HBVdb

Dataset for nucleotide sequence Genomes of genotype H

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** ********************* ** ******** ***** ****** ***************************
CTCAACACAGTTCCACCAAGCACTGTTGGATCCGAGAGTAAGGGGtCTGTATtTTCCTGCTGGTGGCTCCAGTTCAGAAA
     t                     a  c        g     g      c                           
                                       c                                        
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** *******  ********** ***************************************** *************
CACAGAACCCTGCTCCGACTATTGCCTCTCTCACATCATCAATCTTCTCGAAGACTGGGGACCCTGcTATGAACATGGAG
    a       tg          t                                         t             
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********************* ********* *********** ***** ***** ********** *** *********
AACATCACATCAGGACTCCTAGGACCCCTTCTCGTGTTACAGGCGGTGTGTTTCTTGTTGACAAAAATCCTCACAATACC
                     a         c           g     t     c          g   g         
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *************************************** **************************************
AcAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGTACCACCCGGGTGTCCTGGCCAAAATTCGCAGTCCC
 a                                       a                                      
                                                                                
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***************************************************** **************************
CAATCTCCAATCACTTACCAACCTCCTGTCCTCCAACTTGTCCTGGCTATCGTTGGATGTGTCTGCGGCGTTTTATCATC
                                                     c                          
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********************* **********************************************************
TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTGTGTCCTCT
                     g                                                          
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************ ***************** ******** ************* ********** ***************
ACTTCCAGGATCtACAACCACCAGCACGGGACCCTGCAAAACCTGCACCACTCTTGCTCAAGGAACCTCTATGTTTCCCT
            a                 t        g             y          c               
            w                                                                   
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** ** ****  ***************************************** ************************
CcTGCTGCTGTACCAAACCTTCGGACGGAAATTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGGAAAATACCTA
 t  t  t    ta                                         g                        
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** ******************** **************** ** ***** ***************************
TGGGAGTGGGCCTCAGCCCGTTTCTCTTGGCTCAGTTTACTAGTGCAATTTGtTCAGTGGTGCGTAGGGCTTTCCCCCAC
     t                    a                c  c     c                           
     c                                                                          
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** *******  * *** ******** *********************************** ****************
TGTCTGGCTTTTAGTTATATGGATGATtTGGTATTGGGGGCCAAATCTGTGCAGCATCTTGAGTCCCTTTATACCGCTGT
   t       cg c   g        c                                   g                
                           g                                                    
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********************************* ****************** ******* *** ** * **********
TACCAATTTTTTGTTATCTGTGGGCATCCATTTgAACACAGCTAAAACAAAAtGGTGGGGTTATTCCtTaCACTTTATGG
                                 a                  a       c   a  c t          
                                 r                  w                           
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*****   ******** ******** *********************** ********* * ****** ********** 
GTTATATaATTGGGAGTTGGGGGACcTTGCCTCAGGAACATATTGTGCATAAAATCAAAGATTGCTTTCGCAAACTTCCC
     ggc        c        a                       a         a g      y          t
                         s                                                      
                         g                                                      

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** *** **** *********** ** ******** ******************************** ***********
GTgAATAGACCCATTGATTGGAAGGTtTGTCAACGcATTGTGGGTCTTTTGGGCTTTGCAGCCCCTTTTACTCAATGTGG
  t   c    t           a  c        a                                c           
  r                                                                             
  a                                                                             

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** ***************** ******** **  * ***** *************************************
TTATCCTGCTCTCATGCCCTTGTATGCCTGTATTACcGCTAAgCAGGCTTTTGTTTTCTCGCCAACTTACAAGGCCTTTC
   c                 a        c  cr t     a                                     
                                          c                                     
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  ** ******** *** ************************ ** *********************************
TCTGTAAACAATACaTGAACCTTTACCCCGTTGCTCGGCAACGgCCAGGCCTTTGCCAAGTGTTTGCTGACGCAACCCCC
 gc  c        c   c                        a  g                                 
                                                                              
