HBVdb

Dataset for nucleotide sequence PreS2 of genotype H

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
               *   ** ** **            **  ***   * **  *** *** * **          ***
------------ATGCAGTGGAACTCAACACAGTTCCACCAAGCACTGTTGGATCCGAGAGTAAGGGGtCTGTATtTTCC
nnnnnnnnnnnnnnn taa  c  a  ------------  tc   atc a  ct   a   g a  cg------c-   
                            t                         a       c     -    g -    

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*************************** *******  ********** ***** ****** **** *** **** *****
TGCTGGTGGCTCCAGTTCAGAAACACAGAACCCTGCTCCGACTATTGcCTCTCTCACATCATCAATCTTCTCGAAGACTG
                           a       tg          t     a      g    c   a    c     
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** **** ********** ********************* * *** ** ** *********** ***** ***** *
GGGACCCTGCTATGAACATGGAGAACATCACATCAGGACTCCTAGGACCCCTTCTCGTGTTACAGGCGGTGTGTTTCTTG
    t    t          a                     c a   t  g  c           g     t     c 
                                                                              g 

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********* *** ** *** **   *** **************************** ***** ***************
TTGACAAAAATCCTCACAATACCAcAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGTACCACCCGGGTG
         g   g  a   g  cag   g                            c     a               
             k                                                                  

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********** ** *********** ************** ** *** *************************** ***
TCCTGGCCAAAATTCGCAGTCCCCAATCTCCAATCACTTACCAACCTCCTGTCCTCCAACTTGTCCTGGCTATCGTTGGA
           g  y           c              a  t   t                           c   
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****************** ************************* ********* *************************
TGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAA
                  c                         g         c                         
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***********************************  **************** ******** ************* ***
GGTATGTTGCCCGTGTGTCCTCTACTTCCAGGATCtACAACCACCAGCACGGGACCCTGCAAAACCTGCACCACTCTTGC
                                   at                t        g             y   
                                                                              

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******* **************** ** ** ****  ************************************** ** *
TCAAGGAACCTCTATGTTTCCCTCcTGCTGCTGTACCAAACCTTCGGACGGAAATTGCACCTGTATTCCCATCCCATCAT
       c                t  t  t    ta                                      g  g 
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********** ***** *********** ******************** **************** ** ***** ****
CTTGGGCTTTCGGAAAATACCTATGGGAGTGGGCCTCAGCCCGTTTCTCTTGGCTCAGTTTACTAGTGCAATTTGTTCAG
          a     t           t                    a                c  c     c    
                            c                                                   

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********************** *** **** **  * *** ******** ********************** ** ***
TGGTGCGTAGGGCTTTCCCCCACTGTCTGGCTTTTAGTTATATGGATGATtTGGTATTGGGGGCCAAATCTGTGCAGCAT
                      t   t    c  cg c   g        c                      a  a   
                                                  g                         t   

       810       820       830       840       850        
....:....|....:....|....:....|....:....|....:....|....:...
****** ** ********************************************** *
CTTGAGTCCCTTTATACCGCTGTTACCAATTTTTTGTTATCTGTGGGCATCCATTTgA
      g  a                                              a 
                                                        r 
© 1998-2022Legal notice