HBVdb

Dataset for nucleotide sequence SP of genotype E

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ******** * * **  *   *** **   * ***** *****        ***  *   *  * ** *  ******* 
ATGCCCCTATCTTATCAACACTTCCGGAGAaTACTGTTGTTAGACGAAGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCG
                       t    c       a        c                  c          a
                              t                                                 

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *  **   *  **  *** **  *** *  *  **** ***  * *         *** *  * *  *  *    
CCTCGCAGACGAAGATCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCCAGCTTCCCAATGATCATCAACCACCAGTAC
         c                                     tg    agc               c  
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **        *  * ***** **    * **     * ****      ***  *** ** **   *** **    *   
GGGACCCTGCCGAACCTGCACGACTCTTGCTCAAGGAACCTCTATGTTTCCCTCATGTTGCTGTTCAAAACCTTCGGACG
          a               c       a                      c       t              
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *** *** * ****  * ****** ***** * ** *** * ***** ********  ******* ** ***** **  
GAAATTGCACTTGTATTCCCATCCCATCATCATGGGCTTTCGGAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCC
                                                                             t
                                                                                

       330       
....:....|....:..
  * **  ** ***** 
TGGCTCAGTTTACTAG-
                 
                 
© 1998-2021Legal notice