CDS JF439824_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97D1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439825_SP_P-A Feature FT:CDS JF439825_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97D2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439826_SP_P-A Feature FT:CDS JF439826_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97E1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439827_SP_P-A Feature FT:CDS JF439827_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97E2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagaacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439828_SP_P-A Feature FT:CDS JF439828_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97F1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaacctcgggaatctcaatgatcagcaacaac
cagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439829_SP_P-A Feature FT:CDS JF439829_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97F2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439830_SP_P-A Feature FT:CDS JF439830_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97G2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439831_SP_P-A Feature FT:CDS JF439831_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97H1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439832_SP_P-A Feature FT:CDS JF439832_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97H2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcggcaacaac
cagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439833_SP_P-A Feature FT:CDS JF439833_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99H4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439834_SP_P-A Feature FT:CDS JF439834_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99A4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439835_SP_P-A Feature FT:CDS JF439835_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99B3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439836_SP_P-A Feature FT:CDS JF439836_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99B4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggacaatgcaaaacctgcacgactactgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439837_SP_P-A Feature FT:CDS JF439837_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99C3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439838_SP_P-A Feature FT:CDS JF439838_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99C4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgcattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439839_SP_P-A Feature FT:CDS JF439839_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99D3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439840_SP_P-A Feature FT:CDS JF439840_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99D4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggacaatgcaaaacctgcacgactactgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439841_SP_P-A Feature FT:CDS JF439841_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99E4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcacaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439842_SP_P-A Feature FT:CDS JF439842_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99F3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccat
ttctcatggctcagtttactag
>gnl|hbvcds|JF439843_SP_P-A Feature FT:CDS JF439843_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99F4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcccgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439844_SP_P-A Feature FT:CDS JF439844_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99H3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439845_SP_P-A Feature FT:CDS JF439845_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00H6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagagct
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439846_SP_P-A Feature FT:CDS JF439846_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00A5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatatttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctctcgcaaagtacctatgggagtgggcctcagtccgc
ttctcatggctcagtttactag
>gnl|hbvcds|JF439847_SP_P-A Feature FT:CDS JF439847_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00A6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439848_SP_P-A Feature FT:CDS JF439848_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00B5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439849_SP_P-A Feature FT:CDS JF439849_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00B6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439850_SP_P-A Feature FT:CDS JF439850_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00C5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggacaatgcaaaacctgcacgactactgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439851_SP_P-A Feature FT:CDS JF439851_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00C6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439852_SP_P-A Feature FT:CDS JF439852_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00D5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaacgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactactgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439853_SP_P-A Feature FT:CDS JF439853_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00D6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439854_SP_P-A Feature FT:CDS JF439854_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00E5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccgtcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439855_SP_P-A Feature FT:CDS JF439855_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00E6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggacaatgcaaaacctgcacgactactgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439856_SP_P-A Feature FT:CDS JF439856_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00F5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccgtcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439857_SP_P-A Feature FT:CDS JF439857_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00F6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgccctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439858_SP_P-A Feature FT:CDS JF439858_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00G5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgcattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439859_SP_P-A Feature FT:CDS JF439859_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00G6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439860_SP_P-A Feature FT:CDS JF439860_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00H5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgcattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439861_SP_P-A Feature FT:CDS JF439861_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05H8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439862_SP_P-A Feature FT:CDS JF439862_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05B7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439864_SP_P-A Feature FT:CDS JF439864_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05D7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacactcccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439865_SP_P-A Feature FT:CDS JF439865_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05D8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatattgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439866_SP_P-A Feature FT:CDS JF439866_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05F7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439867_SP_P-A Feature FT:CDS JF439867_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05G8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439868_SP_P-A Feature FT:CDS JF439868_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05H7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcaatttactag
>gnl|hbvcds|JF439869_SP_P-A Feature FT:CDS JF439869_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaccta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439870_SP_P-A Feature FT:CDS JF439870_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaacta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439871_SP_P-A Feature FT:CDS JF439871_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaccta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439872_SP_P-A Feature FT:CDS JF439872_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaacta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctattggctcagtttactag
>gnl|hbvcds|JF439873_SP_P-A Feature FT:CDS JF439873_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaccta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439874_SP_P-A Feature FT:CDS JF439874_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaccta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439875_SP_P-A Feature FT:CDS JF439875_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaccta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439876_SP_P-A Feature FT:CDS JF439876_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaccta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439877_SP_P-A Feature FT:CDS JF439877_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C11). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgatgccctcatgttgctgtacaaaaacta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439878_SP_P-A Feature FT:CDS JF439878_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgatgccctcatgttgctgtacaaaaacta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439879_SP_P-A Feature FT:CDS JF439879_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaccta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439880_SP_P-A Feature FT:CDS JF439880_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgacgcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaccta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439881_SP_P-A Feature FT:CDS JF439881_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaccta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439882_SP_P-A Feature FT:CDS JF439882_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaccta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439883_SP_P-A Feature FT:CDS JF439883_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaccta
cggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439886_SP_P-A Feature FT:CDS JF439886_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F1). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgttgccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439887_SP_P-A Feature FT:CDS JF439887_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F2_rev_comp). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439888_SP_P-A Feature FT:CDS JF439888_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F3). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439889_SP_P-A Feature FT:CDS JF439889_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F4). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttacggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439890_SP_P-A Feature FT:CDS JF439890_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F5). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgttgccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439891_SP_P-A Feature FT:CDS JF439891_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F6). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439892_SP_P-A Feature FT:CDS JF439892_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F8). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439893_SP_P-A Feature FT:CDS JF439893_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F9). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439894_SP_P-A Feature FT:CDS JF439894_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F11). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439895_SP_P-A Feature FT:CDS JF439895_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F12). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439896_SP_P-A Feature FT:CDS JF439896_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01A2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439897_SP_P-A Feature FT:CDS JF439897_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01A5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439898_SP_P-A Feature FT:CDS JF439898_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01A10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439899_SP_P-A Feature FT:CDS JF439899_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439900_SP_P-A Feature FT:CDS JF439900_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439901_SP_P-A Feature FT:CDS JF439901_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439902_SP_P-A Feature FT:CDS JF439902_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439903_SP_P-A Feature FT:CDS JF439903_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G11). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439904_SP_P-A Feature FT:CDS JF439904_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439905_SP_P-A Feature FT:CDS JF439905_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439906_SP_P-A Feature FT:CDS JF439906_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcacaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439907_SP_P-A Feature FT:CDS JF439907_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439908_SP_P-A Feature FT:CDS JF439908_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439909_SP_P-A Feature FT:CDS JF439909_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439910_SP_P-A Feature FT:CDS JF439910_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439911_SP_P-A Feature FT:CDS JF439911_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439912_SP_P-A Feature FT:CDS JF439912_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439913_SP_P-A Feature FT:CDS JF439913_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439914_SP_P-A Feature FT:CDS JF439914_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcctatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439915_SP_P-A Feature FT:CDS JF439915_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A5). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439916_SP_P-A Feature FT:CDS JF439916_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439917_SP_P-A Feature FT:CDS JF439917_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgcccaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439918_SP_P-A Feature FT:CDS JF439918_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439919_SP_P-A Feature FT:CDS JF439919_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A9). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacggggccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439920_SP_P-A Feature FT:CDS JF439920_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439921_SP_P-A Feature FT:CDS JF439921_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A11). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439922_SP_P-A Feature FT:CDS JF439922_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439923_SP_P-A Feature FT:CDS JF439923_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439924_SP_P-A Feature FT:CDS JF439924_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439925_SP_P-A Feature FT:CDS JF439925_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgctcctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ctctcttggctcagtttactag
>gnl|hbvcds|JF439926_SP_P-A Feature FT:CDS JF439926_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B4). Partial genome (Contains: HBc, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgtccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttgactcagtttactag
>gnl|hbvcds|JF439927_SP_P-A Feature FT:CDS JF439927_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439928_SP_P-A Feature FT:CDS JF439928_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439929_SP_P-A Feature FT:CDS JF439929_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439930_SP_P-A Feature FT:CDS JF439930_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B9). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439931_SP_P-A Feature FT:CDS JF439931_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccagggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439932_SP_P-A Feature FT:CDS JF439932_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B11). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttaccaacacttccggaatgtactgttgttagacgaagggaccgagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439933_SP_P-A Feature FT:CDS JF439933_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439934_SP_P-A Feature FT:CDS JF439934_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439935_SP_P-A Feature FT:CDS JF439935_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccagggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439936_SP_P-A Feature FT:CDS JF439936_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439937_SP_P-A Feature FT:CDS JF439937_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccgtcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439938_SP_P-A Feature FT:CDS JF439938_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C5). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctatattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439939_SP_P-A Feature FT:CDS JF439939_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439940_SP_P-A Feature FT:CDS JF439940_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439941_SP_P-A Feature FT:CDS JF439941_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439942_SP_P-A Feature FT:CDS JF439942_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaagtacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439943_SP_P-A Feature FT:CDS JF439943_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439944_SP_P-A Feature FT:CDS JF439944_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439945_SP_P-A Feature FT:CDS JF439945_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439946_SP_P-A Feature FT:CDS JF439946_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439947_SP_P-A Feature FT:CDS JF439947_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439948_SP_P-A Feature FT:CDS JF439948_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439949_SP_P-A Feature FT:CDS JF439949_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439950_SP_P-A Feature FT:CDS JF439950_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439951_SP_P-A Feature FT:CDS JF439951_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a11). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtgcgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgcacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439952_SP_P-A Feature FT:CDS JF439952_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgccttgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctg
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439953_SP_P-A Feature FT:CDS JF439953_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439954_SP_P-A Feature FT:CDS JF439954_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggatactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcgatctcgggaatctcaatgatcgacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439955_SP_P-A Feature FT:CDS JF439955_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439956_SP_P-A Feature FT:CDS JF439956_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439957_SP_P-A Feature FT:CDS JF439957_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439958_SP_P-A Feature FT:CDS JF439958_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaggaggaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgtcgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439959_SP_P-A Feature FT:CDS JF439959_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439960_SP_P-A Feature FT:CDS JF439960_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439961_SP_P-A Feature FT:CDS JF439961_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcccgggctttcacaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439962_SP_P-A Feature FT:CDS JF439962_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439963_SP_P-A Feature FT:CDS JF439963_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttatacgacgagactgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacttcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439964_SP_P-A Feature FT:CDS JF439964_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcgatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439965_SP_P-A Feature FT:CDS JF439965_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgtaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439966_SP_P-A Feature FT:CDS JF439966_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c8). Partial genome (Contains: HBe, HBc, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatcccaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439967_SP_P-A Feature FT:CDS JF439967_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcacgtcccctacaacaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439968_SP_P-A Feature FT:CDS JF439968_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439969_SP_P-A Feature FT:CDS JF439969_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439970_SP_P-A Feature FT:CDS JF439970_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttaggcgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439971_SP_P-A Feature FT:CDS JF439971_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaaggact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439972_SP_P-A Feature FT:CDS JF439972_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439973_SP_P-A Feature FT:CDS JF439973_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439974_SP_P-A Feature FT:CDS JF439974_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439975_SP_P-A Feature FT:CDS JF439975_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ctctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439976_SP_P-A Feature FT:CDS JF439976_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ctctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439977_SP_P-A Feature FT:CDS JF439977_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439978_SP_P-A Feature FT:CDS JF439978_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439979_SP_P-A Feature FT:CDS JF439979_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cgggtggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439980_SP_P-A Feature FT:CDS JF439980_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439981_SP_P-A Feature FT:CDS JF439981_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaagcctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JF439982_SP_P-A Feature FT:CDS JF439982_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439983_SP_P-A Feature FT:CDS JF439983_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaggaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439984_SP_P-A Feature FT:CDS JF439984_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439985_SP_P-A Feature FT:CDS JF439985_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439986_SP_P-A Feature FT:CDS JF439986_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439987_SP_P-A Feature FT:CDS JF439987_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaagaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439988_SP_P-A Feature FT:CDS JF439988_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439989_SP_P-A Feature FT:CDS JF439989_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439990_SP_P-A Feature FT:CDS JF439990_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttaccaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439991_SP_P-A Feature FT:CDS JF439991_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtctgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439992_SP_P-A Feature FT:CDS JF439992_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF439993_SP_P-A Feature FT:CDS JF439993_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF440016_SP_P-A Feature FT:CDS JF440016_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B11). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF440018_SP_P-A Feature FT:CDS JF440018_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C1). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggattgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JF440020_SP_P-A Feature FT:CDS JF440020_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JN182318_SP_P-A Feature FT:CDS JN182318_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182319_SP_P-A Feature FT:CDS JN182319_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182320_SP_P-A Feature FT:CDS JN182320_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaaccctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182321_SP_P-A Feature FT:CDS JN182321_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182322_SP_P-A Feature FT:CDS JN182322_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182323_SP_P-A Feature FT:CDS JN182323_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182324_SP_P-A Feature FT:CDS JN182324_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaacgctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182325_SP_P-A Feature FT:CDS JN182325_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182326_SP_P-A Feature FT:CDS JN182326_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182327_SP_P-A Feature FT:CDS JN182327_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182328_SP_P-A Feature FT:CDS JN182328_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182329_SP_P-A Feature FT:CDS JN182329_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182330_SP_P-A Feature FT:CDS JN182330_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacggctcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182331_SP_P-A Feature FT:CDS JN182331_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtataaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182332_SP_P-A Feature FT:CDS JN182332_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182333_SP_P-A Feature FT:CDS JN182333_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JN182334_SP_P-A Feature FT:CDS JN182334_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagtagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ023660_SP_P-A Feature FT:CDS JQ023660_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1160). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
aggcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaagtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ023661_SP_P-A Feature FT:CDS JQ023661_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1158). Complete genome. [Hepadnaviridae] (length=342 residues).
aggcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ023662_SP_P-A Feature FT:CDS JQ023662_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1164). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
aggcccctatcttatcaacacttccggaaactactgttgtttgacgacgagaccgaggcaggtcccctaaaagaagaact
ccctcgcctcgcagacgaaaatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggacccctgcaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ023663_SP_P-A Feature FT:CDS JQ023663_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1159). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
aggcccctatcttatcaacacttccggaaactactgttgtttgacgacgagaccgaggccggtcccctaaaagaagaact
ccctcgcctcgcaaacgaaaatctcaatcgccgcgtcgcaaaaaatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ687529_SP_P-A Feature FT:CDS JQ687529_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Srb 176). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ687533_SP_P-A Feature FT:CDS JQ687533_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Srb 210). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgtaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707299_SP_P-A Feature FT:CDS JQ707299_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707300_SP_P-A Feature FT:CDS JQ707300_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C11). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707301_SP_P-A Feature FT:CDS JQ707301_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C12). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707302_SP_P-A Feature FT:CDS JQ707302_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C13). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707303_SP_P-A Feature FT:CDS JQ707303_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C14). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707304_SP_P-A Feature FT:CDS JQ707304_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C15). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707305_SP_P-A Feature FT:CDS JQ707305_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C16). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccct
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707306_SP_P-A Feature FT:CDS JQ707306_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C17). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707307_SP_P-A Feature FT:CDS JQ707307_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C18). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707308_SP_P-A Feature FT:CDS JQ707308_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C19). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707309_SP_P-A Feature FT:CDS JQ707309_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707310_SP_P-A Feature FT:CDS JQ707310_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C20). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707311_SP_P-A Feature FT:CDS JQ707311_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C21). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707312_SP_P-A Feature FT:CDS JQ707312_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C22). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707313_SP_P-A Feature FT:CDS JQ707313_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C23). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707314_SP_P-A Feature FT:CDS JQ707314_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C24). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707315_SP_P-A Feature FT:CDS JQ707315_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C25). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707316_SP_P-A Feature FT:CDS JQ707316_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C26). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707317_SP_P-A Feature FT:CDS JQ707317_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C27). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707318_SP_P-A Feature FT:CDS JQ707318_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707319_SP_P-A Feature FT:CDS JQ707319_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707320_SP_P-A Feature FT:CDS JQ707320_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C30). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707321_SP_P-A Feature FT:CDS JQ707321_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C31). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707322_SP_P-A Feature FT:CDS JQ707322_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C32). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707323_SP_P-A Feature FT:CDS JQ707323_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C33). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707324_SP_P-A Feature FT:CDS JQ707324_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C34). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccattgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707325_SP_P-A Feature FT:CDS JQ707325_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C35). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcatgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707326_SP_P-A Feature FT:CDS JQ707326_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C36). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccattgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707327_SP_P-A Feature FT:CDS JQ707327_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C37). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707328_SP_P-A Feature FT:CDS JQ707328_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C38). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707329_SP_P-A Feature FT:CDS JQ707329_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C39). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaaaacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707330_SP_P-A Feature FT:CDS JQ707330_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707331_SP_P-A Feature FT:CDS JQ707331_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C40). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707332_SP_P-A Feature FT:CDS JQ707332_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C41). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707333_SP_P-A Feature FT:CDS JQ707333_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C42). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707334_SP_P-A Feature FT:CDS JQ707334_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C43). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaacgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707335_SP_P-A Feature FT:CDS JQ707335_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C44). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgatcaacaataac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707336_SP_P-A Feature FT:CDS JQ707336_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C45). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707337_SP_P-A Feature FT:CDS JQ707337_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C46). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707338_SP_P-A Feature FT:CDS JQ707338_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C47). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707339_SP_P-A Feature FT:CDS JQ707339_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C48). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707340_SP_P-A Feature FT:CDS JQ707340_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C5). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgattaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707341_SP_P-A Feature FT:CDS JQ707341_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C6). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707342_SP_P-A Feature FT:CDS JQ707342_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C7). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707343_SP_P-A Feature FT:CDS JQ707343_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C8). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707344_SP_P-A Feature FT:CDS JQ707344_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C9). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccattgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707345_SP_P-A Feature FT:CDS JQ707345_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C1). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707346_SP_P-A Feature FT:CDS JQ707346_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C12). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707347_SP_P-A Feature FT:CDS JQ707347_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C13). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707348_SP_P-A Feature FT:CDS JQ707348_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C14). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707349_SP_P-A Feature FT:CDS JQ707349_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C15). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707350_SP_P-A Feature FT:CDS JQ707350_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C16). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707351_SP_P-A Feature FT:CDS JQ707351_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707352_SP_P-A Feature FT:CDS JQ707352_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C20). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707353_SP_P-A Feature FT:CDS JQ707353_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C21). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707354_SP_P-A Feature FT:CDS JQ707354_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C22-2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707355_SP_P-A Feature FT:CDS JQ707355_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C25). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707356_SP_P-A Feature FT:CDS JQ707356_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgagtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707357_SP_P-A Feature FT:CDS JQ707357_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C29-2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707358_SP_P-A Feature FT:CDS JQ707358_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C33). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707359_SP_P-A Feature FT:CDS JQ707359_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C35). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707360_SP_P-A Feature FT:CDS JQ707360_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C36). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707361_SP_P-A Feature FT:CDS JQ707361_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C37). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707362_SP_P-A Feature FT:CDS JQ707362_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C39). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707363_SP_P-A Feature FT:CDS JQ707363_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707364_SP_P-A Feature FT:CDS JQ707364_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C41). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707365_SP_P-A Feature FT:CDS JQ707365_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C43). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707366_SP_P-A Feature FT:CDS JQ707366_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C44). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707367_SP_P-A Feature FT:CDS JQ707367_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C46). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707368_SP_P-A Feature FT:CDS JQ707368_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C47). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcgtatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggttccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707369_SP_P-A Feature FT:CDS JQ707369_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C48). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707370_SP_P-A Feature FT:CDS JQ707370_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C5). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707371_SP_P-A Feature FT:CDS JQ707371_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707372_SP_P-A Feature FT:CDS JQ707372_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C11). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacagcaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtgttcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707373_SP_P-A Feature FT:CDS JQ707373_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C14). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707374_SP_P-A Feature FT:CDS JQ707374_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C15). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707375_SP_P-A Feature FT:CDS JQ707375_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C17-2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707376_SP_P-A Feature FT:CDS JQ707376_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707377_SP_P-A Feature FT:CDS JQ707377_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C21). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707378_SP_P-A Feature FT:CDS JQ707378_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C22). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707379_SP_P-A Feature FT:CDS JQ707379_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C24-9). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707380_SP_P-A Feature FT:CDS JQ707380_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C27). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707381_SP_P-A Feature FT:CDS JQ707381_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707382_SP_P-A Feature FT:CDS JQ707382_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707383_SP_P-A Feature FT:CDS JQ707383_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C31). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707384_SP_P-A Feature FT:CDS JQ707384_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C32). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707385_SP_P-A Feature FT:CDS JQ707385_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C33). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707386_SP_P-A Feature FT:CDS JQ707386_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C34). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707387_SP_P-A Feature FT:CDS JQ707387_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C36). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
cccgcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707388_SP_P-A Feature FT:CDS JQ707388_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C37). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707389_SP_P-A Feature FT:CDS JQ707389_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C38). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707390_SP_P-A Feature FT:CDS JQ707390_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C39). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707391_SP_P-A Feature FT:CDS JQ707391_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707392_SP_P-A Feature FT:CDS JQ707392_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C40). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707393_SP_P-A Feature FT:CDS JQ707393_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C42). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707394_SP_P-A Feature FT:CDS JQ707394_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C44). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707395_SP_P-A Feature FT:CDS JQ707395_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C46). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgcggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcctcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707396_SP_P-A Feature FT:CDS JQ707396_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C47). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707397_SP_P-A Feature FT:CDS JQ707397_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C48). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707398_SP_P-A Feature FT:CDS JQ707398_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C5). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacatgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707399_SP_P-A Feature FT:CDS JQ707399_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C6). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707400_SP_P-A Feature FT:CDS JQ707400_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707401_SP_P-A Feature FT:CDS JQ707401_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C10). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctatattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgagcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707402_SP_P-A Feature FT:CDS JQ707402_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C11-3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707403_SP_P-A Feature FT:CDS JQ707403_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C16). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707404_SP_P-A Feature FT:CDS JQ707404_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C17). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707405_SP_P-A Feature FT:CDS JQ707405_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C18). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707406_SP_P-A Feature FT:CDS JQ707406_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C19). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707407_SP_P-A Feature FT:CDS JQ707407_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C20-9). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707408_SP_P-A Feature FT:CDS JQ707408_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C23). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707409_SP_P-A Feature FT:CDS JQ707409_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C26-5). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707410_SP_P-A Feature FT:CDS JQ707410_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707411_SP_P-A Feature FT:CDS JQ707411_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707412_SP_P-A Feature FT:CDS JQ707412_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C32). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707413_SP_P-A Feature FT:CDS JQ707413_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C34). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707414_SP_P-A Feature FT:CDS JQ707414_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C35). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707415_SP_P-A Feature FT:CDS JQ707415_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C40). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707416_SP_P-A Feature FT:CDS JQ707416_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C41). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707417_SP_P-A Feature FT:CDS JQ707417_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C44). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707418_SP_P-A Feature FT:CDS JQ707418_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C47). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707419_SP_P-A Feature FT:CDS JQ707419_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C48). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707420_SP_P-A Feature FT:CDS JQ707420_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C6). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707531_SP_P-A Feature FT:CDS JQ707531_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707532_SP_P-A Feature FT:CDS JQ707532_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C10). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaaaaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707533_SP_P-A Feature FT:CDS JQ707533_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C11). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707534_SP_P-A Feature FT:CDS JQ707534_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C12). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707535_SP_P-A Feature FT:CDS JQ707535_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C13). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707536_SP_P-A Feature FT:CDS JQ707536_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C14). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaaaaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707537_SP_P-A Feature FT:CDS JQ707537_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C15). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707538_SP_P-A Feature FT:CDS JQ707538_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C16). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707539_SP_P-A Feature FT:CDS JQ707539_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C17). