HBVdb

Dataset for nucleotide sequence PreC of genotype G

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** **************************************** ***********************************
ATGtAACTTTTTCACCTCTGCCTAATCATCTCTTGTTCATGTCCtACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCT
   c                                        c                                   
   g                                                                            

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********************************************************************************
TTAGGGCATGGATAGAACAACTTTGCCATATGGCCTTTTTGGCTTAGACATTGACCCTTATAAAGAATTTGGAGCTACTG
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******* ************************************************************ ***********
TGGAGTTGCTCTCGTTTTTGCCTTCTGACTTTTTCCCGTCTGTTCGTGATCTTCTCGACACCGCTTCAGCTTTGTACCGG
       a                                                            s           
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** ************ **  **** ************* ******************* ********************
GAATCCTTAGAGTCCTCTGATCATTGTTCGCCTCACCATACAGCACTCAGGCAAGCAATcCTGTGCTGGGGTGAGTTGAT
   g            t  tg    c             g                   t                    
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********* ********************************************** ********************** 
GACTCTAGCtACCTGGGTGGGTAATAATTTGGAAGATCCAGCATCCAGAGATTTGGTGGTCAATTATGTTAATACTAATA
         c                                              c                      t
                                                                               c

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************************************************* ***** ************************
TGGGTTTAAAAATCAGGCAACTATTGTGGTTTCACATTTCCTGTCTTACTTTTGGGAGAGAAACCGTTCTTGAGTATTTG
                                                 g     a                        
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***************************** * ************************************************
GTGTCTTTTGGAGTGTGGATTCGCACTCCTCCTGCTTATAGACCACCAAATGCCCCTATCCTATCAACACTTCCGGAGAC
                             g t                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******************** ***********************************************************
TACTGTTGTTAGACGAAGAGGCAGGTCCCCTCGAAGAAGAACTCCCTCGCCTCGCAGACGAAGATCTCAATCGCCGCGTC
                    a                                                           
                                                                                

       650       660       670     
....:....|....:....|....:....|....:
** ******** ****** ************ ***
GCAGAAGATCTGCATCTCCAGCTTCCCAATGTTAG
  g        a      a            a   
  c                                
© 1998-2020Legal notice