HBVdb

Dataset for nucleotide sequence S of genotype H

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** *** ****** * ****  ** * * * ** ** *********** ***** **  * ***** **** *** ** 
ATGGAGAACATCACATCAGGACTCCTAGGACCCCTTCTCGTGTTACAGGCGGTGTGTTTCTTGTTGACAAAAATCCTCAC
                                     c           g     t   c     t        g   
                                                       a                        

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** **   *** ******* ************** ** ** ***** **   * ** * ************** ** **
AATACCAcAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGTACCACCCGGGTGTCCTGGCCAAAATTCGC
      cag                             g           a   t    a              g     
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********* *********** ** ** *** *************************** *** ****************
AGTCCCCAATCTCCAATCACTTACCAACCTCCTGTCCTCCAACTTGTCCTGGCTATCGTTGGATGTGTCTGCGGCGTTTT
         c              a  t   t                           c                    
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ***** ******** ********** *********   ***  * **** ************************* **
ATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTGTG
                           g         c                                       a  
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****** ***********  * ** ******* *** ** ****  ********  *** ****** ***  ******* 
TCCTCTACTTCCAGGATCtACAACCACCAGCACGGGACCCTGCAAAACCTGCACCACTCTTGCTCAAGGAACCTCTATGT
      g           at g  t           t        g           y      c             
                                                                              

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ***** ** ** ***   *****  ****  **** ***** **** ********* ** ** ********    ** 
TTCCCTCCTGCTGCTGTACCAAACCTTCGGACGGAAATTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGGAAAA
     t           a                                     g           t t    
       a                                                                        

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ********  ********** ********  **************** **  **** ******** ** *********
TACCTATGGGAGTGGGCCTCAGCCCGTTTCTCTTGGCTCAGTTTACTAGTGCAATTTGtTCAGTGGTGCGTAGGGCTTTC
           t                    a                c      c                     
           c                                                                    

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** **  **** **  * *** ******** ************* ** ****     ** *  * * ** *******
CCCCACTGTCTGGCTTTTAGTTATATGGATGATtTGGTATTGGGGGCCAAATCTGTGCAGCATCTTGAGTCCCTTTATAC
                 cg c   g        c                      ag a  c cg   g  a       
                                 g                         r                    

       650       660       670       680 
....:....|....:....|....:....|....:....|.
 *** * ********  * ** *** **** ** ***** *
CGCTGTTACCAATTTTTTGTTATCTGTGGGCATCCATTTgA
               gc    g           a     a 
                                         
© 1998-2022Legal notice