HBVdb

Dataset for nucleotide sequence Genomes of genotype F

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          ** **                *     *                   **** *    * ** * *    *
CTCaACcCAGTTCCACCAGGCtcTGTTaGATCCgAGGGTAAGGGCTCTGTATtTTCCTGCTGGTGGCTCCAGTTCAGaGA
t  ct ta    t  t  aa ct    g  c  c aa    a        gcc-c                      ga 
                                 a                ---                           
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *    ** ** **  * *****   * *  * *** ****  *    **  ***** * ** **     * **  ** 
CaCAGAACCCTGCTCCGACTATTGCCTCTCTCACATCATCAATCTTCTcGAAGACTGGGGGCCCTGCtAtGAACATGGAc
 g  a       t             y    t           c  t         c  t   c c         g
                                             a              a      a            
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **     **   *  **    **  ** * *   * *   * ** *  *  **  *  * **   *** ** **  **
AACATCACATCAGGACTCCTAGGACCCCTGCTCGTGTTACAGGCGGTGTgTTTCTTGTTGACAAAAATCCTCACAATACC
 g  ctt         a    a                           t  c      t  g     g  a   g  
                                                 c                              
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *  **  *** ** *********** ** ****** * *     * *   ***** ** ******  * * *****
ACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGActACCCGGGTGTCCTGGCCAAAATTCGCAGTCCC
  g                             g        a  a ac   a                            
                                            c                                   
                                            r                                   
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****************** *****  *******  * ***** **  ***** * *  ** ** ** ***** ****** 
CAACCTCCAATCACTTACCAACCTCCTGTCCTCCAACTTGTCCTGGCTATCGtTGGATGTGTCTGCGGCGTTTTATCATC
                                              t     c                           
                                                                                
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******* *********** ******** **************** **** *     ***** ******** ***** * 
TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCT
                                             g       c  g                       
                                                                                
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                            * *   **** *** ***   ****   **** **  ** **** * *   *
AcTTCCAGGATC------------cACGACC---ACCAGCACGGGACCaTGCAAAACCTGCACAACTCTTGCTCAAGGAA
 a                      tt a                    c     g               a     c 
                                                                                
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* * **** * ***** ** ** *** * * *** * *** ***** ***** *********** ***** **   ** *
CCTCTATGTTTCCCTCcTGtTGCTGTTCcAAACCcTCGGACGGAAACTGCACtTGTATTCCCATCCCATCATCtTGGGCT
                t  c  t   a a     t                 c                    c      
                a           m     y                                             
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ***** * ********  ** * ****  ** ** *** * ***** ******* ***  *  ** ***** * ** 
TTAGGAAAATACCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCAATTTGTTCAGTGGTGCGT
                                       t       a                              
                                         a       k                              
                                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * * ********* *** **** **     *    **** ************ ****** **   *   * *  **  *
AGGGCTTTCCCCCACTGTcTGGCTTTTAGTTATATGGATGATCTGGTATTGGGGGCCAAATCTGTGCAGCATCTTGAGTC
c             t   t              g                               t  a           
                                                                                
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * **  *   * ** * *****  *  ****  ****  ** *  * **  *  * ** ** **  * ***** **  
CCTTTATACCGCTGTTACCAATTTTCTGTTATCTGTGGGTATCCATTTaAATACcTCtAAAACAAAAAGATGGGGTTAca
                         t        t             g   g tg g     g  gc       c  tt
                                                               t                
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *  * ** *****  *    ** **  ***  **  * ** ** **  * ** ***   *  **  * *     *  
cccTAcATTTcATGGGTTATGTtATTGGcAGTTGGGGAtCaTTACCcCAAGATCAtATTGTACAcAAAaTCAAAGAtTGT
att ca    t         c             g g  g  a        c   a t  a  gc   rg  a  c
 a                  a             a       t                                 
                                                                                
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**    *** * *****    ** **  * ** ***** ** ** **  *  * ** **  *  ***  ***** ** * 
TTTcGtAAACTTCCTGTAAATCGtCCaATTGAtTGGAAAGTTTGTCAaCGcATTGTGGGtCTTTTGGGCTTTGCcGCcCC
   a a     g           c   a  c        c  c    a                  t  t  
     g                 a               a                                g     
                                                                          a     
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *   * ***** ** ** **************  *  *    ** ** *  ** **  * ** ***** ** ****  *
tTTtACcCAATGTGGTTATCCTGCTCTCATGCCTcTGTATgCCTGTATaACTGCtAAACAGGCTTTTGTCTTTTCGCCAA
c  c  t     c                     t  caat     t  c  g        g     t  c       
      a                                         c              c                
                                                                                
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** **  ***** *       ** ***    ********** ***    ******** * *** * ************
CTTACAAGGCCTTTCTcTGTaAACAaTACATGAACCTTTACCCCGTTGCTCGGCAACGGCCAGGCCTGTGCCAAGTGTTT
 c      a       a   c    g      c                ca          g                  
 a              g                                                               
                                                                                
