HBVdb

Dataset for nucleotide sequence C of genotype RF

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                              *        *  *  * **              *
ATGG------------------------------------ACATtGACCCtTATAAAGAATTTGGAGCTtCTGTGGAGTT
    atagaacaactttgccatatggcctttttggcttag    c  ta g                 ga ctc      
                                                  a                 a  a        
                                                  c                             

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
              *        * *  *                       **                 *  *     
ACTCTCtTTTTTGCCTTCTGAcTTCTTTCCtTCtaTtCGaGATCTcCTcGAcACCGCctCaGCTcTgTATCGGGAgGCCT
g     g         gac  t  t ac  g  ag aa g  c  t  a  t  t  tg t  ct actca  tt gc
      a         a             a  c  c  t     a  t     a  aa c  g  c        a  t 
                c                g     c                    g                 a 

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *          *              *  ** **  *                 * **        *          
TAGAGTCTCCgGAaCATTGtTCACCTCACCATACaGCACTCAGGCAAGCtATTcTgTGtTGGGGtGAgtTgATGAaTcTg
    ag ct t  g  c  ca gg    t  c  t  ca a       aag ct t  c    tg  ac a    cct a
             t        t           g            c  ag c        a  c           t
                                  c                    a           t            

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      ****  *      *  *              *     *               * *                 *
GCcACCTGGGTGGGaagTAATTTGGAAGAtCCAGCATCcAGgGAatTAGTAGTCAGtTATGTcAAtgtTAATATGGGCCT
  t  t        tgta     ac c  c atatc  tc a  cccga g  agac     t  cac c cg    tt 
              c c                           tga   t  t                          
                a                                                               

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **       *   *     ** * *     *              *                    *   *  *    *
AAAaaTcAGaCAAcTatTGTGGTTTCACATTTCcTGTCTtACTTTTGGaAGAGAAACtGTtcTtGAgTATTTGGTgTCTT
g  gt t  g   t cc a        tg a  t  c  c tg     g a c c  c  ca a  a  c     a  c 
    c        a g            c    a     g  c           t  g  at g           c  a 
                                          a           g  a  gg                  

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     * *    * *   *  *        *    **     * **   * ** ** *     ***   *   *    * 
TtGGAGTGTGGATTCGCACTCCTcCcGCtTAcAGACCACCAAATGCCCCTATCtTATCAACACTTCCGGAaACTACTGTT
 c           c        caaac a  t      tat            c    c           g   tg a  
                        tt  c                                                   
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *                                  **     *            *   *         *     
GTTAGACG------A------c------GAG------GCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAG
a     ta             agggaca  t           a     c     c          a           cc 
      g              -     c                                                    
                                                                                

       570       580       590       600       610  
....:....|....:....|....:....|....:....|....:....|..
       *   *            *       **       *    **    
gTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCtCAATGTTAG
a        a         c     a  gc     ca ctc ct       a
                            a         gc   a        
                                                    
© 1998-2020Legal notice