HBVdb

Dataset for nucleotide sequence Genomes of genotype F

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          ** **                *     **       **         ******  * **** * *    *
CTCaACtCAGTTCCACCAGGCtCTGTTaGATCCgAGgGTAAGGGCTCTGTAttTtCCTGCTGGTGGCTCCAGTTCAGaGA
ta ct ca    t  t  aa ct    g     c  a    a        gcccc                     aga 
                                 a                c                           c 
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **   ** ** ** ** ***** * * *  * *** ****  *    **  ***** * ** **     * ****** 
CACAGAACCCTGCTCCGACTATTGCCTCTCTCACATCATCAATCTTCTcGAAGACTGGGGGCCCTGCtAtGAACATGGAc
 g  a       t             y                c  t         c  t  tc c         g
                                             a  y                  a y          
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **     ***  *  ** * ***  ** * *** * **  * ** *  *  ** **  * **   *** ** **  **
AACATcACATCAGGACTCCTAGGACCCCTGCTCGTGTTACAGGCGGTGTGTTTCTTGTTGACAAAAATCCTCACAATACC
 g  ctt              a                        g  t  c  c     t  g     g  a   g  
                                                 c                              
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    * ***  *** ** *********** ** ****** * *     * *   ***** ** ********* * *****
ACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGActACCCGGGTGTCCTGGCCAAAATTCGCAGTCCC
  g  a                          g        a  a ac   a                            
                                            c                                   
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****************** *****  ******* ******** **  ***** * *  ***** ** ***** ****** 
CAACCTCCAATCACTTACCAACCTCCTGTCCTCCAACTTGTCCTGGCTATCGtTGGATGTGTCTGCGGCGTTTTATCATC
                         t                    t     c                           
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******* *********** ******** **************** ******  *  ***** ******** ***** * 
TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCT
                                             g       c  g                       
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ******** *                ******* *** ****  ****   *******  ******* * *   ** *
AcTTCCAGGATC------------cACGACCACCAGCACGGGACCaTGCAAAACCTGCACAACTCTTGCtCAAGGAACCT
 a                      t  a                 c     g               a     c    
                        a                                                       
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **** ******* ** ** *** * * *** ***** ***** ***** *********** ***** **  *** *** 
CTATGTTTCCCTCcTGtTGCTGTTCcAAACCcTCGGACGGAAACTGCACtTGTATTCCCATCCCATCATCtTGGGCTTTA
             t  c  t   a a     t                 c                 g          
                               y                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** * ********  ** * ****  ** ****** ******* ***********  ***** ***** ****  * 
GGAAAATACCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCAATTTGTTCAGTGGTGCGTaGG
                                    t       a                              c  
                                      a       k                                 
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ********* *** *********   ** * ***************** ****** ***  *   * *  **  *  *
GCTTTCCCCCACTGTcTGGCTTTTAGTTATATGGATGATCTGGTATTGGGGGCCAAATCTGTGCAGCATCTTGAGTCCCT
           t   t              g                                  a              
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **  *   * ** * ****** *  ****  ****  ** *  * **  *  * ***** **  * ***** **     
TTATACCGCTGTTACCAATTTTCTGTTATCTGTGGGTATCCATTTaAATACcTCtAAAACAAAAAGATGGGGTTAcaccc
                      t        t           g   g tg g     g  gc       c  ttatt
                                                            t                 a 
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  * ** *****  *    ** ** ****  **  * ** ** **  * ** ***   *  **  * *  *  *  ** 
TAcATTTcATGGGTTATGTtATTGGcAGTTGGGGAtCaTTACCcCAAGATCAcATTGTACAcAAAaTCAAAGAtTGtTTT
 ca    t         c     t         g g  g  a     c  t   a t  a  gc   rg  a  c   
                 a     a         a       t                 t           c      
                                   y                                            

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *** * *****    ** **  * ** ***** ** ** **  *  * ** **  *  ***  ***** ** *  * 
cGtAAACTtCCTGTAAATCGtCCaATTGAtTGGAAAGTTTGTCAaCGcATtGTGGGtCTTTTGGGCTTTGCcGCcCCtTT
a g     g           c   a  c        c       a                  t  t  c  
  a                 a               a                                g        
                                                                     a        

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * ***** ** ** **************  *  *    ** ** *  ** **  * ** ***** ** ****  ** *
tACcCAATGTGGTTATCCTGCTCTCATGCCTcTGTATgCCTGTATaACTGCtAAACAGGCTTTTGTCTTTTCGCCAACTT
 t     c                     t  caat     t  c  g        g     t  c        c 
   a                                 r       c              c                 a 
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **  ***** *       ** ***    ********** ***    ******** * *** *****************
ACAAGGCCTTTCTaTGTaAACAaTACATGAACCTTTACCCCGTTGCTCGGCAACGGCCAGGCCTGTGCCAAGTGTTTGCT
             c   c    g   gctc                ca        t g                     
             g                                            t                     
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ** ** **** *** ****** * *   * ** ** ******  *** *   *****  ******  * ********
GACGCAACCCCCACTGGTTGGGGCTTGGCCATTGGCCATCAGCGCATGCGTGGAACCTTTGTGGCTCCTCTGCCGATCCA
  t              c                                                     a        
                                                                                