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707540_SP_P-A Feature FT:CDS JQ707540_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C18). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707541_SP_P-A Feature FT:CDS JQ707541_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C19). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707542_SP_P-A Feature FT:CDS JQ707542_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C21). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707543_SP_P-A Feature FT:CDS JQ707543_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C22). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707544_SP_P-A Feature FT:CDS JQ707544_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C23). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707545_SP_P-A Feature FT:CDS JQ707545_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C24). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707546_SP_P-A Feature FT:CDS JQ707546_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C26). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707547_SP_P-A Feature FT:CDS JQ707547_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C27). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707548_SP_P-A Feature FT:CDS JQ707548_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707549_SP_P-A Feature FT:CDS JQ707549_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C29). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707550_SP_P-A Feature FT:CDS JQ707550_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggatcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707551_SP_P-A Feature FT:CDS JQ707551_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C30). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707552_SP_P-A Feature FT:CDS JQ707552_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C31). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707553_SP_P-A Feature FT:CDS JQ707553_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C32). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707554_SP_P-A Feature FT:CDS JQ707554_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C33). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707555_SP_P-A Feature FT:CDS JQ707555_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C34). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707556_SP_P-A Feature FT:CDS JQ707556_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C35). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707557_SP_P-A Feature FT:CDS JQ707557_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C36). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707558_SP_P-A Feature FT:CDS JQ707558_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C38). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707559_SP_P-A Feature FT:CDS JQ707559_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707560_SP_P-A Feature FT:CDS JQ707560_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C40). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707561_SP_P-A Feature FT:CDS JQ707561_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C41). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707562_SP_P-A Feature FT:CDS JQ707562_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C42). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707563_SP_P-A Feature FT:CDS JQ707563_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C43). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707564_SP_P-A Feature FT:CDS JQ707564_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C44). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707565_SP_P-A Feature FT:CDS JQ707565_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C45). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707566_SP_P-A Feature FT:CDS JQ707566_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C46). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707567_SP_P-A Feature FT:CDS JQ707567_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C47). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707568_SP_P-A Feature FT:CDS JQ707568_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C48). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707569_SP_P-A Feature FT:CDS JQ707569_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C5). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707570_SP_P-A Feature FT:CDS JQ707570_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C6). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707571_SP_P-A Feature FT:CDS JQ707571_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C7). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707572_SP_P-A Feature FT:CDS JQ707572_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C8). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707573_SP_P-A Feature FT:CDS JQ707573_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C9). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707574_SP_P-A Feature FT:CDS JQ707574_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C10). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707575_SP_P-A Feature FT:CDS JQ707575_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C13). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtatacccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707576_SP_P-A Feature FT:CDS JQ707576_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C14). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707577_SP_P-A Feature FT:CDS JQ707577_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C15). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707578_SP_P-A Feature FT:CDS JQ707578_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C16). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtatacccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707579_SP_P-A Feature FT:CDS JQ707579_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C17). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707580_SP_P-A Feature FT:CDS JQ707580_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C18). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707581_SP_P-A Feature FT:CDS JQ707581_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C19). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacagaaccta
cggatggaaattgcacctgtatacccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707582_SP_P-A Feature FT:CDS JQ707582_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C2). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707583_SP_P-A Feature FT:CDS JQ707583_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C21). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtatacccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707584_SP_P-A Feature FT:CDS JQ707584_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C22). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707585_SP_P-A Feature FT:CDS JQ707585_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C23). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707586_SP_P-A Feature FT:CDS JQ707586_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C24). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707587_SP_P-A Feature FT:CDS JQ707587_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C25). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707588_SP_P-A Feature FT:CDS JQ707588_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C26). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707589_SP_P-A Feature FT:CDS JQ707589_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C27). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707590_SP_P-A Feature FT:CDS JQ707590_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707591_SP_P-A Feature FT:CDS JQ707591_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C29). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707592_SP_P-A Feature FT:CDS JQ707592_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707593_SP_P-A Feature FT:CDS JQ707593_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C33). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707594_SP_P-A Feature FT:CDS JQ707594_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C34). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707595_SP_P-A Feature FT:CDS JQ707595_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C35). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707596_SP_P-A Feature FT:CDS JQ707596_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C36). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707597_SP_P-A Feature FT:CDS JQ707597_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C37). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707598_SP_P-A Feature FT:CDS JQ707598_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C38). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707599_SP_P-A Feature FT:CDS JQ707599_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatggggctgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707600_SP_P-A Feature FT:CDS JQ707600_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C40). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707601_SP_P-A Feature FT:CDS JQ707601_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C41). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707602_SP_P-A Feature FT:CDS JQ707602_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C42). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707603_SP_P-A Feature FT:CDS JQ707603_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C43). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtatacccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707604_SP_P-A Feature FT:CDS JQ707604_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C44). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtatacccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707605_SP_P-A Feature FT:CDS JQ707605_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C45). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707606_SP_P-A Feature FT:CDS JQ707606_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C48). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtatacccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707607_SP_P-A Feature FT:CDS JQ707607_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C8). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707608_SP_P-A Feature FT:CDS JQ707608_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C9). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707609_SP_P-A Feature FT:CDS JQ707609_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707610_SP_P-A Feature FT:CDS JQ707610_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C10). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707611_SP_P-A Feature FT:CDS JQ707611_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C11). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707612_SP_P-A Feature FT:CDS JQ707612_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C13). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707613_SP_P-A Feature FT:CDS JQ707613_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C15). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707614_SP_P-A Feature FT:CDS JQ707614_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C17). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707615_SP_P-A Feature FT:CDS JQ707615_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C18). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707616_SP_P-A Feature FT:CDS JQ707616_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707617_SP_P-A Feature FT:CDS JQ707617_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C21). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707618_SP_P-A Feature FT:CDS JQ707618_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C22). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707619_SP_P-A Feature FT:CDS JQ707619_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C23). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707620_SP_P-A Feature FT:CDS JQ707620_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C24). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707621_SP_P-A Feature FT:CDS JQ707621_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C26). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707622_SP_P-A Feature FT:CDS JQ707622_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C27). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707623_SP_P-A Feature FT:CDS JQ707623_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707624_SP_P-A Feature FT:CDS JQ707624_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707625_SP_P-A Feature FT:CDS JQ707625_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C30). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707626_SP_P-A Feature FT:CDS JQ707626_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C31). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707627_SP_P-A Feature FT:CDS JQ707627_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C32). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707628_SP_P-A Feature FT:CDS JQ707628_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C33). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707629_SP_P-A Feature FT:CDS JQ707629_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C34). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707630_SP_P-A Feature FT:CDS JQ707630_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C35). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707631_SP_P-A Feature FT:CDS JQ707631_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C36-6). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707632_SP_P-A Feature FT:CDS JQ707632_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707633_SP_P-A Feature FT:CDS JQ707633_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C41). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707634_SP_P-A Feature FT:CDS JQ707634_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C42). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707635_SP_P-A Feature FT:CDS JQ707635_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C45). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgccacgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaatggcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707636_SP_P-A Feature FT:CDS JQ707636_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C46). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707637_SP_P-A Feature FT:CDS JQ707637_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C5-5). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JQ707638_SP_P-A Feature FT:CDS JQ707638_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C12). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707639_SP_P-A Feature FT:CDS JQ707639_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C13-9). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707640_SP_P-A Feature FT:CDS JQ707640_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C14). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707641_SP_P-A Feature FT:CDS JQ707641_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C17). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707642_SP_P-A Feature FT:CDS JQ707642_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707643_SP_P-A Feature FT:CDS JQ707643_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C20-7). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707644_SP_P-A Feature FT:CDS JQ707644_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C22). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707645_SP_P-A Feature FT:CDS JQ707645_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C24). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707646_SP_P-A Feature FT:CDS JQ707646_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C26). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707647_SP_P-A Feature FT:CDS JQ707647_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C27). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707648_SP_P-A Feature FT:CDS JQ707648_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707649_SP_P-A Feature FT:CDS JQ707649_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707650_SP_P-A Feature FT:CDS JQ707650_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C30). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707651_SP_P-A Feature FT:CDS JQ707651_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C33). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707652_SP_P-A Feature FT:CDS JQ707652_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C34). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707653_SP_P-A Feature FT:CDS JQ707653_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C38). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707654_SP_P-A Feature FT:CDS JQ707654_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C40). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707655_SP_P-A Feature FT:CDS JQ707655_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C41). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707656_SP_P-A Feature FT:CDS JQ707656_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C43). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707658_SP_P-A Feature FT:CDS JQ707658_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_13). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707659_SP_P-A Feature FT:CDS JQ707659_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_14). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707661_SP_P-A Feature FT:CDS JQ707661_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_18). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707662_SP_P-A Feature FT:CDS JQ707662_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_19). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707663_SP_P-A Feature FT:CDS JQ707663_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707664_SP_P-A Feature FT:CDS JQ707664_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_20). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707665_SP_P-A Feature FT:CDS JQ707665_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_21). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707667_SP_P-A Feature FT:CDS JQ707667_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_25). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707669_SP_P-A Feature FT:CDS JQ707669_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707670_SP_P-A Feature FT:CDS JQ707670_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_29). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707672_SP_P-A Feature FT:CDS JQ707672_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_32). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707674_SP_P-A Feature FT:CDS JQ707674_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_38). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggaatgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707675_SP_P-A Feature FT:CDS JQ707675_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_41). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707676_SP_P-A Feature FT:CDS JQ707676_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_42). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JQ707681_SP_P-A Feature FT:CDS JQ707681_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_9-12). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|JX096952_SP_P-A Feature FT:CDS JX096952_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11-10165). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggaatgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JX096953_SP_P-A Feature FT:CDS JX096953_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 12-8957). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JX154579_SP_P-A Feature FT:CDS JX154579_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS36). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggaaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JX154580_SP_P-A Feature FT:CDS JX154580_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS46). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JX154581_SP_P-A Feature FT:CDS JX154581_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS51). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JX154582_SP_P-A Feature FT:CDS JX154582_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS64). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JX310721_SP_P-A Feature FT:CDS JX310721_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate D11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JX310722_SP_P-A Feature FT:CDS JX310722_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate D1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JX310723_SP_P-A Feature FT:CDS JX310723_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate D5). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JX310724_SP_P-A Feature FT:CDS JX310724_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate D2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|JX310725_SP_P-A Feature FT:CDS JX310725_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate D3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KC875251_SP_P-A Feature FT:CDS KC875251_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV1). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KC875252_SP_P-A Feature FT:CDS KC875252_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV3). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccaccatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KC875253_SP_P-A Feature FT:CDS KC875253_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV23). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KC875254_SP_P-A Feature FT:CDS KC875254_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV12). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaatagcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KC875255_SP_P-A Feature FT:CDS KC875255_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV24). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KC875256_SP_P-A Feature FT:CDS KC875256_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV27). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KC875257_SP_P-A Feature FT:CDS KC875257_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV14). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcatgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KC875258_SP_P-A Feature FT:CDS KC875258_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV66). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgattccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KC875259_SP_P-A Feature FT:CDS KC875259_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV73). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KC875260_SP_P-A Feature FT:CDS KC875260_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV5). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF214657_SP_P-A Feature FT:CDS KF214657_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF214658_SP_P-A Feature FT:CDS KF214658_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2009-6). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF214659_SP_P-A Feature FT:CDS KF214659_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2009-2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggaaactctatgtttccctcctgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF214660_SP_P-A Feature FT:CDS KF214660_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-9). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF214661_SP_P-A Feature FT:CDS KF214661_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-8). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF214662_SP_P-A Feature FT:CDS KF214662_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-14). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcctgttgctgtacaaaaccta
cggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF214663_SP_P-A Feature FT:CDS KF214663_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2007-11). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF214665_SP_P-A Feature FT:CDS KF214665_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF214666_SP_P-A Feature FT:CDS KF214666_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2010-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggtaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaaccagcac
gggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF779210_SP_P-A Feature FT:CDS KF779210_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN5547). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggagcctactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779211_SP_P-A Feature FT:CDS KF779211_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN5691). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779213_SP_P-A Feature FT:CDS KF779213_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN5744). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgatagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctccacctccgcaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779215_SP_P-A Feature FT:CDS KF779215_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN5763). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgatagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctccacctccgcaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779221_SP_P-A Feature FT:CDS KF779221_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN5934). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatagtgatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779227_SP_P-A Feature FT:CDS KF779227_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6061). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779231_SP_P-A Feature FT:CDS KF779231_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6084). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgcttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779232_SP_P-A Feature FT:CDS KF779232_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6088). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779234_SP_P-A Feature FT:CDS KF779234_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6104). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779238_SP_P-A Feature FT:CDS KF779238_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6119). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779239_SP_P-A Feature FT:CDS KF779239_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6120). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcatacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779240_SP_P-A Feature FT:CDS KF779240_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6123). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779243_SP_P-A Feature FT:CDS KF779243_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6142). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779244_SP_P-A Feature FT:CDS KF779244_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6152). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779245_SP_P-A Feature FT:CDS KF779245_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6156). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779246_SP_P-A Feature FT:CDS KF779246_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6163). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779247_SP_P-A Feature FT:CDS KF779247_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6164). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779248_SP_P-A Feature FT:CDS KF779248_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6168). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779249_SP_P-A Feature FT:CDS KF779249_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6173). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779251_SP_P-A Feature FT:CDS KF779251_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3787). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779252_SP_P-A Feature FT:CDS KF779252_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3809). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779253_SP_P-A Feature FT:CDS KF779253_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3817). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779254_SP_P-A Feature FT:CDS KF779254_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3820). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779255_SP_P-A Feature FT:CDS KF779255_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3825). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779256_SP_P-A Feature FT:CDS KF779256_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3829). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779257_SP_P-A Feature FT:CDS KF779257_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3857). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779258_SP_P-A Feature FT:CDS KF779258_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3864). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779259_SP_P-A Feature FT:CDS KF779259_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3892). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779260_SP_P-A Feature FT:CDS KF779260_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3894). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779261_SP_P-A Feature FT:CDS KF779261_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3896). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779262_SP_P-A Feature FT:CDS KF779262_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3898). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779263_SP_P-A Feature FT:CDS KF779263_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3903). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779264_SP_P-A Feature FT:CDS KF779264_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3945). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgattcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779265_SP_P-A Feature FT:CDS KF779265_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3946). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcttatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779266_SP_P-A Feature FT:CDS KF779266_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3949). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcatgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779268_SP_P-A Feature FT:CDS KF779268_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3966). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcatctctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779269_SP_P-A Feature FT:CDS KF779269_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4207). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779270_SP_P-A Feature FT:CDS KF779270_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4219). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779271_SP_P-A Feature FT:CDS KF779271_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4233). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779272_SP_P-A Feature FT:CDS KF779272_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4236). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcacatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgc
ttctcttggctcagtttactag
>gnl|hbvcds|KF779273_SP_P-A Feature FT:CDS KF779273_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4237). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779274_SP_P-A Feature FT:CDS KF779274_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4259). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779275_SP_P-A Feature FT:CDS KF779275_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4283). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779276_SP_P-A Feature FT:CDS KF779276_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4314). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|KF779277_SP_P-A Feature FT:CDS KF779277_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4322). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779279_SP_P-A Feature FT:CDS KF779279_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4359). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779280_SP_P-A Feature FT:CDS KF779280_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4364). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgc
ttctcttggctcagtttactag
>gnl|hbvcds|KF779281_SP_P-A Feature FT:CDS KF779281_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4390). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779282_SP_P-A Feature FT:CDS KF779282_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4392). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779283_SP_P-A Feature FT:CDS KF779283_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4394). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779284_SP_P-A Feature FT:CDS KF779284_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0574). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagtctcccatatcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779286_SP_P-A Feature FT:CDS KF779286_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0606). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779287_SP_P-A Feature FT:CDS KF779287_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0613). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgctgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779290_SP_P-A Feature FT:CDS KF779290_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0756). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779291_SP_P-A Feature FT:CDS KF779291_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0765). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779293_SP_P-A Feature FT:CDS KF779293_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0787). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcggctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtactcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779294_SP_P-A Feature FT:CDS KF779294_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0796). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcggctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779295_SP_P-A Feature FT:CDS KF779295_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0854). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcctggctcagtttactag
>gnl|hbvcds|KF779297_SP_P-A Feature FT:CDS KF779297_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0874). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctctatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779298_SP_P-A Feature FT:CDS KF779298_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0908). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcggctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779299_SP_P-A Feature FT:CDS KF779299_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0943). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779304_SP_P-A Feature FT:CDS KF779304_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT1039). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779305_SP_P-A Feature FT:CDS KF779305_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT1043). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779306_SP_P-A Feature FT:CDS KF779306_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT1093). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779307_SP_P-A Feature FT:CDS KF779307_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT1227). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779308_SP_P-A Feature FT:CDS KF779308_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT1293). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatcccaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779309_SP_P-A Feature FT:CDS KF779309_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT1294). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779310_SP_P-A Feature FT:CDS KF779310_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF3845). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779311_SP_P-A Feature FT:CDS KF779311_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF3863). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatcccaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779312_SP_P-A Feature FT:CDS KF779312_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF3907). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779313_SP_P-A Feature FT:CDS KF779313_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF3958). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779314_SP_P-A Feature FT:CDS KF779314_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF3985). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779315_SP_P-A Feature FT:CDS KF779315_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4204). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779316_SP_P-A Feature FT:CDS KF779316_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4247). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779317_SP_P-A Feature FT:CDS KF779317_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4308). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779319_SP_P-A Feature FT:CDS KF779319_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4323). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779320_SP_P-A Feature FT:CDS KF779320_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4350). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779321_SP_P-A Feature FT:CDS KF779321_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4362). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779322_SP_P-A Feature FT:CDS KF779322_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4406). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779323_SP_P-A Feature FT:CDS KF779323_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4414). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779324_SP_P-A Feature FT:CDS KF779324_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4416). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779325_SP_P-A Feature FT:CDS KF779325_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4422). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779326_SP_P-A Feature FT:CDS KF779326_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4424). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779328_SP_P-A Feature FT:CDS KF779328_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4532). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779329_SP_P-A Feature FT:CDS KF779329_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4540). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcccagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacttatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779330_SP_P-A Feature FT:CDS KF779330_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4541). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779331_SP_P-A Feature FT:CDS KF779331_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4543). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779332_SP_P-A Feature FT:CDS KF779332_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4549). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779333_SP_P-A Feature FT:CDS KF779333_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4661). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779334_SP_P-A Feature FT:CDS KF779334_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4673). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagctccctatcgccgagtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779335_SP_P-A Feature FT:CDS KF779335_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4687). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779336_SP_P-A Feature FT:CDS KF779336_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4730). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779337_SP_P-A Feature FT:CDS KF779337_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4733). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779338_SP_P-A Feature FT:CDS KF779338_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4756). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779339_SP_P-A Feature FT:CDS KF779339_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4804). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779342_SP_P-A Feature FT:CDS KF779342_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4865). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779344_SP_P-A Feature FT:CDS KF779344_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4928). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779345_SP_P-A Feature FT:CDS KF779345_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4936). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779346_SP_P-A Feature FT:CDS KF779346_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4938). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779347_SP_P-A Feature FT:CDS KF779347_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4950). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779348_SP_P-A Feature FT:CDS KF779348_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4951). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779349_SP_P-A Feature FT:CDS KF779349_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4999). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779350_SP_P-A Feature FT:CDS KF779350_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5005). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779351_SP_P-A Feature FT:CDS KF779351_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5017). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779352_SP_P-A Feature FT:CDS KF779352_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5034). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779354_SP_P-A Feature FT:CDS KF779354_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5084). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779355_SP_P-A Feature FT:CDS KF779355_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5121). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779356_SP_P-A Feature FT:CDS KF779356_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5185). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779358_SP_P-A Feature FT:CDS KF779358_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5263). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779359_SP_P-A Feature FT:CDS KF779359_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5268). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779360_SP_P-A Feature FT:CDS KF779360_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5279). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgctcctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779361_SP_P-A Feature FT:CDS KF779361_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5291). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779362_SP_P-A Feature FT:CDS KF779362_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5296). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779363_SP_P-A Feature FT:CDS KF779363_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5350). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779364_SP_P-A Feature FT:CDS KF779364_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5374). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779365_SP_P-A Feature FT:CDS KF779365_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5380). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779366_SP_P-A Feature FT:CDS KF779366_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5383). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779367_SP_P-A Feature FT:CDS KF779367_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5403). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779368_SP_P-A Feature FT:CDS KF779368_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5421). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779369_SP_P-A Feature FT:CDS KF779369_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5521). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779370_SP_P-A Feature FT:CDS KF779370_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5594). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtcagt
