HBVdb

Dataset for nucleotide sequence X of genotype G

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **** ************ ****  * ** ***    ********* **** **** **** * *** ******* ****
ATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTTCGCGGGACGTCCTTTGTTTACGTCCCGTCAGCGCTGAATCCAGCGG
c    a            c    ta c  c   gtca         c    c    c    a g   t       t    
                               a                                              
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**********  **** ** ****** ***  ** ** ***** * * *  *** **  *** ********** ******
ACGACCCCTCCCGGGGCCGTTTGGGGCTCTgTCGCCCCCTTCTCCGTCTGCCGTTCCTGCCGACCACGGGGCGCACCTCT
          tt    t  g      a   ac  t  t     t a t at   a  ga   w          a      
                   c              a                           t                 
                                                              c                 

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *** ***** ***** *  *** ***  ************************ *** **** ********  ****** 
CTTTACGCGGTCTCCCCGTCTGTtCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGCACGTTACATGGAA
a   c     a     g ag   g   ct                        t   c    g        cg      g
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ** *****  *            ** * *   **  ***** ***** ******* *  *    ****** **** 
ACCGCCATGAACAcCTCTCATCaTCTGCCAAgGCAGTTATATAAGAGGACTCTTGGACTGTTTGTTATGTCAACAACCGG
t  a  g     ga cacttggcatca  c a gta  gc     t     a       c ca cagc      g    a
                     atc                     g                                  
                      g                      c                                  

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * ***  ****** ** ******** ***   ** ***** ** ** **  *   *   ******* *     **** 
GgTGGAGAAATACTTCAAGGACTGTGTTTTTGCTGAGTGGGAAGAATTAGGCAATGAGTCCAGGTTAATGAcCTtTGTAT
ca t   gc      g  a        g   aaa  c     g  g  g  gg gag att       c gttaa    c
 c                         a                                        a           
                                                                                

       410       420       430       440       450       460     
....:....|....:....|....:....|....:....|....:....|....:....|....:
* ** ***** * ** ***** ******  ***** ******* * *******************
TAGGAGGCTGTAGGCATAAATTGGTCTGcgCACCAGCACCATGtAACTTTTTCACCTCTGCCTAA
 g  g     c c  c     g      tt     a       c g                   
                                           g                     
                                                                 
© 1998-2020Legal notice