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** ** ** ***** ** ** ** ** ****** ** *******  *     * *  ** ** ** ** ** *  ** *
TACTGCGGAACTCCTtGCAGCtTGTTTCGCTCGCAGCcGGTCTGGAGCGAaacTcATCGGCACaGACAAcTCTGTTGTCC
      a        a     c  c            a          a cta t     g  g     t     c    
                                                   cg                      g    
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *  * ** ** ** ** ** *********** ** **  **** ******** **  * ** ****  ***** ***
TCTCTaGGAAGTACACCTCCTTcCCATGGCTGCTCGGtTGTGCTGCcAACTGGATCCTgCGCGGGACGTCCTTTGTTTAC
    cc a  a  t  a     t           a  a        a                               
     m                               g                                          
     g                               c                                          

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ** ** * ********* ******** ** **  **** **  * **  * *  ** **     * * **  * ***
GTCCCGTCGGCGCTGAATCCcGCGGACGAcCCCTCtCGGGGtCGCTTGGGGcTgTAcCGCCCcCTTCTcCGTCTGCcGTT
     a  a           a        t  t      c  tc a  ag c tt     t     g     a t   
     c              t                                a              t           
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   ** ** ***** *  * ******** ***** * * **   *** *** * *    ****   ************ 
CCAGCCGACgACGGGTCGCACCTCTCTTTACGCGGaCTCCCCGTCTGTTCCTTCTCATCTGCCGGaCCGTGTGCACTTCG
  g   a  c        t                c            g       g        t              
         a                         t                                            
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***************     **** ** *** ***** ***         *    *         *         *  * 
CTTCACCTCTGCACGTCGCATGGAGACCACCGTGAACGCCCCctGgAgttTGCCAACAGTCTTACATAAgaGGACTcTTG
                 a      a            a   atcaa acc    c ag c    t c  ac       
                                           a   t                     cm       
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *                             *     *    *  **  **    * *** * ***   ** *** **
GACTTTCAGGA------------cGGTCAATgACCTGGATCGAAGAATACATCAAAGACTGTGTATTTAAgGACTGGGAG
    c  c  g            a      ccc       t c   c   t             g    ca         
       g               t                      t                                 
                       g                                                        

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***   **  * **      *  ** *   *      *  ******* * *  ****  **** *               
GAGcTGGGGGAGGAGAttAGGTTAAaGgTCTTTGTAtTAGGAGGCTGTAGGCATAAATTGGTCTGTTCACCAGCACCATG
   tc         cc       t a t a    c                            cg             
                ga                                                              
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * ** * *********** **     *  **  ****  *** ********* *** ************ * **** 
CAACTTTTTCACCTCTGCCTAATCATCTTTTGTTCATGTCCtACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTg
                     g    t c            c                                     a
                                                                                
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * ********* ****  **********  ** ** **    **  *  *  * *****  *    ** *  *  **  
GGGCATGGACATTGACCCTTATAAAGAATTTGGAGCTTCTGTGGAaTTaCTCTCtTTTTTGCCTTCTGAtTTCTTCCCgT
  a         c                    c       c   gc     g         atc  c    at  
                                                                c             
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      * **  *  *  *******   * *  *     *  *     *  * **  *  * ** *   *       ** 
CaGTTCGGGACCTACTCGACACCGCTTCAGCcCTcTACcGGGATGCTtTAGAgTCACCaGAACATTGCACaCCcaAcCAT
 gaca      ca          cg     t tta     gc  a      g      t cgatc t  c
 t            t           a       g           c                     t         
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *   *  * **   *       * ***   **  *        * *    ***** ***  * *  **  *  *  *
ACcGCTCTCAGGCAAGCTATtTTGTGcTGGGGTGAgTTAATGACTTTGGCTTCCTGGGTGGGcAATAAtTTGGAaGAcCC
  t   a        at g ag    t   aag  ag   c gt   c  ca          tc c  c   c   
                    c                      a   t                            
                                                                              

