HBVdb

Dataset for nucleotide sequence PreS2 of genotype E

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *     ** * *        ** *   *   **  *       **                       * *******  
ATGCAGTGGAATTCCACAACaTTCCACCAAGCTCTGCAGGATCCCAGAGTAAGAGGCCTGTATtTTCCTGCTGGTGGCTC
g a  a       a  a g t  t   a  a    a   a      a     ag  t     -c-c              
                                                              g-c-              

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   **  *  * *      *  * **      * *  *  * *   **  ***    *   * *  *** *     *   
CAGTTCCGGAACAGTGAACCCTGTTCCGACTACTGCCTCaCTCATCTCGTCAATCTTCTCGAGGATTGGGGACCCTGCAC
               a g                   t     a                            t     
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     ** *         * **      ***    **** ** *   **   *  *** **** *  * * * ***** *
CGAACATGGAAaGCATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAAAATC
          gga   t                             a           a                     
          c                                                                     

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**   *** **  *** ** ****  * **** *****   *    ** ******      * *  *    ***** ** 
CTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCTCCCGTGTGTCTTGGCCAAAA
                                           g           a t            g         
                                                         a            c         

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  * *  ** ** *  *  ***** ** *   ***   **       ** * **  *  *  * ****   *  *** 
TTCGCAGTCCCCAAcCTCCAaTCACTCACCAACCTCTTGTCCTCCAATTTGTCCTGGCTATCGCTGGATGTGTCTGCGGC
            t     g        t               g     g     t                      
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **    * * *  ** ***** * ** * ***** **** ** *  ** ***** ** ** **  ** ** **** *
GTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCC
          a                                                        c            
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *** * * *   **  ** *  * *  *  *     **        *  * * *** **    * *      * ***
GTTTGTCCTCTAATTCCAGGATCATCAACCACCAGTACGGGACCCTGCCGAACCTGCACGACTCTTGCTCAAGGAACCTC
            c                      c            a               c       a       
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*      ***  **  **  *   * *  *    *    ***   * *   **  * ****** ***** * ** *** *
TATGTTTCCCTCATGTTGCTGTTCAAAACCTTCGGACGGAAATTGCACTTGTATTCCCATCCCATCATCATGGGCTTTCG
  ca           c                    aa                                          
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * *** ********  ******* ** ***** **   ** **  ** ********  * ** ** ********  ** 
GAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGCCGGG
                                   t                                     ta   
                                                                              

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** *** ** **  * *** *  * **  **** ******** *****  * *   **   *  ** *** *  *  **
CTTTCCCCCACTGTCTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTT
          t   t                                     g gaa          c      g     
                                                                                

       810       820       830       840      
....:....|....:....|....:....|....:....|....:.
*  **  **   ** ***** **  *  ** **** **  *  * *
TATACCTCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAA
     tg                 c          c      c g 
                                              
© 1998-2022Legal notice