HBVdb

Dataset for nucleotide sequence PreS2 of genotype E

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *     ** * *        ** *   *   **  *       **                       * ******** 
ATGCAGTGGAATTCCACAACaTTCCACCAAGCTCTGCAGGATCCCAGAGTAAGAGGCCTGTATtTTCCTGCTGGTGGCTC
g a  a          a g t  t      a    a   a      a     ag  t     -c-c              
                                                              g-c-              

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   **  *  * **     * ***** **   * *  *  * *   **  ***    **  * ** ***** ** **   
CAGTTCCGGAACAGTGAACCCTGTTCCGACTACTGCCTCaCTCATCTCGTCAATCTTCTCGAGGATTGGGGACCCTGCAC
               a g                   t     a                            t     
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  ** *    **  ** **   *  ***   ******** *   **   *  *** **** ** ***** ***** *
CGAACATGGAAaGCATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAAAATC
          gga                                 a           a                     
          c                                                                     

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** *** **  *** ******* ** **** ***** **** * ** ******    *****  *  * *********
CTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCTCCCGTGTGTCTTGGCCAAAA
                                           g           a t            g         
                                                                      c         

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ** ** ** ** ** ** ***** ** ** **** ******  *  ** ***** * *** * ***** ** *****
TTCGCAGTCCCCAAcCTCCAaTCACTCACCAACCTCTTGTCCTCCAATTTGTCCTGGCTATCGCTGGATGTGTCTGCGGC
  t           t     g        t               g           t                      
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **  *** * **************** * ***** **** ** *  ** ***** ** ** **  ** ** **** *
GTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCC
          a                                                        c            
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *** * * *   **  ** *  * *  *  *     **        *  * ***** **    * *      * ***
GTTTGTCCTCTAATTCCAGGATCATCAACCACCAGTACGGGACCCTGCCGAACCTGCACGACTCTTGCTCAAGGAACCTC
            c                      c            a               c       a       
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*      ***  *** ** **   ***  *    *    *** *** * ****  * ****** ***** * ** *** *
TATGTTTCCCTCATGTTGCTGTTCAAAACCTTCGGACGGAAATTGCACTTGTATTCCCATCCCATCATCATGGGCTTTCG
               c                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * *** ********  ******* ** ***** **   ** **  ** ********  * ** ** ********  ** 
GAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGCCGGG
                                   t                                     ta   
                                                                              

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** *** ** **  * *** *  * **  **** ******** *****  * *   **   *  ** *** *  *  **
CTTTCCCCCACTGTCTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTT
          t   t                                     g gaa          c      g     
                                                                                

       810       820       830       840      
....:....|....:....|....:....|....:....|....:.
*  **  **   ** ***** **  *  ** **** **  *  * *
TATACCtCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAA
     tg                 c          c      c g 
                                              
© 1998-2021Legal notice