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**      ** *        *  * * **            ***** * **    *  *      *  *******    *
TGCaGCtAGGGAttTAGTaGTTAAcTATGTcAAcACTaAcATGGGCcTaAAaATTAGACAAtTgtTGTGGTTTCACATTT
  gtt c     cc g yg  gg t     t  t t c t      t g  g         c ac           g   
               c                   a                                            
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *   *    ****  *       * ** *  *   * ***  *  *  ** ****** * * *** **       ** 
CCTGcCTTACTTTTGGAAGAGAAACAGTTCTTGAGTATTTGGTGTCcTTTGGAGTGTGGATTCGCACTCCtCCtGCTTAT
    t  c tg         cctgt    g  a           t     g                 aatac    c
       a            a c      a                                          ay      
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *    ******** **** **** *  ***** **        ** *****     * ** ** *   * ***  **
AGACCACCAAATGCCCCTATCcTATCCACACTTCCGGAAACTACTGTTGTTAGACGACGAGGCAGGTCCCCTaGAAGAAG
  g    a             t    a             t g     a     g  a        a t   c       
                                                                                
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********** * **  ****** *** ***  *** **  *     **** *******   * **   ***** *** 
AACTCCCTCGCCTCGCaGACGAAGgTCTCAATCGCCGCGTCGCaGAAGATCTCAATCTCCAGCTTCCCAATGTTAGTATT
                ca      a        a         cac              gt      g           
                                                                                
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**     * *       ***    *  ** ** ** ** **  ******  **    *  *** ** * **    *  **
CCTTGGACTCATAAGGTGGGAAAtTTTACGGGgCTcTAtTCtTCTACTGTtCCTgCTTTtAATCCTgACTGGTtaACTCC
                k      c        a  t  c         a   a    c      a t   gcc     
                g                                 g               c       g     
                                                                                

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   ******  * ***** *  **  *  *  * **    *  ***** * **  ** ** **  * ** **  * **  
TTCTTTTCCTGAtATTCATTTaCATCAAGAtcTGATatctAAATGTGAACAATTTGTAGGCCCtCTcACaAAAAATGAAT
g         a c        g  cg ga ct a  tcac          g      g  t   t  t          
                                       a                        a  c          
                                                                                

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*       ** *** *  * *****  * * * * * *** *     ** ***** ** *     ** ** *  ** ** 
TgaGAAGaTTaAAATTggTtATGCCAgCcAGATTtTtTCCTAAggTTACcAAATAtTTTCCTaTGGAaAAaGGaATtAAA
 ac g rg  g     aa c      t t r   c a      ac c  t     c  c  cc a  g  g  c  c  g
                                                             at    c     g      
                                                                   t            

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  * ****  **  *    *********** **  *  *    ** ****  *****  * *** *    **  *  *
CCcTATTATCCTGAgcAtGcaGTTAATCATTAtTTTAAgACcAGACAtTATTTGCATACTTTATGGAAgGCgGGaATttT
         a  ta cttg           c  cc  a rg  c            c t     a  a   cc 
                 g                     t                          r  r      y 
                                                                                

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****   *   *   * *   ** **  ***** ** ** ** *  **  * ********* **  **************
ATATAAGAGAGAATCCACACGTAGCGCCTCATTTTGTGGGTCACCATATTCcTGGGAACAAGAGCTACAGCATGGGAGCA
      r rgr       c a  s   a        k           ca t         a                  
                                                                                
                                                                                

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** *  ** **                                   **** ** ***** *** * **  * *****  *
CCTCTcTCAACGACacGAAGgGGCATGGGACaGAATCTcTCTGTgCCCAATCCtCTGGGaTTCTTtCCAGACCATCAGCT
     a        ta    a          t      t     a        a     c   c g   r a        
              g                                      g                          
                                                                                

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******  * ****   ***** *** **   * ** ****** ******    ****** * ************ ****
GGATCCtCTaTTCAGgGCAAATTCCAGCAGTCCCGAcTGGGACTTCAACAaAAACAAGGACAaTTGGCCAATGGCAAACA
       t    aa          a      a  t             c gc        g                 
                                                     m        c                 
                                                     g                          

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** *    * **     *  ** ** ** ** ** **    ***** *** *  * ** ***** ** ** ** ** 
AGGTAGGA---GTGGGAGGaTACGGTCCaGGGTTCACACCCCCACACGGTGGCCTGtTGGGGTGGAGcCCtCAgGCACAg
                  cc  t  c  t     t        t            c    a     t  a  a     a
                   t        c                                                   
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**     *  * **   * **    * ** ***    *  **********       *  *   * *   *     * **
GGTGTgcTaACAACcTTGCCAGCAGATCCGCCTCCTGCTTCCACCAATCGGCGGTCCGGGAGaAAgCCAACCCCAGTCTC
   a tt     a        ga    a        cc           a aa g  a  g  a        t     
            t                                               r                 
                                                                              

      3210      3220      3230      3240  
....:....|....:....|....:....|....:....|..
** ***  * *  ***** ** ** ** *           * 
TCCACCTCTAAGAGACACaCATCCACAGGCcATGCAGTGGAA
                  t           ag a  a     
                              g           
                                          
© 1998-2020Legal notice