ttctctaggctcagtttactag
>gnl|hbvcds|KF779371_SP_P-A Feature FT:CDS KF779371_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5608). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779372_SP_P-A Feature FT:CDS KF779372_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5654). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779373_SP_P-A Feature FT:CDS KF779373_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5680). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779374_SP_P-A Feature FT:CDS KF779374_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5743). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779375_SP_P-A Feature FT:CDS KF779375_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5760). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779378_SP_P-A Feature FT:CDS KF779378_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PRC6064). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779379_SP_P-A Feature FT:CDS KF779379_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PRC6136). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779381_SP_P-A Feature FT:CDS KF779381_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PRC6268). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779383_SP_P-A Feature FT:CDS KF779383_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PRC6296). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779384_SP_P-A Feature FT:CDS KF779384_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate SFN0061). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ctcccttggctcagtttactag
>gnl|hbvcds|KF779385_SP_P-A Feature FT:CDS KF779385_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate SFN0098). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF779386_SP_P-A Feature FT:CDS KF779386_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate SFN0138). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922406_SP_P-A Feature FT:CDS KF922406_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatctacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922407_SP_P-A Feature FT:CDS KF922407_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatctacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922408_SP_P-A Feature FT:CDS KF922408_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatctacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922409_SP_P-A Feature FT:CDS KF922409_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcggaagatctcaatctcgggaatctcaatgatctacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922414_SP_P-A Feature FT:CDS KF922414_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgagacaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922415_SP_P-A Feature FT:CDS KF922415_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922416_SP_P-A Feature FT:CDS KF922416_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922417_SP_P-A Feature FT:CDS KF922417_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v4). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcatcacttccggaaactactgttgttagacgatgaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922418_SP_P-A Feature FT:CDS KF922418_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v5). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922419_SP_P-A Feature FT:CDS KF922419_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v6). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922420_SP_P-A Feature FT:CDS KF922420_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v7). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922421_SP_P-A Feature FT:CDS KF922421_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v8). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922424_SP_P-A Feature FT:CDS KF922424_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4070v1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922425_SP_P-A Feature FT:CDS KF922425_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4070v2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922426_SP_P-A Feature FT:CDS KF922426_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4312v1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922427_SP_P-A Feature FT:CDS KF922427_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4312v2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922428_SP_P-A Feature FT:CDS KF922428_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4312v3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922429_SP_P-A Feature FT:CDS KF922429_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3274v1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaactcttccggagactactgttgttagacgacgaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922430_SP_P-A Feature FT:CDS KF922430_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3274v2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaactcttccggagactactgttgttagacgacgaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922431_SP_P-A Feature FT:CDS KF922431_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3274v3). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaactcttccggagactactgttgttagacgacgaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922433_SP_P-A Feature FT:CDS KF922433_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3658v1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
gagtacgggaccctgcaaaacctgcacgactcctgctcagaacaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922434_SP_P-A Feature FT:CDS KF922434_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3658v2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
gagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922435_SP_P-A Feature FT:CDS KF922435_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N060v1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaatccttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922436_SP_P-A Feature FT:CDS KF922436_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N060v2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaatccttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KF922437_SP_P-A Feature FT:CDS KF922437_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N060v3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaatccttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ010776_SP_P-A Feature FT:CDS KJ010776_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3358v1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatctacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ010777_SP_P-A Feature FT:CDS KJ010777_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3358v2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatctacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ010778_SP_P-A Feature FT:CDS KJ010778_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3358v3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatctacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ194506_SP_P-A Feature FT:CDS KJ194506_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV_Amsterdam_1_1994). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ586809_SP_P-A Feature FT:CDS KJ586809_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843166_SP_P-A Feature FT:CDS KJ843166_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag04). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843172_SP_P-A Feature FT:CDS KJ843172_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag10). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaattactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaatcta
cggctggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggtctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843173_SP_P-A Feature FT:CDS KJ843173_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag11). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843182_SP_P-A Feature FT:CDS KJ843182_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag21). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843183_SP_P-A Feature FT:CDS KJ843183_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag22). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843184_SP_P-A Feature FT:CDS KJ843184_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag23). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgcttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843186_SP_P-A Feature FT:CDS KJ843186_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag25). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843188_SP_P-A Feature FT:CDS KJ843188_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag27). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843192_SP_P-A Feature FT:CDS KJ843192_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag31). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843214_SP_P-A Feature FT:CDS KJ843214_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag55). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843215_SP_P-A Feature FT:CDS KJ843215_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag56). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843216_SP_P-A Feature FT:CDS KJ843216_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag57). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
caatacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843217_SP_P-A Feature FT:CDS KJ843217_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag62). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacggagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ843218_SP_P-A Feature FT:CDS KJ843218_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag63). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854685_SP_P-A Feature FT:CDS KJ854685_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 116-SE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgtcgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854686_SP_P-A Feature FT:CDS KJ854686_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1356-SE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854687_SP_P-A Feature FT:CDS KJ854687_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1377-SE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854688_SP_P-A Feature FT:CDS KJ854688_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1379-SE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854689_SP_P-A Feature FT:CDS KJ854689_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16202-NE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccccaacaac
cagtacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcaatttactag
>gnl|hbvcds|KJ854690_SP_P-A Feature FT:CDS KJ854690_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16338-NE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854691_SP_P-A Feature FT:CDS KJ854691_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16650-NE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854692_SP_P-A Feature FT:CDS KJ854692_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 17372-NE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854693_SP_P-A Feature FT:CDS KJ854693_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 17545-NE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854694_SP_P-A Feature FT:CDS KJ854694_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 17822-NE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854695_SP_P-A Feature FT:CDS KJ854695_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1814-N-BRA). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854696_SP_P-A Feature FT:CDS KJ854696_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 18158-SE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854697_SP_P-A Feature FT:CDS KJ854697_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1969-SE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854698_SP_P-A Feature FT:CDS KJ854698_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1993-N-BRA). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854699_SP_P-A Feature FT:CDS KJ854699_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2340-N-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggrgtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854700_SP_P-A Feature FT:CDS KJ854700_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 313-N-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854701_SP_P-A Feature FT:CDS KJ854701_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 349-SE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatccacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854702_SP_P-A Feature FT:CDS KJ854702_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 41-CW-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854703_SP_P-A Feature FT:CDS KJ854703_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 65-SE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854704_SP_P-A Feature FT:CDS KJ854704_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 66-CW-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854705_SP_P-A Feature FT:CDS KJ854705_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 67-CW-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854706_SP_P-A Feature FT:CDS KJ854706_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 753-CW-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854707_SP_P-A Feature FT:CDS KJ854707_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 895-N-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854708_SP_P-A Feature FT:CDS KJ854708_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16-S-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854709_SP_P-A Feature FT:CDS KJ854709_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24-S-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgrgaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KJ854710_SP_P-A Feature FT:CDS KJ854710_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 274-SE-BRA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KM243029_SP_P-A Feature FT:CDS KM243029_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate TAC455). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KM519452_SP_P-A Feature FT:CDS KM519452_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_G1862T_Mutant_SA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KM519453_SP_P-A Feature FT:CDS KM519453_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_Wild_SA). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KM519454_SP_P-A Feature FT:CDS KM519454_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A2_WT_BEL). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|KM606737_SP_P-A Feature FT:CDS KM606737_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba13a). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|KM606742_SP_P-A Feature FT:CDS KM606742_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KM606746_SP_P-A Feature FT:CDS KM606746_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba14). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KM606748_SP_P-A Feature FT:CDS KM606748_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba51). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KM606749_SP_P-A Feature FT:CDS KM606749_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba56). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP168422_SP_P-A Feature FT:CDS KP168422_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KN136). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaygwcgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccttgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP168423_SP_P-A Feature FT:CDS KP168423_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate NRB517). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP168424_SP_P-A Feature FT:CDS KP168424_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KSM571). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagttyactag
>gnl|hbvcds|KP168425_SP_P-A Feature FT:CDS KP168425_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MBS119). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP168426_SP_P-A Feature FT:CDS KP168426_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KSM05). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggwcccctagaagaagaact
ccctcgcctcgcmgacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP168427_SP_P-A Feature FT:CDS KP168427_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EMB201). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatctacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggayggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggrgtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP168428_SP_P-A Feature FT:CDS KP168428_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KN195). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgtcgcgaccgaggyaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgctgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP168429_SP_P-A Feature FT:CDS KP168429_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KN033). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP168430_SP_P-A Feature FT:CDS KP168430_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate NRB10). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP168431_SP_P-A Feature FT:CDS KP168431_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KSM03). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatccacaacaac
cagcacggggccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP168432_SP_P-A Feature FT:CDS KP168432_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EMB213). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP168433_SP_P-A Feature FT:CDS KP168433_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate NRB04). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP168434_SP_P-A Feature FT:CDS KP168434_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KSM564). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP168435_SP_P-A Feature FT:CDS KP168435_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MBS117). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggayggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP274925_SP_P-A Feature FT:CDS KP274925_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS-1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacggagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP274927_SP_P-A Feature FT:CDS KP274927_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS-3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP274928_SP_P-A Feature FT:CDS KP274928_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS-4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718085_SP_P-A Feature FT:CDS KP718085_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-12-1-26). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718086_SP_P-A Feature FT:CDS KP718086_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-03-02-1-60). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718087_SP_P-A Feature FT:CDS KP718087_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1897). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718088_SP_P-A Feature FT:CDS KP718088_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1162). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718089_SP_P-A Feature FT:CDS KP718089_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1249). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|KP718090_SP_P-A Feature FT:CDS KP718090_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1348). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718091_SP_P-A Feature FT:CDS KP718091_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1771). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718092_SP_P-A Feature FT:CDS KP718092_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1891). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718093_SP_P-A Feature FT:CDS KP718093_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1202). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718094_SP_P-A Feature FT:CDS KP718094_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8757_TR). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718095_SP_P-A Feature FT:CDS KP718095_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8809_TR). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcagaggcaggtcccctagaagaagaacc
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718096_SP_P-A Feature FT:CDS KP718096_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-0004). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718097_SP_P-A Feature FT:CDS KP718097_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GP13-1943). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718098_SP_P-A Feature FT:CDS KP718098_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3106_HIV). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718099_SP_P-A Feature FT:CDS KP718099_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GP13-378). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718100_SP_P-A Feature FT:CDS KP718100_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 137_HIV). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718101_SP_P-A Feature FT:CDS KP718101_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GP11-3018). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP718102_SP_P-A Feature FT:CDS KP718102_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GP12-1400). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccytcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KP995108_SP_P-A Feature FT:CDS KP995108_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 203-Cirrhosis). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KR905425_SP_P-A Feature FT:CDS KR905425_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-24). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaattgctgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatatttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagttcactag
>gnl|hbvcds|KR905426_SP_P-A Feature FT:CDS KR905426_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactgctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggggtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KR905427_SP_P-A Feature FT:CDS KR905427_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-30). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcaacaacaac
cagcactggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KR905429_SP_P-A Feature FT:CDS KR905429_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-35). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttggggtttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KR905430_SP_P-A Feature FT:CDS KR905430_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-47). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacaggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KR905431_SP_P-A Feature FT:CDS KR905431_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-77). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacaggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT151611_SP_P-A Feature FT:CDS KT151611_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 398). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacaggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcytgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT151612_SP_P-A Feature FT:CDS KT151612_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 500). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagaggaagaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcytgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT151613_SP_P-A Feature FT:CDS KT151613_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 792). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcytgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT151614_SP_P-A Feature FT:CDS KT151614_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 969). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcytgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT151615_SP_P-A Feature FT:CDS KT151615_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 191). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcytgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT151616_SP_P-A Feature FT:CDS KT151616_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 655). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcytgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT151617_SP_P-A Feature FT:CDS KT151617_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 803). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagaggaagaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcytgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT151618_SP_P-A Feature FT:CDS KT151618_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 590). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcytgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT347087_SP_P-A Feature FT:CDS KT347087_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM265). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
gagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT347088_SP_P-A Feature FT:CDS KT347088_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM285). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT347091_SP_P-A Feature FT:CDS KT347091_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM3). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT347092_SP_P-A Feature FT:CDS KT347092_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT366466_SP_P-A Feature FT:CDS KT366466_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.7). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaattgctgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatatttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggggtgggcctcagtccgt
ttctcttggctcagttcactag
>gnl|hbvcds|KT366467_SP_P-A Feature FT:CDS KT366467_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.9). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactgctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggggtgggcctcagcccgt
ttctcttggctcaatttactag
>gnl|hbvcds|KT366468_SP_P-A Feature FT:CDS KT366468_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.27). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacaggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT366469_SP_P-A Feature FT:CDS KT366469_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.28). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT366470_SP_P-A Feature FT:CDS KT366470_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.31). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacaggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT366471_SP_P-A Feature FT:CDS KT366471_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.50). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749822_SP_P-A Feature FT:CDS KT749822_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL19). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacaccgggaccgaggcaggtctcctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacttgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749824_SP_P-A Feature FT:CDS KT749824_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL2b). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749825_SP_P-A Feature FT:CDS KT749825_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4a). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749826_SP_P-A Feature FT:CDS KT749826_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4b). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749829_SP_P-A Feature FT:CDS KT749829_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL7). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749830_SP_P-A Feature FT:CDS KT749830_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL5b). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749831_SP_P-A Feature FT:CDS KT749831_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL8). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749832_SP_P-A Feature FT:CDS KT749832_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL10). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749833_SP_P-A Feature FT:CDS KT749833_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL9b). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggaaggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749834_SP_P-A Feature FT:CDS KT749834_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL9a). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcatacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|KT749835_SP_P-A Feature FT:CDS KT749835_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL9c). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749836_SP_P-A Feature FT:CDS KT749836_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL12). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749837_SP_P-A Feature FT:CDS KT749837_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL15). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749838_SP_P-A Feature FT:CDS KT749838_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL16). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749839_SP_P-A Feature FT:CDS KT749839_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL5d). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaacaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|KT749840_SP_P-A Feature FT:CDS KT749840_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL18). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749842_SP_P-A Feature FT:CDS KT749842_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4e). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749843_SP_P-A Feature FT:CDS KT749843_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL5c). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749844_SP_P-A Feature FT:CDS KT749844_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL25). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KT749846_SP_P-A Feature FT:CDS KT749846_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4f). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|KT749847_SP_P-A Feature FT:CDS KT749847_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4d). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|KT749849_SP_P-A Feature FT:CDS KT749849_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4c). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgt
ttctcatggctcagtttactag
>gnl|hbvcds|KT749850_SP_P-A Feature FT:CDS KT749850_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL21). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KU605532_SP_P-A Feature FT:CDS KU605532_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1486Baseline). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KU605533_SP_P-A Feature FT:CDS KU605533_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM8787Baseline). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KU605534_SP_P-A Feature FT:CDS KU605534_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM8787F2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KU605535_SP_P-A Feature FT:CDS KU605535_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1163Baseline). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KU605536_SP_P-A Feature FT:CDS KU605536_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643Baseline). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaaccacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KU605537_SP_P-A Feature FT:CDS KU605537_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643F1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaaccacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KU605538_SP_P-A Feature FT:CDS KU605538_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643F2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaaccacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KU605539_SP_P-A Feature FT:CDS KU605539_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643F3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaaccacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KU736918_SP_P-A Feature FT:CDS KU736918_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Tanzania_1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KU736919_SP_P-A Feature FT:CDS KU736919_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Tanzania_2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgrgaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KU736920_SP_P-A Feature FT:CDS KU736920_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Sudan_10). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX276769_SP_P-A Feature FT:CDS KX276769_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggstttcgyaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX357640_SP_P-A Feature FT:CDS KX357640_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AA11ETH). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX357642_SP_P-A Feature FT:CDS KX357642_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JM16ETH). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX357643_SP_P-A Feature FT:CDS KX357643_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MK156ETH). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacgac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX357644_SP_P-A Feature FT:CDS KX357644_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AA152ETH). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaaacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX357645_SP_P-A Feature FT:CDS KX357645_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AA162ETH). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX357646_SP_P-A Feature FT:CDS KX357646_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BL185ETH). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
tggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX357647_SP_P-A Feature FT:CDS KX357647_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BL13ETH). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX357649_SP_P-A Feature FT:CDS KX357649_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AA86ETH). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgtcgagacagaggcaggtccactagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX357650_SP_P-A Feature FT:CDS KX357650_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AA46ETH). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX648547_SP_P-A Feature FT:CDS KX648547_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Zi12_103). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcygcggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggatcctgcaaaacctgcacgactcctgctcaaggcaactctatttttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|KX648548_SP_P-A Feature FT:CDS KX648548_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Zi14_091). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|KX648549_SP_P-A Feature FT:CDS KX648549_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Zi14_172). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgagaccgaggcaggkcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcaatttactag
>gnl|hbvcds|KX827293_SP_P-A Feature FT:CDS KX827293_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno5.4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX827294_SP_P-A Feature FT:CDS KX827294_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno6.2). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX827295_SP_P-A Feature FT:CDS KX827295_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno6.3). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX827296_SP_P-A Feature FT:CDS KX827296_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno6.5). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX827297_SP_P-A Feature FT:CDS KX827297_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno9.1). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcagtcgccgcgtcgcagargatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KX827298_SP_P-A Feature FT:CDS KX827298_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno9.4). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KY003230_SP_P-A Feature FT:CDS KY003230_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 20160922). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KY382410_SP_P-A Feature FT:CDS KY382410_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A2_wt). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|KY886219_SP_P-A Feature FT:CDS KY886219_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|L13994_SP_P-A Feature FT:CDS L13994_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|LC051141_SP_P-A Feature FT:CDS LC051141_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB14-0620). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|LC074724_SP_P-A Feature FT:CDS LC074724_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate p621). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|LC311241_SP_P-A Feature FT:CDS LC311241_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate p509). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|LC311242_SP_P-A Feature FT:CDS LC311242_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate p90). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|LC311243_SP_P-A Feature FT:CDS LC311243_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate p121). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|LC430617_SP_P-A Feature FT:CDS LC430617_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 78556-102). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|LC458430_SP_P-A Feature FT:CDS LC458430_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JRC-HB01). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|LC458431_SP_P-A Feature FT:CDS LC458431_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JRC-HB03). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|LC462120_SP_P-A Feature FT:CDS LC462120_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|LT992440_SP_P-A Feature FT:CDS LT992440_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DA119). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|LT992441_SP_P-A Feature FT:CDS LT992441_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DA195). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcaacaacgaccagtac
gggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccttcggatg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT992448_SP_P-A Feature FT:CDS LT992448_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RISE386). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcctcgaccaccagtac
gggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggatg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|M57663_SP_P-A Feature FT:CDS M57663_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF772344_SP_P-A Feature FT:CDS MF772344_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate SV1662). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggcccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF772345_SP_P-A Feature FT:CDS MF772345_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1959). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccatgcaagacctgcacaactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF772346_SP_P-A Feature FT:CDS MF772346_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 855_16). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF772347_SP_P-A Feature FT:CDS MF772347_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 970). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacaattccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccgtcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF772348_SP_P-A Feature FT:CDS MF772348_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate SV120). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF772350_SP_P-A Feature FT:CDS MF772350_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 64106). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF772351_SP_P-A Feature FT:CDS MF772351_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1141). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF772353_SP_P-A Feature FT:CDS MF772353_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate SV580). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaagatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF925361_SP_P-A Feature FT:CDS MF925361_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV04). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF925362_SP_P-A Feature FT:CDS MF925362_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV05). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggccaaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF925368_SP_P-A Feature FT:CDS MF925368_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV12). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF925372_SP_P-A Feature FT:CDS MF925372_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV16). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF925373_SP_P-A Feature FT:CDS MF925373_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV17). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgagaccgaggcagggcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF925385_SP_P-A Feature FT:CDS MF925385_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV29). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF925400_SP_P-A Feature FT:CDS MF925400_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV46). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MF925407_SP_P-A Feature FT:CDS MF925407_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV54). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464807_SP_P-A Feature FT:CDS MH464807_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA85). Partial genome (Contains: HBe, HBc, HBx). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaatacttccggagacttctgttgttagatgtcgaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacaggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtataaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464808_SP_P-A Feature FT:CDS MH464808_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA86). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttcckgaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggrgtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464809_SP_P-A Feature FT:CDS MH464809_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA87). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagatgccgagctcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggcccagtttactag
>gnl|hbvcds|MH464810_SP_P-A Feature FT:CDS MH464810_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA88). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464811_SP_P-A Feature FT:CDS MH464811_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA89). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagatgccgagctcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgackcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464812_SP_P-A Feature FT:CDS MH464812_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA90). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464813_SP_P-A Feature FT:CDS MH464813_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA91). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464814_SP_P-A Feature FT:CDS MH464814_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA92). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464815_SP_P-A Feature FT:CDS MH464815_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA93). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464816_SP_P-A Feature FT:CDS MH464816_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA94). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464817_SP_P-A Feature FT:CDS MH464817_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA95). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcgaaacaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464818_SP_P-A Feature FT:CDS MH464818_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA96). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464819_SP_P-A Feature FT:CDS MH464819_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA97). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464820_SP_P-A Feature FT:CDS MH464820_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA98). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccctgcaaaacctacacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464821_SP_P-A Feature FT:CDS MH464821_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA99). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464822_SP_P-A Feature FT:CDS MH464822_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA100). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464823_SP_P-A Feature FT:CDS MH464823_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA101). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=342 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagatgccgagctcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaataacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggcccagtttactag
>gnl|hbvcds|MH464824_SP_P-A Feature FT:CDS MH464824_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA102). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464825_SP_P-A Feature FT:CDS MH464825_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA103). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464826_SP_P-A Feature FT:CDS MH464826_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA104). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464827_SP_P-A Feature FT:CDS MH464827_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA105). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464828_SP_P-A Feature FT:CDS MH464828_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA106). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464829_SP_P-A Feature FT:CDS MH464829_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA107). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaaatctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH464830_SP_P-A Feature FT:CDS MH464830_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA108). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MH580627_SP_P-A Feature FT:CDS MH580627_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 299). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|MH580639_SP_P-A Feature FT:CDS MH580639_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 420). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|MH580642_SP_P-A Feature FT:CDS MH580642_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 443). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|MH580643_SP_P-A Feature FT:CDS MH580643_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 446). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|MH932713_SP_P-A Feature FT:CDS MH932713_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Hiroshima GtA CL1). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512455_SP_P-A Feature FT:CDS MK512455_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2079). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctaaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgattccctcatgttgctgtacaaaaccta
cggacgggaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggcccagtttactag
>gnl|hbvcds|MK512456_SP_P-A Feature FT:CDS MK512456_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw3531). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512457_SP_P-A Feature FT:CDS MK512457_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw3173). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512458_SP_P-A Feature FT:CDS MK512458_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2244). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512459_SP_P-A Feature FT:CDS MK512459_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2226). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512460_SP_P-A Feature FT:CDS MK512460_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2199). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcaaacaaaaatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512461_SP_P-A Feature FT:CDS MK512461_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2157). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512462_SP_P-A Feature FT:CDS MK512462_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2113). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcattttcctag
>gnl|hbvcds|MK512463_SP_P-A Feature FT:CDS MK512463_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2086). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacaaagatctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512464_SP_P-A Feature FT:CDS MK512464_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2016). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttcttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatttcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512465_SP_P-A Feature FT:CDS MK512465_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2003). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512466_SP_P-A Feature FT:CDS MK512466_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-226). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512467_SP_P-A Feature FT:CDS MK512467_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-220). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512468_SP_P-A Feature FT:CDS MK512468_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-203). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgattccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512469_SP_P-A Feature FT:CDS MK512469_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-136). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|MK512470_SP_P-A Feature FT:CDS MK512470_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-126). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512471_SP_P-A Feature FT:CDS MK512471_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-120). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512472_SP_P-A Feature FT:CDS MK512472_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-65). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512473_SP_P-A Feature FT:CDS MK512473_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-48). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512474_SP_P-A Feature FT:CDS MK512474_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-37). Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgccccgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512475_SP_P-A Feature FT:CDS MK512475_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-25). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagcacgggaccctgcaaaacctgcacgactcctgctcaaagcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcaatttactag
>gnl|hbvcds|MK512476_SP_P-A Feature FT:CDS MK512476_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-14). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MK512477_SP_P-A Feature FT:CDS MK512477_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-03). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagatgtcgagtccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatccacaacaac
cagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MN507849_SP_P-A Feature FT:CDS MN507849_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2488_ocHBVa_GC). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagcccgt
ttctcttggctcagtttactag
>gnl|hbvcds|MN544634_SP_P-A Feature FT:CDS MN544634_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CG-0018a-01). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatccacaaccac
cagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcctggctcagtttactag
>gnl|hbvcds|V00866_SP_P-A Feature FT:CDS V00866_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctaagtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|X02763_SP_C-A Feature FT:CDS X02763_SP_C-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctccatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|X51970_SP_P-A Feature FT:CDS X51970_SP_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|X70185_SP_P-A Feature FT:CDS X70185_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A938). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|Z35717_SP_P-A Feature FT:CDS Z35717_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate hb614). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|Z72478_SP_P-A Feature FT:CDS Z72478_SP_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A317). Complete genome. [Hepadnaviridae] (length=342 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaac
cagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccta
cggttggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgt
ttctcttggctcagtttactag
>gnl|hbvcds|AB010289_SP_P-B Feature FT:CDS AB010289_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB010290_SP_P-B Feature FT:CDS AB010290_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB010291_SP_P-B Feature FT:CDS AB010291_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB010292_SP_P-B Feature FT:CDS AB010292_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB014366_SP_P-B Feature FT:CDS AB014366_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 07D07HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB031266_SP_P-B Feature FT:CDS AB031266_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-3). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB031267_SP_P-B Feature FT:CDS AB031267_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB033554_SP_P-B Feature FT:CDS AB033554_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate RTB299). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcatcaaccaccagcac
aggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB033555_SP_P-B Feature FT:CDS AB033555_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAD744). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccccgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB048705_SP_P-B Feature FT:CDS AB048705_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcaacgaccaccagcac
gggaccttgcagaacctgcacgatcactgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB073821_SP_P-B Feature FT:CDS AB073821_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaygaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073822_SP_P-B Feature FT:CDS AB073822_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073823_SP_P-B Feature FT:CDS AB073823_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatccctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073824_SP_P-B Feature FT:CDS AB073824_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcgtcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073825_SP_P-B Feature FT:CDS AB073825_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi51). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073826_SP_P-B Feature FT:CDS AB073826_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi89). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073827_SP_P-B Feature FT:CDS AB073827_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073828_SP_P-B Feature FT:CDS AB073828_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgttcaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073829_SP_P-B Feature FT:CDS AB073829_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073830_SP_P-B Feature FT:CDS AB073830_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH57). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacrcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073831_SP_P-B Feature FT:CDS AB073831_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH61). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073832_SP_P-B Feature FT:CDS AB073832_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Th65). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073833_SP_P-B Feature FT:CDS AB073833_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi59). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073834_SP_P-B Feature FT:CDS AB073834_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073835_SP_P-B Feature FT:CDS AB073835_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073836_SP_P-B Feature FT:CDS AB073836_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073837_SP_P-B Feature FT:CDS AB073837_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ku1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcatgggcttccgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073838_SP_P-B Feature FT:CDS AB073838_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ho7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacaacgaygcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073839_SP_P-B Feature FT:CDS AB073839_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw174). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073840_SP_P-B Feature FT:CDS AB073840_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073841_SP_P-B Feature FT:CDS AB073841_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073842_SP_P-B Feature FT:CDS AB073842_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw11). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcttcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073843_SP_P-B Feature FT:CDS AB073843_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcaccactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073844_SP_P-B Feature FT:CDS AB073844_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-T11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073845_SP_P-B Feature FT:CDS AB073845_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ya16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073846_SP_P-B Feature FT:CDS AB073846_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry565). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccacgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073847_SP_P-B Feature FT:CDS AB073847_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Fu53). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073848_SP_P-B Feature FT:CDS AB073848_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HUS). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073849_SP_P-B Feature FT:CDS AB073849_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na101). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttstgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcrccgcgtcgcagaagatctcaatctagggaaccccaatgatcatcaaccaccagcac
gggrccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073850_SP_P-B Feature FT:CDS AB073850_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na102). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073851_SP_P-B Feature FT:CDS AB073851_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacagctcctgctcaaggaaactttacgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttcttt
tggctcagtttactag
