HBVdb

Dataset for nucleotide sequence PreS1 of genotype G

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*****        **  ** *        ****         *** * *** *****      ********* *****  
ATGGGGCTTTCTTGGACGGTC-----CCTCTCGAGTG-----GGGAAAGAACCTTTCCACCAGCAATCCTCTAGGATTCC
     a-------  tt  a ttccaaac    gaaaggcat   g c   t     tgttcc         g     tt
                   a                         g            a                   

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********** ******** ** ** *** **** **  * *********************** ***** ******* *
TTCCCGATCACCAGTTGGACCCaGCATTCAGAGCAAATACCAACAATCCAGATTGGGACTTCAATCCCAAAAAGGACCCT
          t        t  g  g   g    c  ct a                       c     c       a 
                      t  c                                                      

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****** * *** *  *********  ***** *  ** ** ************** ******** **  **********
TGGCCAGAGGCCAACAAGGTAGGAGTTGGAGCCTATGGACCCGGGTTCACCCCTCCACACGGAGGCCTTTTGGGGTGGAG
      c a   c tc         cg     a tc  g  a              t        t  gc          
                          c                             g                       

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **   ********* * ******   * ******* *** **  ******* ******** ****** *  ******
CCCTCAGTCTCAGGGCACACTAACAACTTTGCCAGCAGATCCGCCTCCTGCCTCCACCAATCGTCAGTCAGGGAGGCAGC
  t  cag         t t      acg a       t   t  ca       a        g      a ac      
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ******** * ****** ** ******** ************ *******   *** **     ** ********** 
CTACTCCCATCTcTCCACCACTAAGAGACAGTCATCCTCAGGCCATGCAGTGGAACTCTACAGCAtTCCACCAAGCTCTA
 c        a t      t  g        y            c       ---   c  ccagg  t          t
 a                                                            a c              g

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  ****** * ****            ***********************  * *      * ** ***** ******
CAAAATCCCAAAGTCAGGGGCCTGTATtTTCCTGCTGGTGGCTCCAGTTCAGGGATAGTGAACCCTGTTCCGACTATTGC
  rg      g a    ----------c-                       aa c ccagga t  c     a      
          c                -                              a                     

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** **  ** ********* * * ** ***** ** ** * **** ******** ************ **** ****
CTCTCACATCTCGTCAATCTTCtCCAGGATTGGGGACCCTGCACCGAACATGGAGAACATCACATCAGGATTCCTAGGAC
     t  ca  a         a g a  c     g  t  t a    t        t            c    c    
                      g a                                                       

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************ ********    **** ********* * ** ********** ************************
CCCTGCTCGTGTtACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACCGCAGAGTCTAGACTCGTGGTGGACT
            c        tagg    g         a t  t          a                        
                        a                                                       

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******************* *    ********* ***** ******************************** ** ***
TCTCTCAATTTTCTAGGGGGAGTGCCCGTGTGTCCTGGCCTAAATTCGCAGTCCCCAACCTCCAATCACTCACCAATCTC
                   a acaa         t     a                                t  c   
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ********** ********* **************  **************** *************************
CTGTCCTCCAACTTGTCCTGGCTATCGCTGGATGTGTCTGCGGCGTTTTATCATATTCCTCTTCATCCTGCTGCTATGCC
t          t         a              gt                c                         
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************************* ***** ******************** ** *** ********** ******** 
TCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTGATTCCAGGATCCTCGACCACCAGT
                         t     r                    c  a   t          c        c
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******** **** ********** ****************************************** ***** ******
ACGGGACCCTGCAAAACCTGCACGACTCCTGCTCAAGGCAACTCTATGTATCCCTCATGTTGCTGTACAAAACCTTCGGA
        a    g          t                                          t     t      
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ********************************************************** **** ***** ********
CGGAAATTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTCT
aa                                                          t    t     c        
                                                            c                   

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **************** ******************************** ****** ***** **** *** * ****
CtTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTCTGGCTTTCAGCTATaTgGATG
 a                c                                a      t     c    t   g t    
 c                                                                         c    

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** * ********* **** ******** ** ****** ** *** ********************** * *********
ATGTGGTATTGGGGGCCAAATCTGTACAACATCTTGAGTCCCTTTaTACCGCTGTTACCAATTTTCTTtTGTCTTTGGGT
  a t         a    g        m  c      g  a   t                      g t         
                            g                                                   

      1210
....:....|
******  **
ATACATCTAA
      tc  
          
© 1998-2020Legal notice