HBVdb

Genotype

A tool to genotype HBV sequence(s).

Paste a nucleotide sequence below (hide help):

OR upload a file in Pearson/FASTA format (limit 20MB):

Warning: most of the errors with the Genotyping tools come from not correctly formatted/supported (e.g. ref|accession) FASTA sequence header in the file. If you have doubt just use >accession as sequence header and use a different accession for each sequence.

Nucleotide sequence:
>gnl|hbvnuc|AB330367_P_CD
aaaccctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggggaccc
tgcgctgaacatggagaacatcacatcaggattcctaggacccctactcgtgttacaggc
ggggtttttcttgttgacaagaatcctaacaataccgcagagtctagactcgtggtggac
ttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgcttgatgtgtct
gcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttct
tctggactatcgaggtatgttgcccgtttgccctctaattccaggatcttcaaccaccag
cacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggc
tttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagt
gccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggat
gatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggtcac
tctctacatttcatgggctatgtcattggatgttatgggtccttgccacaagatcacatc
agacagaaaatcaaagaatgttttaggaaacttcctgttaacaggcctattgattggaaa
gtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacgcaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgcca
acatacaaggcctttttgtgcaaacaatacctgaacctttaccccgttgcccggcaacgg
ccaggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggc
catcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgtt
gttctctcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatc
ctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttct
cggggccgattgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcac
ttcgcttcacctctgcacgtcgcatggagaccaccgtga

© 1998-2020Legal notice