HBVdb

Dataset for nucleotide sequence PreS2 of genotype F

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *           ** **                *     *                   **** *    * 
ATGCAGTGGAACTCaACcCAGTTCCACCAGGCtcTGTTaGATCCgAGGGTAAGGGCTCTGTAttTtCCTGCTGGTGGCTC
g a  a     t  ct ta    t  t  aa ct    g  c  c aa    a        gcc-c-             
                                            a                --- -              
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** * *    **      ** ** **  * *****   * *  * *** ****  *    **  ***** * ** **   
CAGTTCAGaGACaCAGAACCCTGCTCCGACTATTGCCTCTCTCACATCATCAATCTTCTcGAAGACTGGGGGCCCTGCtA
        ga  g  a       t             y    t           c  t         c  t   c 
                                                        a              a      a 
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * **  ** * **     **   *  **    **  ** * *   * *   * ** *  *  **  *  * **   **
tGAACATGGAcAACATCACATCAGGACTCCTAGGACCCCTGCTCGTGTTACAGGCGGTGTgTTTCTTGTTGACAAAAATC
        g g  ctt         a    a                           t  c      t  g    
                                                            c                   
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** **  **    *  *** *** ** ***** ***** ** ****** * *     * *   ****  ** ******
CTCACAATACCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGActACCCGGGTGTCCTGGCCAAAA
 g  a   g    g                             g        a  a ac   a                 
                                                       c                        
                                                       r                        

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * * *********************** *****  *******  * ***** **  ***** * *  ** ** ** **
TTCGCAGTCCCCAACCTCCAATCACTTACCAACCTCCTGTCCTCCAACTTGTCCTGGCTATCGtTGGATGTGTCTGCGGC
                                                         t     c                
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** ****** ******* *********** ** ***** **************** **** *     ***** ******
GTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCC
                                                        g       c  g            
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ***** *                 * *   **** *** ***   ****   **** **  ** **** * *   **
GTTTGTCCTCTAcTTCCAGGATCcACGACC---ACCAGCACGGGACCaTGCAAAACCTGCACAACTCTTGCtCAAGGAAC
            a          tt a                    c     g               a     c  
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * **** * ***** ** ** *** * * *** * *** ***** ***** *********** ***** **   ** **
CTCTATGTTTCCCTCcTGtTGCTGTTCcAAACCcTCGGACGGAAACTGCACtTGTATTCCCATCCCATCATCtTGGGCTT
               t  c  t   a a     t                 c                    c       
               a           m     y                                              
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ***** * ********  ** * ****  ** ** *** * ***** ******* ***  *  ** ***** * **  
TAGGAAAATACCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCAATTTGTTCAGTGGTGCGTA
                                      t       a                              c
                                        a       k                               
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* * ********* *** **** **     *    **** ************ ** *** *    *   * *  **  * 
GGGCTTTCCCCCACTGTcTGGCTTTTAGTTATATGGATGATCTGGTATTGGGGGCCAAATCTGTGCAGCATCTTGAGTCC
             t   t              g                               t  a            
                                                                                
                                                                                

       810       820       830       840         
....:....|....:....|....:....|....:....|....:....
 * **  *   * ** * *****  *  ****  ****  ** *  * *
CTTTATACCGCTGTTACCAATTTTCTGTTATCTGTGGGTATCCATTTaA
                        t        t             g 
                                                 
                                                 
© 1998-2022Legal notice