HBVdb

Dataset for nucleotide sequence S of genotype H

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** *** ****** ********** * * * ** ** *********** ***** **  * ***** **** *** ** 
ATGGAGAACATCACATCAGGACTCCTAGGACCCCTTCTCGTGTTACAGGCGGTGTGTTTCTTGTTGACAAAAATCCTCAC
   a   g      g          c a c t  g  c           g     t  ct c     t    g   g  a
                                                       c     g              k   
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** **   *** ******* ************** ** ** ***** ** *** ** * ************** ** **
AATACCAcAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGTACCACCCGGGTGTCCTGGCCAAAATTCGC
   g  cag   g       t              g  g  c     a  a   t  t a              g  y  
                                                         a r                    
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********* ************** ** *** *************************** ********************
AGTCCCCAATCTCCAATCACTTACCAACCTCCTGTCCTCCAACTTGTCCTGGCTATCGTTGGATGTGTCTGCGGCGTTTT
         c              a  t   t                           c                    
                                                                                
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ***** ******** ********** ********* ******** **** ************************* **
ATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTGTG
 c     c        c          g         c        g    g                         a  
                                                                                
                                                                                
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******************  * ** *********** *******  ********  *** **********  ******* 
TCCTCTACTTCCAGGATCtACAACCACCAGCACGGGACCCTGCAAAACCTGCACCACTCTTGCTCAAGGAACCTCTATGT
                  at g  t           t       gg        gt   y          ca       g
                                                                              
                                                                              
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ***** ** ** ****  ***** ***** **************** ********* ** ***********    ** 
TTCCCTCcTGCTGCTGTACCAAACCTTCGGACGGAAATTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGGAAAA
aa     t  t  t    ta     c     t                y         g  g           tctg  t
       a  g                    a                                         a c    
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ********  ********** ********  **************** **  **** *********************
TACCTATGGGAGTGGGCCTCAGCCCGTTTCTCTTGGCTCAGTTTACTAGTGCAATTTGtTCAGTGGTGCGTAGGGCTTTC
 t        gt          t        ta                c  cc    c                     
 c         c                                                                    
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** **  **** **  * *** ******** ************* ** ****     ** *  * * ** *******
CCCCACTGTCTGGCTTTTAGTTATATGGATGATtTGGTATTGGGGGCCAAATCTGTGCAGCATCTTGAGTCCCTTTATAC
     t  ct    c  cg c   g        c             t  g    cagca  c cg c g  a       
                                 g                     at  t                    
                                                           r                    
                                                           c                    

       650       660       670       680 
....:....|....:....|....:....|....:....|.
 *** * ********  * ** *** **** ** ***** *
CGCTGTTACCAATTTTTTGTTATCTGTGGGCATCCATTTgA
t   c a        gc t  g   t    t  a     a 
                                       r 
                                         
                                         
© 1998-2020Legal notice