HBVdb

Dataset for nucleotide sequence Genomes of genotype E

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *       *** *   *   *** *   *  ***   *       *           * ********    ** **  *
TTCCACAACATTCCACCAAGCTCTGCAGGATCCCAGAGTAAGAGGCCTGTATtTTCCTGCTGGTGGCTCCAGTTCCGGAA
  a  a g    t      a    a   a      ag    ag  t      ccc                         
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***  *  ******* ***  ***  ** * *   **  *** ** *** * ** ***** ** **    **  ** *  
CAGTGAACCCTGTTCCGACTACTGCCTCACTCATCTCGTCAATCTTCTCGAGGATTGGGGACCCTGCACCGAACATGGAA
    a                   t     a                            t               c
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **  ** **  ** ****   ******** **  ******* *** **** ** ***** ***** ***** *** **
AGCATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAAAATCCTCACAATACC
ga                                 a           a                                
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *** ********************* **** * ** ******    ****** *  * *********** ** ** **
GCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCTCCCGTGTGTCTTGGCCAAAATTCGCAGTCCC
     a                          g           a t            g           t        
                                              a            c                    
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ** ** ***** ** ** ***********  *  ** ***** * *** * ***** ** ******* **  *** 
CAAcCTCCAaTCACTCACCAACCTCTTGTCCTCCAATTTGTCCTGGCTATCGCTGGATGTGTCTGCGGCGTTTTATCATC
   t     g                        g         t                                a
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****************** * ***** ******* *  ** ***** ** ** **  ** ** **** **  *** * * 
TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCT
                                                        c                       
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   **  ****  * *  *  *   * **        *  * ***** **    * ***    * ****     *****
AATTCCAGGATCATCAACCACCAGTACGGGACCCTGCCGAACCTGCACGACTCTTGCTCAAGGAACCTCTATGTTTCCCT
 c          cc                      ta               c                          
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *** ** ***  *** **    *    *** *** * ****  ******** ***** ******** * ***** ****
CATGTTGCTGTTCAAAACCTTCGGACGGAAATTGCACTTGTATTCCCATCCCATCATCATGGGCTTTCGGAAAATTCCTA
    c       t                                                                   
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****  ******* ** ***** ***  *****  ** ********  * ** ** ********  ** ******* ** 
TGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGCCGGGCTTTCCCCCAC
                                                            ta             t
                                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  * *****  * **  ************* *****  * *   **   *  ** *** *  *  *** ***  **  
TGTCTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTATACCTCTGT
   t                                     g  aa   a      c                  g    
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ***** **  ** ** **** ** **  * **  *    **    **  * ***** **  *     * ** ****
TACCAATTTTCTTTTGTCTTTGGGTATACATTTAAATcCCAACAAAACAAAAAGATGGGGATATTCCCTaaATTTCATGG
                        c      c g   t t  t     t   c g           tt gc c  t    
                                     g a                             t  g       
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *    *** * ****  ** **  * ** **  * ** **   *   ** ***    * *****  * ** ** ** 
GTTATGTAATTGGaAGTTGGGGgTCATTACCACAgGAACACATCAgAaTGAAAATCAAAGACTGTTTTAGAAAACTCCCT
  ca       t        a     g  g   t     tca tca      c g  t              t  a
                      c              c       c ca                               
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * *   * *   * ** ***** *   ****  *  * *  ** **  * ** ***** ** ** ** ** ********
GTTAAcCGGCCTATTGATTGGAAAGTATGTCAAaGAATTGTGGGTCTTTTGGGCTTTGCTGCCCCTTTTACACAATGTGG
  c  ta a  c              c     gc gc c         a  t           c     g        
                          g                                                   
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  ** ** **  ****  * **  *  *    **        * *****    ** ** ** *  ** *** * **  
aTATCCTGCTTTAATGCCTCTgTATGCGTGTATTCAATCTAAGCAGGCTTTCACTTTCTCGCCAACTTACAAGGCCTTTC
g                t a   a  c cc  ggac g         t tg  t  a  g         a    ct
c                  a c              c  g                                        
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*       ** **   *  ***** ***** **   *  *****   *   * ******** ******** ***** ***
TGTGTAAACAATAccTGAACCTTTACCCCGTTGCCCGGCAACGGCCaGGTCTGTGCCAAGTGTTTGCTGATGCAACCCCC
     ccc  g  ta  gc               t         tac                       c         
                                              t                                 
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ** ********* *  * * *  **  **    *  **   ***   * * **    *  *******  ********
ACTGGCTGGGGCTTGGCCATAGGCCATCAGCGCaTGCGtGGAACCTTTGTGGCTCCTCTGCCGATCCATACTGCGGAACT
     t              g   at   a   c a  c        c         a a  a        g        
                    t            g                                              
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * ** ** ***** ***  **** *  **** **     * ** ** ** ** ***** ** ** ** ** ** ** *
CCTAGCCGCTTGTTTTGCTCGCAGCAGGTCTGGAGCgAAACTTATCGGGACaGATAATTCTGTCGTTCTCTCcCGGAAAT
 t    a  c               c       g  a cc  c  a  a  t  c     c  t  c     a  a    
      g                                      t     g                    t       
                                                   c                            

