HBVdb

Dataset for nucleotide sequence X of genotype F

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** **** *  **  ** * ** * * * **  * * ****   *** * *** * ** *  * *** * *** ****
ATGGCTGCTCGGtTGTGCTGCcAACTGGATCCTgCGCGGGACGTCCTTTGTtTACGTCCCGTCGGCGCTGAATCCcGCGG
         a  a        a  t                        c        a  a           a    
            c                                                              t    
            g                                                                   

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****  * **  * *  **  * **  *    **  *         **  *   *    ** ** ***** *    ****
ACGAtCCCTCtCGGGGtCGCTTGGGGcTgTAcCGCCCcCTTCTcCGTCTGCCGTTCCAGCCGACgACGGGTCGCACCTCT
     t      c  tc a  ag c  t     t     g     a t         a  c               
                            a              t                    a               
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *** ***** * * **   * * *** * *    ***    * ********** **     ****   *     ***  
CTTTACGCGGcCTCCCCGTCTGTTCCTTCTCATCTGCCGGaCCGTGTGCACTTCGCTTCACCTCTGCACGTCGCATGGAG
          a            g       g        t                             a a      a
          t                                                                     
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  **   * * ***         *    *         *         *                         *   
ACCACCGTGAACGCCCCtcGgAgctTGCCAACAGTCTTACATAAgaGGACTcTTGGACTtTCAGGAcGGTCAATgACCTG
                act a atc    c t  c    t    ac     a       c  c   a       cc    
                                            cm     m          g   t             
                                                                  g             

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *       **  **    * *** * **       *** *** *   **  * **      *                
GATCGAAGAaTACATCAAAGACTGTGTATTTAAgGACTGGGAGGAGcTGGGGGAGGAGAttAGGTTAAaGgTCTTTGTAt
   t     c                 g    ca            t            cc       t a t a   cc
                                                                                
                                                                                

       410       420       430       440       450       460     
....:....|....:....|....:....|....:....|....:....|....:....|....:
*   * ****   *  **    **   *                    **     *      ** 
TAGGAGGCTGTAGGCATAAATTGGTCTGTTCACCAGCACCATGCAACTTTTTCACCTCTGCCTAA
                            cg      t        t                   
                                                                 
                                                                 
© 1998-2021Legal notice