HBVdb

Dataset for nucleotide sequence PreS1 of genotype E

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** * ***** *** * ** ** **    **   *** ** ***               *   ****     * *****
ATGGGGCTTTCTTGGACGGTCCCTCTCGAATG---GGGGAAGAATCATTCCACCACCAATCCTCTGGGATTTTTTCCCGA
     a     g              a              a     g      t a      t                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** **** *** ****  ***   ** **  **   *   * ********    *****    * * *  * **     
CCACCAGTTGGATCCAGCATTCAGAGCAAACACCAGAAATCCAGATTGGGACCACAATCCCAACAAAGACCACTGGACaG
                  g   ca   g    cac              tat        c            ag 
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * * * *********** *  * *   *  * **  *  * **    ** *      *  * **        * *  
AAGCCAACAAGGTAGGAGTGGGAGCATTCGGGCCgGGGTTCACTCCCCCACACGGAGGCCTTTTGGGGTGGAGCCCTCAG
cc                        t     t   c        g            c    a c   t      
                                  a                                             

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****  **               ***        * **   *   *    **   *           **  *** ** **
GCTCAAGGCATGCTAAAAACATTGCCAGCAGATCCGCCTCCTGCCTCCACCAATCGGCAGTCAGGAAGGCAGCCTACCCC
            tagcct tgg     a  a                            a                    
                    c                                                           

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * **       **  * *     *     *      *     ** *          ** *   *   **  *      
AATCACTCCACCTTTGAGAGACACTCATCCTCAGGCCATGCAGTGGAATTCCACAACaTTCCACCAAGCTCTGCAGGATC
      g                 g     c      g a  a       a  a g t  t      a    a   a   
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **                       * ********    **  *  * **     * ***** **   * *  *  * *
CCAGAGTAAGAGGCCTGTATtTTCCTGCTGGTGGCTCCAGTTCCGGAACAGTGAACCCTGTTCCGACTACTGCCTCaCTC
   a     a----------c-c                           a g                   t   
          g  t     g-c-                                                         

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   **  ***    **  * ** ***** ** **     *  ** *    **  ** **   *  **    ******** 
ATCTCGTCAATCTTCTCGAGGATTGGGGACCCTGCACCGAACATGGAAaGCATCACATCAGGATTCCTAGGACCCCTGCT
  a                            t               gga   t                          
                                               c                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   **   *  *** **** ** ***** ***** ***** *** **  *** ******* ** **** ***** ****
CGTGTTACAGGCGGGGTTTTTCTTGTTGACAAAAATCCTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCA
   a           a    c                                                           
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * ** ******    *****  *  * *********** ** ** ** ** ** ** ***** ** ** **** *****
ATTTTCTAGGGGGAGCTCCCGTGTGTCTTGGCCAAAATTCGCAGTCCCCAAcCTCCAaTCACTCACCAACCTCTTGTCCT
g           a t            g           t           t     g        t             
                           c                                                    

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *  ** *****   *** * ***** ** ******* **  *** * **************** * ***** **** 
CCAATTTGTCCTGGCTATCGCTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTT
  g         t     t                          a                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** *  **  **** ** ** **   * ** **** **  *** * *     **  ** *  * ** *  *     **  
CTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCATCAACCACCAGTACGGGAC
                        c                        c                    c       
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *  * ***** **    * *      * ****      ***  *** ** **   ***  *  * *    *** 
CCTGCCGAACCTGCACGACTCTTGCTCAAGGAACCTCTATGTTTCCCTCATGTTGCTGTTCAAAACCTTCGGACGGAAAT
    ta               c       a         c            c       t                   
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** * ****  * ****** ***** * ** *** * * *** ********  ******* ** ***** **   ** *
TGCACTTGTATTCCCATCCCATCATCATGGGCTTTCGGAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCT
                                                                        t     
                                                                              

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  ** ********  * ** ** ********  **  ** *** ** **  * *** *  * **  **** ********
CAGTTTACTAGTGCCATTTGTTCAGTGGTTCGCCGGGCTTTCCCCCACTGTCTGGCTTTCAGTTATATGGATGATGTGGT
                                ta             t   t                            
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *****  * *    *   *  ** **  *  *  ***  **  **   ** ***** **  *  ** **** **  *  
ATTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTATACCtCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATT
         g gaa          c      g          tg       t         c          c      c
                                                                                

   
...
* *
TAA
 g 
   
© 1998-2021Legal notice