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **  * ** ****** **** ** **  **** ** *** * **    *********** *  * *********    
ATACATCaTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTgCGAGGGACGTCCTTTGTCTACGTCCCGTCAGCG
     c                 a   a                aa                t           g   
       g                                      t                                 
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * ** *  * ****** ** *   **** *   * **    *  ***** *  **    **    * **   *  * **
CTGAATCCTGCGGACGACCCgTCTCGGGGTCGCTTGGGGaTCTaTCGTCCCCTTCTCCGTCTGCCGTTCCaGCCGACCAC
     c              c        c   c     g t cc        a                ga   t    
                    a                                                         
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** *  ** * * * *** * * ****** * **   **   *  *   **  *** * * ***** * ****** *  
GGGGCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTgCCTTCTCATCTGCCGGaCCGTGTGCACTTCGCTTCACCTCTGC
               g              a     tg  a   gc       t                          
                                    a                g                          
                                                     c                          

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****  *****   **   **** * * *                * *** **      * **  ***** *******  
ACGTCGCATGGAGACCACCGTGAACGCCCAC------CAAaTcTTGCCCAAGGTCTTACATAAGAGGACTCTTGGACTCT
            a   c        a    t      aggcga               t     c             
                                        t                                       
                                        g                                       

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      ******** * * ********  ** **** *  ***  **** **  ********** *  ********    
CtGCAATGTCAACGACCGACCTTGAGGCATACTTCAAAGACTGTTTGTTTAAAGACTGGGAGGAGTtGGGGGAGGAGAtT
ag t                        g                                            cc 
                                                                                
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *      *   ***    *********************** **           ** *   ****** *** ****
AGaTTAAaGgTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTCTGCGCACCAGCACCATGCAACTTTTTCACCTCTGC
  g c ct a g        c                            t    t                g        
                                                                                
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** **** *   ** *  ***  * *  ******** ** *  ** ************** ** *****   * ** **
CTAATCATCTCTTGTTCATGTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTgGGgCATGGACATTGACCC
                                                             a  a         c  t  
                                                             r            y     
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *******  *******     *   *  * * **  ********    ** ** * **  **       *  **  *  
TTATAAAGAATTTGGAGCTaCTGTGGAGTTACTCTCGTTTTTGCCTTCTGACTTCTTTCCTTCAGTAAGAGATCTTCTAG
                   tg               t        gggc  t  t a  ag  c  t a           
                                    a         a                                 
                                              c                                 

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *        *        *    **  *  *          **     *                 * ****     
ATACCGCCTCaGCTCTGTATCGGGATGCCTTAGAATCTCCTGAGCATTGTTCACCtCACCAcACtGCACTCAGGCAAGCC
    t  ac t   t c t                 t    a     ca   yg  t ct  g  ta          t
          c                                            c  a     c               
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  * ** *****  *  * *      *    **  **** **    ** **  * *  *     **  * **     *
ATTCTTTGCTGGGGgGAacTAATGAcTCTAGCTACCTGGGTGGGtGtAAATTTGGAAGATCCAGCATCCAGGGACCTAGT
g  a g  t      ct t   tact    c           g ct  c  ac c  c a t c   a  ttat  
   t             tg g      a                  g                a        a  g  
                  a                           a                                 

