HBVdb

Dataset for nucleotide sequence C of genotype H

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******** **** ** ******************** ***** ***  ***** *****  *** **** **** ** *
ATGGACATTGACCCTTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTCATTTTTGCCTTCTGACTTCTTCCCGTCTGT
        c    t  t                    c     k   gy     c     aa   t    a    c  a 
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **** ** * ********** ********  * **** *********** ** ** ****** ****   **  ****
CCGGGACCTACTCGACACCGCTTCAGCCCTCTACCGAGATGCCTTAGAATCACCcGAACATTGCACCCCCAACCAcACTG
 g    t  g y          a        ct a    g           t  a  t      t    tcg  rt    
                                                      t                         

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  ********* * **  *** *** * *** * * *   ** * *  ********** ******** * ****  *  
CTCTCAGGCAAGCTATTTTGTGCTGGGGTGAGTTGATGACcTTGGCTTCCTGGGTGGGCAATAATTTAGAGGATCCTGCA
 ca         t g  cc   t   c g   g a c gaa  c g ga          c        c t    ag gg
                                       tt                           a           

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ******** ** *************    * * ** ** ************* ***  * **** *** ***** * 
GCaAGAGATCTAGTAGTTAATTATGTCAATACTAAcATGGGcCTAAAAATTAGACAATTATTATGGTTTCAcATTTCCTG
  c        t  g             gcga c t  a  t             g   cc g    y   t     t s
  t                                                         r                 

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** ** ***********   ***  ******** ***** ********* ****** ** ***** * *  *** ****
CCTTACATTTGGAAGAGAAACTGTgCTTGAGTATTTGGTGTCTTTTGGAGTGTGGATtCGCACTCCACCTGCTTAtAGAC
   a  g           tgt   ta        c     y         g      c  t     g y cg   c    
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******************* ** **  **** ***  *  **** ****** ******************* ********
CACCAAATGCCCCTATCCTATCAACACTTCCGGAGACTACTGTTgTTAGACAACGAGGCAGGGCCCCTAGAAGAAGAACT
                   g  c  ga    t   tg tg    a      c                   g        
                                                                                

       490       500       510       520       530       540       550  
....:....|....:....|....:....|....:....|....:....|....:....|....:....|..
*********** ************ **** ********* ********* ***** * ***** * ******
CCCTCGCCTCGCAGACGAAGATCTCAATCaCCGCGTCGCAGAAGATCTCAATCTCCAGCTTCCCAATGTTAG
           y            a    t         c         c     g t     a r      
                             g                                   g      
© 1998-2022Legal notice