HBVdb

Dataset for nucleotide sequence PreC of genotype RF

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                 *   *   *               *      
ATGCAACTTTTTCAC---------CTCTGCCTAATCATCT---CaTGTTCATGTCCTACTGTTCAAGCCTCCAAGCTGTG
   t        g agagcatgag    c gg g------   tt- gg gaa   c                       
                                           --   a                               
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *     ** * *  * * **                                    * *    *        *  *  
CCTTGGGTGGCTTTgGGgCATG------------------------------------GACATtGACCCtTATAAAGAAT
      a        a    gatagaacaactttgccatatggcctttttggctta     c  ta g          
                                                                   a          
                                                                     c          

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **              *              *        * *  *                       **       
TTGGAGCTtCTGTGGAGTTACTCTCtTTTTTGCCTTCTGAcTTCTTTCCtTCtaTtCGaGATCTcCTcGAcACCGCctCa
       ga ctc      g     g         gac  t  t ac  g  ag aa g  c  t  a  t  t  tg t
       a  a              a         a             a  c  c  t     a  t     a  aa c
                                   c                g     c                    g

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *  *     *  *          *              *  ** **  *                 * **
GCTcTgTATCGGGAgGCCTTAGAGTCTCCgGAaCATTGtTCACCTCACCATACaGCACTCAGGCAAGCtATTcTgTGtTG
  ct actca  tt gc    ag ct t  g  c  ca gg    t  c  t  ca a       aag ct t  c  
  g  c        a  t              t        t           g            c  ag c     
                 a                                   c                    a     

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *                ****  *      *  *              *     *               * 
GGGtGAgtTgATGAaTcTgGCcACCTGGGTGGGaagTAATTTGGAAGAtCCAGCATCcAGgGAatTAGTAGTCAGtTATG
  tg  ac a    cct a  t  t        tgta     ac c  c atatc  tc a  cccga g  agac    
   a  c           t              c c                           tga   t  t       
      t                            a                                            

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*                 * **       *   *     ** * *     *              *              
TcAAtgtTAATATGGGCCTAAAaaTcAGaCAAcTatTGTGGTTTCACATTTCcTGTCTtACTTTTGGaAGAGAAACtGTt
 t  cac c cg    tt g  gt t  g   t cc a        tg    t  c  c tg     g a c c  c  c
                       c        a g            c    a     g  c           t  g  a
                                                             a           g  a  g

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *   *  *    *     * *    * *   *  *        *    **     * **   * ** ** *   
cTtGAgTATTTGGTgTCTTTtGGAGTGTGGATTCGCACTCCTcCcGCtTAcAGACCACCAAATGCCCCTATCtTATCAAC
a a  a  c     a  c  c           c        caaac a  t      tat            c    c  
t g           c  a                         tt  c                                
g                                                                               

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ***   *   *    *      *                                  **     *            *
ACTTCCGGAaACTACTGTTGTTAGACG------A------c------GAG------GCAGGTCCCCTAGAAGAAGAACTC
         g   tg a  a     ta             agggaca  t           a     c     c      
                         g              -     c                                 
                                                                                

       650       660       670       680       690       700       710 
....:....|....:....|....:....|....:....|....:....|....:....|....:....|.
   *         *            *   *            *       **       *    **    
CCTCGCCTCGCAGACGAAGgTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCtCAATGTTAG
    a           cc a        a         c     a  gc     ca ctc ct       a
                                               a         gc   a        
                                                                       
© 1998-2020Legal notice