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** ** ** **** *** ****** * *   * ** ** ******  *** *   *****  ******  * *****
GCTGACGCAACCCCCACTGGTTGGGGCTTGGCCATTGGCCATCAGCGCATGCGTGGAACCTTTGTGGCTCCTCTGCCGAT
     t              c                                                     a     
                                                                                
                                                                                
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** * * ** **  **   *  ** ** ** *** ** *  *** ***  *     * *  ** ** *     ** *  *
CCATACTGCGGAACTCCTTGCAGCtTGTTTCGCTCGCAGCCGGTCTGGAGCGAaacTcATCGGcACaGACAAcTCTGTTG
                  a     c  c            a            cta t     g  g     t     c 
                                                      cg                        
                                                                                
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **  *  * ** ** *  ** ** *********** ** **  **** ******** **  * ** ****  ***** 
TCCTCTCTaGGAAGTACACCTCCTTcCCATGGCTGCTCGGtTGTGCTGCcAACTGGATCCTgCGCGGGACGTCCTTTGTT
 a     cc                t              a        a                            
        m                               g                                       
                                        c                                       
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** ** ** * ********* ******** ** **  **** **  * **  * *  ** **     * * **  * 
TACGTCCCGTCGGCGCTGAATCCcGCGGACGAcCCCTCcCGGGGtCGCTTGGGGcTgTAcCGCCCcCTTCTcCGTCTGCc
        a  a           a        t  t      c  tc a  ag c tt     t     g     a t
                       t                                a              t        
                                                                                
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***    ** ** ***** *    ******** ***** * * **   *** *** * *    ****   **********
GTTCCAGCCGACgACGGGTCGCACCTCTCTTTACGCGGaCTCCCCGTCTGTTCCTTCTCATCTGCCGGaCCGTGTGCACT
     g   a  c                         c            g       g        t           
            a                         t                                         
                                                                                
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ***************     **** ** *** ***** ***         *    *         *         * 
TCGCTTCACCTCTGCACGTCGCATGGAGACCACCGTGAACGCCCCctGgAgttTGCCAACAGTCTTACATAAgaGGACTc
                  a a      a                 tc a acc    c t  c    t c  ac     a
                                              a               y         c      m
                                                                                
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                    *     *       **  **    * *** * ***   ** ***
TTGGACTTTCAGGA------------cGGTCAATgACCTGGATCGAAGAATACATCAAAGACTGTGTATTTAAgGACTGG
       c  c               a       cc       t     c                 g    ca      
          g               t                                                     
                          g                                                     
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *****   **  * **      *  ** *   *      *  ******* * *  ***   **** *            
GAGGAGcTGGGGGAGGAGAttAGGTTAAaGgTCTTTGTAtTAGGAGGCTGTAGGCATAAATTGGTCTGTTCACCAGCACC
      t            cc       t a t a    c                            cg          
                                                                                
                                                                                
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      * ** * *********** **     *  **  ****  ***  ******** *** ************ * **
ATGCAACTTTTTCACCTCTGCCTAATCATCTTTTGTTCATGTCCtACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCT
                             t c            c                                   
                                                                                
                                                                                
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  * ********* ****  * ********  ** ** **    **  *  *  * *****  *    ** *  *  *
TTgGGGCATGGACATTGACCCTTATAAAGAATTTGGAGCTTCTGTGGAaTTaCTCTCTTTTTTGCCTTCTGAtTTCTTCC
   a         c                    c      ac   gc     g         atc  c    at 
                                            g                      ca           
                                                                   g            
                                                                   k            

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*        *  *  *  *  *  ****   * *  *        *     *  * **  *  * *      *       
CgTCaGTTCGGGACCTACTCGACACCGCTTCAGCcCTcTACcGGGATGCTtTAGAgTCACCgGAACATTGCACcCCcaAc
 a  gaca       a          c      tctta        c ga a      g      t a atc t
 t  t                                g                                 t   m  
                                                                                
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** *  *   *  * **   *       * **    **  *        * *      *** ***  * *  **  *  *
CATACcGCTCTCAGGCAAGCTATtTTGTGcTGGGGTGAgTTAATGACTTTGGCTTCCTGGGTGGGcAATAAtTTGGAaGA
  c  t  ca         t g ag a  t   aa   ag   cagt   c  ca          tc    c   c  
                       c                      a   t                         
                                                                              
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ***      ** *        *  * * **            ****  * **    *  *         *******  
cCCTGCaGCtAGGGAttTAGTaGTTAAcTATGTcAAcACTaAcATGGGCcTaAAaATTAGACAAtTgtTGTGGTTTCACA
   gtt c     cc g  g     t     t  t t c t      t g  g       c ac           r
                                      a                                         
                                                                                
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ** *   *    ** *  *         **    *   * * *  *  *  *  ****** * * *** **       
TTTCCTGcCTTACTTTTGGAAGAGAAACAGTTCTTGAGTATTTGGTGTCcTTTGGAGTGTGGATTCGCACTCCtCCtGCT
     ta attg         c tgt    g ac             t     g                 agtact 
                         c      a                                          a    
                                                                                
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**    *    ******** **** ****    ***** **         * * * *     *  * **           
TATAGACCACCAAATGCCCCTATCcTATCCACACTTCCGGAAACTACTGTTGTTAGACGACGAGGCAGGTCCCCTaGAAG
  c  g   ga             t                 gt g     a     gc a      annnnncnnnn
                                                          a            t   n    
                                                                                
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
               * *   ****** *** ***  * * *   *     **** *******   * **   *****  
AAGAACTCCCTCGCCTCGCaGACGAAGgTCTCAATCGCCGCGTCGCaGAAGATCTCAATCTCCAGCTTCCCAATGTTAGT
nnnnnnnnnnnnnnn    ca      a        a   g     cac               t      gc       
                                                                                
                                                                                
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **     * *       ***    *  ** ** ** ** **  ******  **    *  *** ** * **    * 
ATTCCTTGGACTCATAAGGTGGGAAAtTTTACGGGgCTcTAcTCtTCTACTGTaCCTgCTTTtAATCCTgACTGGTTaAC
              c    k      c     a  a  t  t         t   a    c   t  a t   gcc  
                   g                                 g   r           c       g  
                                                                                
                                                                                

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **   ******  * ***** *  **  *  *  * **    *  ***** * **  ** ** **  * ** **  * *
TCCTTCTTTTCCTGAtATTCATTTaCATCAAGAtcTGATatctAAATGTGAACAATTTGTAGGCCCtCTcACaAAAAATG
             a c        g   g ga ct a  tcac          g      g      t  c       
                                          a                        a  t       
                                                                                
                                                                                

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *       ** *** *  * *****  * * * * *  ** *     ** ***** ** *     ** ** *  ** 
AATTgAGAAGaTTaAAATTggTtATGCCAgCcAGATTtTtTCCTAAggTTACcAAATAtTTTCCTaTGGAaAAaGGaATt
    ac g  g  g     aa c      t t     c      ac    t     c     cc a  g  g  c  c
                                                                 t    c     g   
                                                                      t         
                                                                                

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **  * ****  **  *    *********** **  *  *    ** ****  *****  * *** *    **  *
AAACCcTATTATCCTGAgcAtGcaGTTAATCATTAtTTTAAgACcAGACAtTATTTGCATACTTTATGGAAgGCgGGaAT
  g         a  ta cttg           c    a     c            c t     a  a   
                                   y                                 r  r     
                                                                                
                                                                                

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ****    *   *   * *    * **  ** ** ** ** ** *  **  * ****** ** *   ***********
ttTATATAAGAGAGAATCCACACGTAGCGCCTCATTTTGTGGGTCACCATATTCcTGGGAACAAGAGCTACAGCATGGGA
cc       r r r       c a      a                       t         a               
 y                                                                              
                                                                                
                                                                                

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*****    **  *                                   **** ** ***** *** * **  * *****
GCACCTCTcTCAACGACacGAAGgGGCATGGGACaGAATCTcTCTGTgCCCAATCCtCTGGGaTTCTTtCCAGAcCATCA
        a        ta    a          t      t     a        a     c   c g   r a     
                 g                                      g                       
                                                                                
                                                                                

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *******  * ****   ***** *** **   * ** *****  ******    ****** * ********** * *
GCTGGATCCtCTaTTCAGaGCAAATTCCAGCAGTCCCGAcTGGGACTTCAACAaAAACAAGGACAaTTGGCCAATGGCAA
          t    ag                    t             c gc        c              
                                                                 g              
                                                                                
                                                                                

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** *** *    * **     *   * **  * *  ** **    ***** *** *  * ** * *** ** *  ** 
ACAAGGTAGGA---GTGGGAGGaTACGGTCCaGGGTTCACACCCCCACACGGTGGCCTGtTGGGGTGGAGcCCtCAGGCA
                   g ct     c      t        t            c    a     t  a  a   
                      c                                                       
                                                                                
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **     *  * **   * **    * ** ***    *  *********           *   *   *   *    
CAgGGTGTgcTaACAACcTTGCCAGCAGATCCGCCTCCTGCTTCCACCAATCGGCGGTCCGGGAGaAAg--CCAACCCCA
  a   a tt     a       tga    a        cc           a aa g  a  g  a           
                                                                              
                                                                              
                                                                              

      3210      3220      3230      3240       
....:....|....:....|....:....|....:....|....:..
    *** *    * *  ** ** ** ** **             * 
GTCTCTCCACCTCTAAGAGACACaCATCCACAGGCcATGCAGTGGAA
                       t           ag a  a     
                       c                       
                                               
                                               
© 1998-2022Legal notice