HBVdb

Dataset for nucleotide sequence PreS2 of genotype G

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *******   *** **     ** ********** **  ****** * ******          ***************
ATGCAGTGGAACTCTACAGCAtTCCACCAAGCTCTACAAAATCCCAAAGTCAGGGGCCTGTATtTTCCTGCTGGTGGCTC
c       ---   c  ccagg  t          t  rg      g a      --------c-               
                  a c              g          c                -                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********  * *      **** ***** *********** **  ** ********* * * ** ***** ** **** 
CAGTTCAGGGATAGTGAACCCTGTTCCGACTATTGCCTCTCACATCTCGTCAATCTTCtCCAGGATTGGGGACCCTGCAC
        aa c ccagga    c     a           t  ca  a         a g a  c     g  t    a
              a                                           g a                   

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** ******** ************ **** **************** ********    **** ********* * **
CGAACATGGAGAACATCACATCAGGATTCCTAGGACCCCTGCTCGTGTtACAGGCGGGGTTTTTCTTGTTGACAAGAATC
    t        t            c    c                c        tagg    g         a t  
                                                            a                   

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ********** ******************************************* *    ********* ***** ***
CTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGTGCCCGTGTGTCCTGGCCTAAA
t          a                                           a acaa         t     a   
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***************************** ** *** ********** ********* **************  ******
TTCGCAGTCCCCAACCTCCAATCACTCACCAATCTCCTGTCCTCCAACTTGTCCTGGCTATCGCTGGATGTGTCTGCGGC
                             t  c   t          t         a              gt      
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********** ************************************************** ***** ************
GTTTTATCATATTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCC
          c                                                  t     r            
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******** ** *** ********** ******** ******** **** ********** *******************
GTTTGTCCTCTGATTCCAGGATCCTCGACCACCAGTACGGGACCCTGCAAAACCTGCACGACTCCTGCTCAAGGCAACTC
        c  a   t          c        c        a    g          t                   
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********************** ***** ******  ******************************************
TATGTATCCCTCATGTTGCTGTACAAAACCTTCGGACGGAAATTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCG
                       t     t      aa                                          
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**************** ********** ********* **************** *************************
CAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTCTCtTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGG
                t          c         a                c                         
                c                    c                                          

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******* ****** ***** **** *** * ****** * ********* **** ******** ** ****** ** **
CTTTCCCCCACTGTCTGGCTTTCAGCTATaTgGATGATGTGGTATTGGGGGCCAAATCTGTACAACATCTTGAGTCCCTT
       a      t     c    t   g t      a t         a    g        m  c      g  a  
                               c                                g               

       810       820       830       840      
....:....|....:....|....:....|....:....|....:.
* ********************** *****************  **
TaTACCGCTGTTACCAATTTTCTTtTGTCTTTGGGTATACATCTAA
 t                      g                 tc  
                                              
© 1998-2020Legal notice