HBVdb

Dataset for nucleotide sequence SP of genotype H

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************* ** **  **** ***  *  **** ************************** **************
ATGCCCCTATCCTATCAACACTTCCGGAGACTACTGTTgTTAGACAACGAGGCAGGGCCCCTAGAAGAAGAACTCCCTCG
             g  c  ga    t   tg tg    a                          g              
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****************** **** ********* ********* ******* ***** *******  *************
CCTCGCAGACGAAGATCTCAATCaCCGCGTCGCAGAAGATCTCAATCTCCAGCTTCCCAATGATCtACAACCACCAGCAC
                  a    t         c         c       t     a       at             
                       g                                                      

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** ******** ************* ********** **************** ** ** ****  *************
GGGACCCTGCAAAACCTGCACCACTCTTGCTCAAGGAACCTCTATGTTTCCCTCcTGCTGCTGTACCAAACCTTCGGACG
   t        g             y          c                t  t  t    ta             
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**************************** ***************************** ******************** 
GAAATTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGGAAAATACCTATGGGAGTGGGCCTCAGCCCGTTTCTCT
                            g                             t                    a
                                                          c                     

       330      
....:....|....:.
****************
TGGCTCAGTTTACTAG
                
                
© 1998-2020Legal notice