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***************** *************** ******* ******* ************ *********** *****
ACTGGCTGGGGCTTGGCGATTGGCCATCAGCGCATGCGCGGAACCTTTGTGGCTCCTCTGCCGATCCATACTGCGGAACT
                 a               c       c       a            c           a     
                                                                                
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** ** ** *************** ************** ******* ** ******** ******** **********
CCTAGCaGCtTGTTTCGCTCGCAGCaGGTCTGGAGCGGACaTTATCGGCACTGACAACTCcGTTGTCCTTTCTCGGAAGT
   c  c  c               c              g       a  c        t        g          
                                        r                                       
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******************** * ** ************************************** ***************
ACACCTCCTTCCCATGGCTGCTaGGcTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTCTACGTCCCGTCGGCG
                    a c  t                                      t               
                         a                                                      
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ************************ *****  ********* ****** ***********  *********** ****
CTGAATCCTGCGGACGACCCCTCTCGTGGTCGCTTGGGGCTCTgCCGCCCtCTTCTCCGCCTgcCGTTCCGGCCGACGAC
 a                        g     tc         a      c           tt           t    
                                                                              
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ************************************* ***** ******************** ***********
GGGTCGCACCTCTCTTTACGCGGACTCCCCGCCTGTGCCTTCTCATCTGCCGGCCCGTGTGCACTTCGCTTCACCTCTGC
a  g                                     t     a                    g           
                                                                                
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** ********** ************ *   * ********** ****  **** ** ******** ***** ****
ACGTCGCATGGAGACCACCGTGAACGCCCCTtgGAaCTTGCCAACAACCTTACATAAGAGGACTCTTGGACTTTCGCCCC
     a          m            a caa g          c    gt    a  a        t     a    
                               yr                                               
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ********************* ******** ******** ******************** *********  *******
GGTCAACGACCTGGATTGAGGAaTACATCAAAGACTGTGTaTTTAAGGACTGGGAGGAGTCGGGGGAGGAGtTGAGGTTA
a                     c        g        g                    a         cc       
                                                                                
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* * * * **** ***************************** ************ ******** ***************
AAGGTCTTTGTATTAGGAGGCTGTAGGCATAAATTGGTCTGTTCACCAGCACCATGCAACTTTTTCACCTCTGCCTAATC
 t a t a    c                             g            t        c               
                                                                                
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********************************************************** ********* **** ******
ATCTTTTGTTCATGTCCCACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGCATGGACATtGACCCTTATAA
                                                          a         c    t      
                                                                                
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**************************** ***** *****  *** **** *************** ** **********
AGAATTTGGAGCTTCTGTGGAGTTACTCTCATTTTTGCCTTCTGACTTCTTCCCGTCTGTCCGGGACCTACTCGACACCG
                            y     c     aa   t    a               t  g          
                                                                                
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********** ** **** *********** ** ** ****** ****   *** *****  ********* * **  *
CTTCAGCCCTCtACCGAGATGCCTTAGAATCACCcGAACATTGCACCCCCAACCAcACTGCTCTCAGGCAAGCTATTTtG
           c  a    g           t  a  t      t    tcg   t     ca         t g  cc 
                                  t                                             
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****** * *** * * *   ** * *  ******************* * ****  *  ** ******** ** *****
TGCTGGGGTGAGTTGATGACcTTGGCTTCCTGGGTGGGCAATAATTTAGAGGATCCTGCAGCaAGAGATCTAGTAGTTAA
      c g   g a c gaa  c g ga                   c t    ag gg  c        t  g     
                    t                           a             t                 
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********  ** * ** ** *****************  * ******** ***** ******** *********** *
TTATGTCAATaCTAAcATGGGcCTAAAAATTAGACAATTatTATGGTTTCAcATTTCcTGCCTTACATTTGGAAGAGAAA
         cg  c t  a  t                 cc g        t     t        g           t 
                                                                              