>gnl|hbvcds|AB073852_SP_P-B Feature FT:CDS AB073852_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073853_SP_P-B Feature FT:CDS AB073853_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073854_SP_P-B Feature FT:CDS AB073854_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073855_SP_P-B Feature FT:CDS AB073855_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry34). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgagggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073856_SP_P-B Feature FT:CDS AB073856_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry46). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatccttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcataagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073857_SP_P-B Feature FT:CDS AB073857_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry48). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccactgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073858_SP_P-B Feature FT:CDS AB073858_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Shin). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctaggggatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB100695_SP_P-B Feature FT:CDS AB100695_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH133). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccccccttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB106884_SP_P-B Feature FT:CDS AB106884_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB115551_SP_P-B Feature FT:CDS AB115551_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB117759_SP_P-B Feature FT:CDS AB117759_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcgaaacccctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB195933_SP_P-B Feature FT:CDS AB195933_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB195934_SP_P-B Feature FT:CDS AB195934_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB195935_SP_P-B Feature FT:CDS AB195935_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB205119_SP_P-B Feature FT:CDS AB205119_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB205120_SP_P-B Feature FT:CDS AB205120_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggcttccgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB205121_SP_P-B Feature FT:CDS AB205121_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF720-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB205122_SP_P-B Feature FT:CDS AB205122_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH69-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcccgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB212625_SP_P-B Feature FT:CDS AB212625_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1026). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaacaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB212626_SP_P-B Feature FT:CDS AB212626_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1022). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatggttccctcatgttgctgtacaaaacctacggaca
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB219426_SP_P-B Feature FT:CDS AB219426_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4014, PNN1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB219427_SP_P-B Feature FT:CDS AB219427_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4075, PNN2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctacggaag
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB219428_SP_C-B Feature FT:CDS AB219428_SP_C-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4076, PNN3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB219429_SP_P-B Feature FT:CDS AB219429_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4101, PNN4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB219430_SP_P-B Feature FT:CDS AB219430_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4148, PNN5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB231909_SP_P-B Feature FT:CDS AB231909_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VH10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtttcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
tggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB241116_SP_P-B Feature FT:CDS AB241116_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC03). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctacgtttccctcctgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB241117_SP_P-B Feature FT:CDS AB241117_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC05). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctacgtttccctcctgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB246339_SP_P-B Feature FT:CDS AB246339_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB246340_SP_P-B Feature FT:CDS AB246340_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB246341_SP_P-B Feature FT:CDS AB246341_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggatcatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB246342_SP_P-B Feature FT:CDS AB246342_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB246343_SP_P-B Feature FT:CDS AB246343_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287314_SP_P-B Feature FT:CDS AB287314_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska433). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287315_SP_P-B Feature FT:CDS AB287315_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska419). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287316_SP_P-B Feature FT:CDS AB287316_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska427). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287317_SP_P-B Feature FT:CDS AB287317_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska416). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaagatctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287318_SP_P-B Feature FT:CDS AB287318_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287319_SP_P-B Feature FT:CDS AB287319_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AlaskaG23). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287320_SP_P-B Feature FT:CDS AB287320_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287321_SP_P-B Feature FT:CDS AB287321_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctattattagacgacgaggcaggagccctagaagaagaactccctcg
cctcgcagacccagatctcaatcaccgcgtcgcagaagatctcaatctcggggaccccaatgatcatcaaccaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287322_SP_P-B Feature FT:CDS AB287322_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287323_SP_P-B Feature FT:CDS AB287323_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaccaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287324_SP_P-B Feature FT:CDS AB287324_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-5). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgatgcaggtccactggaagaagaactccctcg
cctcgcagaccaagatctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287325_SP_P-B Feature FT:CDS AB287325_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaagggacctctatgtttccctcatgttgttgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287326_SP_P-B Feature FT:CDS AB287326_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacatctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287327_SP_P-B Feature FT:CDS AB287327_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A53). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgcaggtctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287328_SP_P-B Feature FT:CDS AB287328_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba 51). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287329_SP_P-B Feature FT:CDS AB287329_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba A55). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB300364_SP_P-B Feature FT:CDS AB300364_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB300370_SP_P-B Feature FT:CDS AB300370_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctagggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB300371_SP_P-B Feature FT:CDS AB300371_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaactcttccggaaactactgttgttagacaacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB302095_SP_P-B Feature FT:CDS AB302095_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaaactcttcgattccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcgtcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB302942_SP_P-B Feature FT:CDS AB302942_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3837NN). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB302943_SP_P-B Feature FT:CDS AB302943_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3639NN). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB302944_SP_P-B Feature FT:CDS AB302944_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3641NN). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB302945_SP_P-B Feature FT:CDS AB302945_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3643NN). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaacatgcaaaacctgcacgactcctgttcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB362933_SP_P-B Feature FT:CDS AB362933_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccacaagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB365445_SP_P-B Feature FT:CDS AB365445_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BOL1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB368295_SP_P-B Feature FT:CDS AB368295_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB471854_SP_P-B Feature FT:CDS AB471854_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-F). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB471855_SP_P-B Feature FT:CDS AB471855_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-C). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB493827_SP_P-B Feature FT:CDS AB493827_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25UC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB493833_SP_P-B Feature FT:CDS AB493833_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB493835_SP_P-B Feature FT:CDS AB493835_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB555498_SP_P-B Feature FT:CDS AB555498_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB555499_SP_P-B Feature FT:CDS AB555499_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA62). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB642093_SP_P-B Feature FT:CDS AB642093_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacgacgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaaaacmtgcacaactcctgctcaaggaacctctatgtttccctcatgctgytgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcrtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB642094_SP_P-B Feature FT:CDS AB642094_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacractactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB642101_SP_P-B Feature FT:CDS AB642101_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT2009-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctagggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB675676_SP_P-B Feature FT:CDS AB675676_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10A37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB713527_SP_P-B Feature FT:CDS AB713527_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcatggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB713528_SP_P-B Feature FT:CDS AB713528_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctatggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB713529_SP_P-B Feature FT:CDS AB713529_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv68). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaaactctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB713530_SP_P-B Feature FT:CDS AB713530_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv94). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaaactctatgtttccctcatggtgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
gggctcagtttactag
>gnl|hbvcds|AB713531_SP_P-B Feature FT:CDS AB713531_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv98). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB713532_SP_P-B Feature FT:CDS AB713532_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv132). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcatggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB828708_SP_P-B Feature FT:CDS AB828708_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HB12-0626). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcrccgcgtcgcagaagatctcaatctcgggactctcaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900095_SP_P-B Feature FT:CDS AB900095_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900096_SP_P-B Feature FT:CDS AB900096_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900097_SP_P-B Feature FT:CDS AB900097_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgcaggtctcaatcgccgcgtcgcagaagatctcaatctagggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctwtgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900098_SP_P-B Feature FT:CDS AB900098_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900102_SP_P-B Feature FT:CDS AB900102_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900103_SP_P-B Feature FT:CDS AB900103_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900104_SP_P-B Feature FT:CDS AB900104_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900105_SP_P-B Feature FT:CDS AB900105_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900106_SP_P-B Feature FT:CDS AB900106_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcctcaaccaccagcac
gggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB900107_SP_P-B Feature FT:CDS AB900107_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccctgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900108_SP_P-B Feature FT:CDS AB900108_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccgatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900110_SP_P-B Feature FT:CDS AB900110_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900111_SP_P-B Feature FT:CDS AB900111_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=339 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggatcgatcccaatgatcatcraccaccag
cacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacgg
acggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttc
tcttggctcagtttactag
>gnl|hbvcds|AB900112_SP_P-B Feature FT:CDS AB900112_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB931168_SP_P-B Feature FT:CDS AB931168_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1P_HB11-1417). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB931169_SP_P-B Feature FT:CDS AB931169_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1S_HB11-1418). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB976562_SP_P-B Feature FT:CDS AB976562_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AK8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF100308_SP_P-B Feature FT:CDS AF100308_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF100309_SP_P-B Feature FT:CDS AF100309_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121243_SP_P-B Feature FT:CDS AF121243_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/14611). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121244_SP_P-B Feature FT:CDS AF121244_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/15122). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121245_SP_P-B Feature FT:CDS AF121245_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/16091). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121246_SP_P-B Feature FT:CDS AF121246_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/IK29902). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121247_SP_P-B Feature FT:CDS AF121247_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/719). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacrrctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgyaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121248_SP_P-B Feature FT:CDS AF121248_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/139-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagttcactag
>gnl|hbvcds|AF121249_SP_P-B Feature FT:CDS AF121249_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/4014). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121250_SP_P-B Feature FT:CDS AF121250_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/6395). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121251_SP_P-B Feature FT:CDS AF121251_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/9873). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF282917_SP_P-B Feature FT:CDS AF282917_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
tggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF282918_SP_P-B Feature FT:CDS AF282918_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF461360_SP_P-B Feature FT:CDS AF461360_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH14-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagttcactag
>gnl|hbvcds|AF461362_SP_P-B Feature FT:CDS AF461362_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH10). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
tggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF479684_SP_P-B Feature FT:CDS AF479684_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3c). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacggagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AJ627225_SP_P-B Feature FT:CDS AJ627225_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 19749). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011084_SP_P-B Feature FT:CDS AP011084_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011085_SP_P-B Feature FT:CDS AP011085_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011086_SP_P-B Feature FT:CDS AP011086_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatatttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011087_SP_P-B Feature FT:CDS AP011087_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011088_SP_P-B Feature FT:CDS AP011088_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011089_SP_P-B Feature FT:CDS AP011089_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011090_SP_P-B Feature FT:CDS AP011090_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011091_SP_P-B Feature FT:CDS AP011091_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011092_SP_P-B Feature FT:CDS AP011092_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011093_SP_P-B Feature FT:CDS AP011093_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011094_SP_P-B Feature FT:CDS AP011094_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011095_SP_P-B Feature FT:CDS AP011095_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011096_SP_P-B Feature FT:CDS AP011096_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY033072_SP_P-B Feature FT:CDS AY033072_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacg
gaaactgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY033073_SP_P-B Feature FT:CDS AY033073_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacg
gaaactgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AY163869_SP_P-B Feature FT:CDS AY163869_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMClx-1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatgttaatgatcatcaacaaccagcac
gggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY163870_SP_P-B Feature FT:CDS AY163870_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMU001). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatgttaatgatcatcaacaaccagcac
gggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167089_SP_P-B Feature FT:CDS AY167089_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttgtcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167093_SP_P-B Feature FT:CDS AY167093_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIa). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaaggcgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167094_SP_P-B Feature FT:CDS AY167094_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIb). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctnaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacanctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167097_SP_P-B Feature FT:CDS AY167097_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIIb). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167098_SP_P-B Feature FT:CDS AY167098_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IVa). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167100_SP_P-B Feature FT:CDS AY167100_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Va). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167101_SP_P-B Feature FT:CDS AY167101_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vb). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167102_SP_P-B Feature FT:CDS AY167102_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vc). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccattatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY206375_SP_P-B Feature FT:CDS AY206375_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaaccgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY206383_SP_P-B Feature FT:CDS AY206383_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagagcaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY206387_SP_P-B Feature FT:CDS AY206387_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacgcttccggaaactactgttgttagacggagatgcaggtcccctagaagaggaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaacaaccagcac
cggagcatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
caaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY206390_SP_P-B Feature FT:CDS AY206390_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY206391_SP_P-B Feature FT:CDS AY206391_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217355_SP_P-B Feature FT:CDS AY217355_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A6-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217356_SP_P-B Feature FT:CDS AY217356_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A9-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217357_SP_P-B Feature FT:CDS AY217357_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1r-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217358_SP_P-B Feature FT:CDS AY217358_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B8r-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY