HBVdb

Dataset for nucleotide sequence PreS1 of genotype F

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***********    **  *     **** ** * * *    *****  * ** ***** ** ***** *** * **  *
ATGGGAGCACCTCTcTCAACGACacGAAGgGGCATGGGACaGAATCTcTCTGTgCCCAATCCtCTGGGaTTCTTtCCAGA
              a        ta    a          t          a        a     c   c g   r 
                       g                                      g                 
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** **  *******  * ****   ***** *** **   * ** *****  ******    ******    *******
cCATCAGCTGGATCCtCTaTTCAGaGCAAATTCCAGCAGTCCCGAcTGGGACTTCAACAaAAACAAGGACAaTTGGCCAA
a      t        t    ag                    t             c gc        c        
                                                                       g        
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  * ***** **  *    * **     *   * **  * *  ** *     ** ** *** *  * ** * *** ** 
TGGCAAACAAGGTAGGA---GTGGGAGGaTACGGTCCaGGGTTCACACCCCCACACGGTGGCCTGtTGGGGTGGAGcCCt
                         g ct     c      t        t            c    a     t  a
                            c                                                 
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  ** ** **     *  * **   * **    * ** ***    *  *********           *   *   *  
CAGGCACAgGGTGTgcTaACAACcTTGCCAGCAGATCCGCCTCCTGCTTCCACCAATCGGCGGTCCGGGAGaAAg--CCA
  a     a   a tt     a       tga    a        cc           a aa g  a  g  a     
                                                                              
                                                                              
                                                                              

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *       *  * *    * *  ** ** ** ** **             *           ** **            
ACCCCAGTCTCTCCACCTCTAAGAGACACaCATCCACAGGCcATGCAGTGGAACTCaACcCAGTTCCACCAGGCtcTGTT
                             t           ag a  a     t  ct ta    t  t  aa ct    
                             c                                                  
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *                   **** *    * ** * *    **      ** ** **  * *****   
aGATCCgAGGGTAAGGGCTCTGTAttTtCCTGCTGGTGGCTCCAGTTCAGaGACaCAGAACCCTGCTCCGACTATTGCCT
g  c  c aa    a     ----cc-c-                     ga  g  a       t             y
      a                g-- -                                                    
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *  * *** ****  *    **  * *** * ** **     * **  ** * **     **   ** **    **  
CTCTCACATCATCAATCTTCTcGAAGACTGGGGGCCCTGCtAtGAACATGGAcAACATCACATCAGGACTCCTAGGACCC
    t           c  t         c  t   c c         g g  ctt         a    a     
                  a              a      a                                       
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** * *   * *   * ** *  *  **  *  * **   *** ** **  ***   *  **  *** ** ***** ***
CTGCTCGTGTTACAGGCGGTGTGTTTCTTGTTGACAAAAATCCTCACAATACCACAGAGTCTAGACTCGTGGTGGACTTC
                      t  c      t        g  a   g    g                        
                      c                                                         
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ** ****** * *     * *   ***** ** ******  * * *********************** *****  *
TCTCAATTTTCTAGGGGGActACCCGGGTGTCCTGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTTACCAACCTCCT
     g        a  a ac   a                                                       
                 c                                                              
                 r                                                              
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******  * ***** **  ***** * *  ** ** ** ***** ****** ******* *********** ** ****
GTCCTCCAACTTGTCCTGGCTATCGtTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTC
                   t     c                                                      
                                                                                
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **************** **** *     ***** ******** ***** *                            
ATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAcTTCCAGGATC------------cAC
                  g       c  g                        a                      tt 
                                                                                
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * *   **** *** ***   ****   **** **  ** **** * *   ** * **** * ***** ** ** *** 
GACC---ACCAGCACGGGACCaTGCAAAACCTGCACAACTCTTGCTCAAGGAACCTCTATGTTTCCCTCcTGtTGCTGTT
a                    c     g               a     c                 t  c  t   a
                                                                     a          
                                                                                
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* * *** * *** ***** ***** *********** ***** **   ** *** ***** * ********  ** * *
CcAAACCcTCGGACGGAAACTGCACtTGTATTCCCATCCCATCATCtTGGGCTTTAGGAAAATACCTATGGGAGTGGGCC
 a     t                 c                    c                                 
 m     y                                                                        
                                                                                
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***  ** ** *** * ***** **** ** ***  *  ** ***** * **  * * ********* *** **** ** 
TCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCAATTTGTTCAGTGGTGCGTAGGGCTTTCCCCCACTGTcTGGCTTTT
            t       a                              c             t   t        
              a       k                                                         
                                                                                
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *    **** ************ ** *** *    *   * *  **  *  * **  *   * ** * *****  *
AGTTATATGGATGATCTGGTATTGGGGGCCAAATCTGTGCAGCATCTTGAGTCCCTTTATACCGCTGTTACCAATTTTCT
      g                               t  a                                    t 
                                                                                
                                                                                
                                                                                

      1210      1220   
....:....|....:....|...
  ****  ****  ** *  * *
GTTATCTGTGGGTATCCATTTaA
       t             g 
                       
                       
                       
© 1998-2022Legal notice