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ***  ******** ********************** ** ***** * ** *** *********************** 
CTGTgCTTGAGTATTTGGTGTCTTTTGGAGTGTGGATtCGCACTCCACCTGCTTAtAGACCACCAAATGCCCCTATCCTA
t   ta        c                      c  t     g y  g   c                       g
                                                                                
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **  ***********  **** ************************** ****************************
TCAACACTTCCGGAGACTACTGTTGTTAGACAACGAGGCAGGGCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAG
  c  ga           tg    a                          g                            
                                                                                
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** **** ********* ********* ******* ***** *********** ** ******************** 
ATCTCAATCaCCGCGTCGCAGAAGATCTCAATCTCCAGCTTCCCAATGTTAGTATTCCTTGGACTCATAAGGTGGGAAAC
    a    t         c         c       t     a           c  g                    t
         g                                                                      
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************************  ********* ******** *** ******* ********* *******  * **
TTTACCGGTCTTTACTCCTCTACTaTACCTGTTTTCAATCCTGACTGGtTAACTCCTTCTTTTCCTGACATTCACTTGCA
                        gc         t        t   c       c         a       tc a  
                                                                              
                                                                                

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******* ******* ******** ********  ************  ******  ************* * *******
TCAAGATcTGATACAAAAATGTGAACAATTTGTaGGCCCACTCACTAcAAATGAAaGGAGACGATTGAAAcTaATTATGC
       t       g        g        gc            ac      gt             t g       
                                                                    a         
                                                                                

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** ** *************  ** ***** *********************** ** ** ********* ********
CAGCTAGGTTTTATCCCAAAGtTACtAAATAcTTCCCTTTGGATAAAGGTATTAAgCCtTACTATCCAGAGAATGTGGTT
    a  a             ca  c     t                       a  a  t         c        
                                                        g                     
                                                                                

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ********** *** * * *** ***** ****************** *******************************
AATCATTACTTtAAAACTAGACAtTATTTACATACTTTGTGGAAGGCAGGAATTCTATATAAGAGAGAATCCACACATAG
g          c   g g c   c     g                  a                               
                   a                                                            
                                                                                

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***************************** ********* ************************ ***** ******** 
CGCCTCATTTTGTGGGTCACCATATTCCTGGGAACAAGAGCTACAGCATGGGAGCACCTCTCTCaACGGCGAGAAGGGGC
                             k         a                        c     r        y
                                                                                
                                                                                

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********** ** ***************************** ***********************************
ATGGGACAGAAtCTTTCTGTGCCCAATCCTCTGGGATTCTTTCCAGACCACCAGTTGGATCCACTATTCAGAGCAAATTC
           c  c                             m                                   
           y                                                                    
                                                                                

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************ *************** ************** ********************* ***** *** ****
CAGCAGTCCCGATTGGGACTTCAACACAAACAAGGACAATTGGCCAATGGCAAACAAGGTAGGAGTGGGAGGCTTCGGTC
            c               g              g                     c     c   t    
                                                                                
                                                                                

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ***************** ***** ******************** ************** ******* ****** ***
CAGGGTTCACACCCCCACACGGTGGCCTTCTGGGGTGGAGCCCTCAGGCACAGGGCATTCTgACAACCTcGCCACCAGAT
 c                 t     g                    a              a       t      c   
                                                                                
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******** ******* ****************** ** ************************** **************
CCACCTCCTGCTTCCACCAATCGGAGGTCAGGAAGAAAGCCAACCCCAGTCTCTCCACCTCTAAGGGACACACATCCACA
        c       a                  g  a                          a              
                                                                                
                                                                                

      3210     
....:....|....:
*** ***********
GGCCATGCAGTGGAA
   y           
               
               
© 1998-2020Legal notice