HBVdb

Dataset for nucleotide sequence X of genotype H

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******* * ** ************************************** ************ *** ***********
ATGGCTGCTaGGcTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTCTACGTCCCGTCGGCGCTGAATCCTGCGG
       a c  t                                      t            a   a           
            a                                                                   

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************* *****  ********* ****** ***********  ******* **  **** ** *********
ACGACCCCTCTCGTGGTCGCTTGGGGCTCTGCCGCCCtCTTCTCCGCCTgcCGTTCCGGCCGACGACGGGTCGCACCTCT
             g     tc         a      c           tt       a  at    a  g         
                                                                              

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**************************** ***** ***** ************** **************** *******
CTTTACGCGGACTCCCCGCCTGTGCCTTCTCATCTGCCGGCCCGTGTGCACTTCGCTTCACCTCTGCACGTCGCATGGAG
                            t     a     a              g                a       
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** ************ *   * * ******** ****  **** ** ******** ***** ** * ***** ******
ACCACCGTGAACGCCCCTtgGAaCTTGCCAACAACCTTACATAAGAGGACTCTTGGACTTTCGCCCCGGTCAACGACCTG
   m            a caa g c        c    gt    a  a        t     a  t a     t      
                  yr                                                            

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********* ******** ******** ******* ************ *********  ******** * * * **** 
GATTGAGGAATACATCAAAGACTGTGTATTTAAGGACTGGGAGGAGTCGGGGGAGGAGTTGAGGTTAAAGGTCTTTGTAT
         c        g        g       g            a         cc        t a t a    c
                                                                                

       410       420       430       440       450       460     
....:....|....:....|....:....|....:....|....:....|....:....|....:
****************** ********** ***** ****** ******** ******** ****
TAGGAGGCTGTAGGCATAAATTGGTCTGTTCACCAGCACCATGCAACTTTTTCACCTCTGCCTAA
                  g          g     c      t        c        g    
                                                                 
© 1998-2020Legal notice