HBVdb

Dataset for nucleotide sequence PreC of genotype H

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *    ** ** ******************* ************************************************
ATGCAACTTTTTCACCTCTGCCTAATCATCTTTTGTTCATGTCCCACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCT
t ttwc  c  c                   y                                                
    t                          c                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** ********* **** ** ******************** ***** ***  ***** *****  *** **** **
TTGGGGCATGGACATTGACCCTTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTCATTTTTGCCTTCTGACTTCTTCC
     a         c    t  t                    c     k   gy     c     aa   t    a  
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ** ** **** ** * ********** ********  * **** *********** ** ** ****** ****   *
CGTCTGTCCGGGACCTACTCGACACCGCTTCAGCCCTCTACCGAGATGCCTTAGAATCACCcGAACATTGCACCCCCAAC
  c  a  g    t  g y          a        ct a    g           t  a  t      t    tcg 
                                                             t                  

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *****  ********* * **  ******* * *** * * *   ** * *  ********** ******** * **
CAcACTGCTCTCAGGCAAGCTATTTTGTGCTGGGGTGAGTTGATGACcTTGGCTTCCTGGGTGGGCAATAATTTAGAGGA
 rt     ca         t g  cc       c g   g a c gaa  c g ga          c        c t  
                                              tt                           a    

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  *  ** ******** ** *************    * * ** ** ************* ***  * **** *** *
TCCTGCAGCaAGAGATCTAGTAGTTAATTATGTCAATACTAAcATGGGcCTAAAAATTAGACAATTATTATGGTTTCAcA
  ag gg  c        t  g             gcga c t  a  t             g   cc g    y   t 
         t                                                         r          

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** * *** ** ***********   ***  ******** ***** ********* ****** ** ***** * *  *
TTTCCTGCCTTACATTTGGAAGAGAAACTGTgCTTGAGTATTTGGTGTCTTTTGGAGTGTGGATtCGCACTCCACCTGCT
    t s   a  g           tgt   ta        c     y         g      c  t     g y cg 
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** *********************** ** **  **** ***  *  **** ****** ******************* *
TAtAGACCACCAAATGCCCCTATCCTATCAACACTTCCGGAGACTACTGTTGTTAGACAACGAGGCAGGGCCCCTAGAAG
  c                       g  c  ga    t   tg tg    a      c                   g 
                                                                                

       570       580       590       600       610       620       630         
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....
****************** ************ **** ********* ********* ***** * ***** * ******
AAGAACTCCCTCGCCTCGCAGACGAAGATCTCAATCaCCGCGTCGCAGAAGATCTCAATCTCCAGCTTCCCAATGTTAG
                  y            a    t         c         c     g t     a r      
                                    g                                   g      
© 1998-2021Legal notice