HBVdb

Dataset for nucleotide sequence PreS2 of genotype H

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**************** ******************  * **  *** *** * **          ***************
ATGCAGTGGAACTCAACACAGTTCCACCAAGCACTGTTGGATCCGAGAGTAAGGGGtCTGTATtTTCCTGCTGGTGGCTC
                t                  tc a  ca   a   g a  cg------c-               
                                                  c     -      -                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*************** *******  ********** ***** ****** ******** **** ********* **** **
CAGTTCAGAAACACAGAACCCTGCTCCGACTATTGcCTCTCTCACATCATCAATCTTCTCGAAGACTGGGGACCCTGCTA
               a       tg          t     a      g        a    c         t    t  
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******** ********************* * *** ** ** *********** ***** ***** ********** **
TGAACATGGAGAACATCACATCAGGACTCCTAGGACCCCTTCTCGTGTTACAGGCGGTGTGTTTCTTGTTGACAAAAATC
        a                     c a   t  g  c           g     t     c          g  
                                                                  g             

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** *** **   *** **************************** ***** ************************** 
CTCACAATACCAcAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGTACCACCCGGGTGTCCTGGCCAAAA
 g  a   g  cag   g                            c     a                          g
 k                                                                              

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** *********** ************** ** *** *************************** ***************
TTCGCAGTCCCCAATCTCCAATCACTTACCAACCTCCTGTCCTCCAACTTGTCCTGGCTATCGTTGGATGTGTCTGCGGC
  y           c              a  t   t                           c               
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****** ************************* ********* *************************************
GTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCC
      c                         g         c                                     
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***********************  **************** ******** ************* ********** ****
GTGTGTCCTCTACTTCCAGGATCtACAACCACCAGCACGGGACCCTGCAAAACCTGCACCACTCTTGCTCAAGGAACCTC
                       at                t        g             y          c    
                                                                              

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************ ** ** ****  ************************************** ** *********** *
TATGTTTCCCTCcTGCTGCTGTACCAAACCTTCGGACGGAAATTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCG
            t  t  t    ta                                      g  g           a 
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** *********** ******************** **************** ** ***** ****************
GAAAATACCTATGGGAGTGGGCCTCAGCCCGTTTCTCTTGGCTCAGTTTACTAGTGCAATTTGTTCAGTGGTGCGTAGGG
    t           t                    a                c  c     c                
                c                                                               

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********** *** **** **  * *** ******** ********************** ** ********* ** **
CTTTCCCCCACTGTCTGGCTTTTAGTTATATGGATGATtTGGTATTGGGGGCCAAATCTGTGCAGCATCTTGAGTCCCTT
          t   t    c  cg c   g        c                      a  a         g  a  
                                      g                         t               

       810       820       830       840      
....:....|....:....|....:....|....:....|....:.
******************************************** *
TATACCGCTGTTACCAATTTTTTGTTATCTGTGGGCATCCATTTgA
                                            a 
                                            r 
© 1998-2020Legal notice