HBVdb

Dataset for nucleotide sequence SP of genotype G

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********** **************** ****************** *** ****** *** *****************
ATGCCCCTATCCTATCAACACTTCCGGAGACTACTGTTGTTAGACGAAGAGGCAGGTCCCCTCGAAGAAGAACTCCCTCG
           t                a                  c   a      t   a                 
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********      ** **** **********  *******  ****   *   * *********** ******** **
CCTCGCAGACGAAGATCTCAATCGCCGCGTCGCAGAAGATCTGCATCTCCAGCTTCCCAATGATCCTCGACCACCAGTAC
         gccttg  c    a          ga       ca    tag aac t           c        c  
          a   c                              g                              

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****** **** ********** ****************************************** ***** ******  
GGGACCCTGCAAAACCTGCACGACTCCTGCTCAAGGCAACTCTATGTATCCCTCATGTTGCTGTACAAAACCTTCGGACG
      a    g          t                                          t     t      aa
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********************************************************** **** ***** ********* 
GAAATTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTCTCt
                                                          t    t     c         a
                                                          c                    c

       330      
....:....|....:.
****************
TGGCTCAGTTTACTAG
                
                
© 1998-2020Legal notice