Dataset for nucleotide sequence C of genotype RF

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
                                              *        *  *    *               *
   gatagaacaactttgccatatggcctttttggctta     c  ta t                 ga ctc      
                                                  a                 a  a        

        90       100       110       120       130       140       150       160
                         *  *                       **                 *  *     
g     g         ga   t  t  c  gg ag aa g  c  ta a  t  t  tg t  ct actca  tt tc
      a         a             a  c  c  t     a  t     a  aa c  g  c        a  g 
                c                g     c                    g                 a 

       170       180       190       200       210       220       230       240
*  *          *              *  ** **  *                 * **        *          
    a  ct t  g  c  ca gg    t  c  t  ca a       aag ct t  c    tg  ac a    c t a
             t        t           g            c   g c        a  c            
                                                       a           t            

       250       260       270       280       290       300       310       320
      ****  *      *                 *     *               * *                 *
  t  t        tgta     ac c  t atatc  tc a  cccga g  agat     t  cac c cg    tt 
              c c                           tga   t  t                          

       330       340       350       360       370       380       390       400
  *                 ** * *     *              *                    *   *  *    *
 gt t  g   t cc a        tg    t  c  c tg     g a c c  c  ca a  a  c     a  c 
    c        a g            c    a                    t  g  at g           c    
                                                      g  a  gg                  

       410       420       430       440       450       460       470       480
     * *      *   *  *             **     * **   * ** ** *     ***   *        * 
 c                    caatc a  t      tat            c                g   tg a  
                        ta  c                                                   

       490       500       510       520       530       540       550       560
     *                                  **     *            *   *         *     
a      a             agggaca  t           a     c     c          a              
                     -     c                                                    

       570       580       590       600       610  
       *   *            *       **       *    **    
a        a         c     a  gc     catctc ct       a
                            a         g             
© 1998-2022Legal notice