HBVdb

Dataset for nucleotide sequence S of genotype E

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *      **     **   *         ***** * **   * **** *   * **  * ***   ** ** ***   
ATGGAAaGCATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAAAATCCTCAC
     gga   t      a                     ca           a     c                  
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** **        *   * *** *   *****  *** *  *  *         * **  *    ***** ** **   
AATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCTCCCGTGTGTCtTGGCCAAAATTCGC
       a a                            g           a tt           g           t  
                                                  r a            c              
                                                                 k              

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **  * ** ** **  **** **  * **   **** *  *  **   * *   **  * *  **    ****  *  *
AGTCCCCAAcCTCCAaTCACTCACCAACCTCTTGTCCTCCAATTTGTCCTGGCTATCGCTGGATGTGTCTGCGGCGTTTT
         t                            g         t     t                a    
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *  * ****   * ** ***  *       *  *              * *   *  *   * ** **   **  **
ATCATcTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTG
     a                                                        g                 
     m                                                        c                 
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *       **  ** *  * *  *        **           * *****       * *        ****    
TCCTCTAATTCCAGGATCATCAACCACCAGTACGGGACCCTGCCGAACCTGCACGACTCTTGCTCAAGGAACCTCTATGT
       c                    c           ta               c                    
                                                           y                    
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ****  ** ** **   *    *         **  *** * ** *  * ******  * ** **** * * * *   
TTCCCTCATGTTGCTGTTCAAAACCTTCGGACGGAAATTGCACTTGTATTCCCATCCCATCATCATGGGCTTTCGGAAAA
                  t            a                                                
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ********   ***  * ** ***** **      **  ** **  * **  * *  **  ** ****  *  * ***
TTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGCCGGGCTTTC
          g                     t          c         c                ta        
          t                     a                                               
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **       * * *    **  * *   * * ***  ** *  * *    *   *  ** *   *  *  * *   *
CCCCACTGTCTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTATAC
     t   t       t      g                      g gaa   c      c  g   g          
     y                                            r                             
                                                                                

       650       660       670       680  
....:....|....:....|....:....|....:....|..
   *    * ** ** **  *  *  ****  *         
CtCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAA-
tg    g  t                         c-g- 
 k    a                                -  
                                          
© 1998-2020Legal notice