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **    ***** **   *      *   *        *  ** *  *  ** ****    **     * *  ** ** *
AGTcAGTTATGTCAATACTAATATGGGCCTAAAGTTCAGGCAATTATTGTGGTTTCACATTTCTTGTCTCACTTTTGGAA
g  tg c     t  c a c  g   cat    a          c          t c       a t   c    
                                                                           g    
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        **  *  * *  ** ** ** *  ** *  ***** * *******    * ** ** **   **********
GAGAAACcGTCaTAGAGTATTTGGTGTCTTTTGGAGTGTGGATTCGCACTCCTCCAGCTTATAGACCACCAAATGCCCCT
  c tgtt  tg      tc     a  c                        attc    c     g a          
    c  a   t                                          ac                        
           c                                                                    

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** **  *   *** **   * ***** *****              **** *   *  **** *  ******* **
ATCTTATCAACACTTCCGGAGAaTACTGTTGTTAGACGAAGAG------GCAGGTCCCCTAGAAGAAGAACTCCCTCGCC
               t  a c       a        c                        c          a  
                      t                                                      t  
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *  **   *  **  *** **  *** * **  **** **** * *    *    *   * *** ** *   * *  
TCGCAGACGAAGATCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCCAGCTTCCCAATGTTAGTATTCCTTGGACTCAC
                                               t     ag             g        t
                                                                                
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********        * **  * ** *** *       *     ** **       * * ** * *  *  ** **   
AAGGTGGGAAATTTTACGGGGCTTTAcTCTTCTACTATACCTGTCTTTAATCCTAACTGGAAAACTCCATCTTTTCCTGA
                       c  t   a c   t t   a        t  cg       c    c   c   a 
                                                                    t           
                                                                                

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** **  *  * ** **  *  *    *  ** *   ** * ** ** **  * ** **  *  *** * *  *  * *
TATTCATTTGCACCAGGACATTATTAACAAATGTGAACAATTTGTAGGTCCTCTAACAGTAAATGAAAAACGAAGATTAA
c            a       t      g        g  c  ct g             a gc gc   
                                                      t                         
                                                                                

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *  *  ******* *  ** *****       ** ** **    **    ** ** ** *  **  * ** ** ** 
AcTTAGTcATGCCTGCTAGATTTTTTCCCATCTCTACgAAATATTTgCCCCTAGAGAAAGGTATAAAACCTTATTATCCA
 tc  a                    t  ag    a        a  at g  t  g  c           c     c
 a                                   t        t  t           g                 t
                                                                                

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *  *  ******* ***** ***    * ** ***** *  **  * *** ***  **  * *******   * * 
GAtAATGTAGTTAATCATTACTTCCAAACCAGACACTATTTACATACCCTATGGAAGGCGGGCATCTTATATAAAAGaGA
  c   c              t     tc          g  c  tt t   g                 gc g  
  g                                               g                             
  a                                                                             

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *       ** *****    **    ** **  ** ******  *   ** * ****** *              
AACTACaCGTAGCGCCTCATTTTgTGGGTCACCTTATTCTTGGGAACAAGAGCTACATCATGGGGCTTTCTTGGACGGTC
   gt c     t        c tg  t     a              c  c            a     g         
      g                a                                                        
                                                                                

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                   * ***   **        * *   *****    * ***** ** ******** ****  **
CCTCTCGAATG---GGGGAAGAATCATTCCACCACCAATCCTCTGGGATTTTTTCCCGACCACCAGTTGGATCCAGCATT
     a              a   t g      t a      t                   t              g  
                          a                                                  c  
                                                                                

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   ** ** ***   *  ***********    ******  ******  * ***       * * * *********** 
CAGAGCAAACACCAGAAATCCAGATTGGGACCACAATCCCAACAAAGACCACTGGACaGAAGCCAACAAGGTAGGAGTGG
 ca   g       a               ta         c             g cc                   
                                                         c                      
                                                                                

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  * **  *  * **  *  * ** *  ** ***    *  ****   **  ** * ****** ** *           
GAGCATTcGGGCCgGGGTTCACTCCCCCACACGGAGGCCTTTTGGGGTGGAGCCCTCAGGCTCAAGGCATGCTAAAAACA
         t   c        g  t         c    a c   t           g      tagcc  tg
             a              c                                                   
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ***   *                         *    * *    *** *** ** ** ** **     * ***** * 
TTGCCAGCAGATCCGCCTCCTGCCTCCACCAATCGGCAGTCAGGAAGGCAGCCTACCCCAATCACTCCACCTTTGAGAGA
    a  a                            a                                         
                                                                                
                                                                                

      3210      3220       
....:....|....:....|....:..
 ** *     *      *     ** *
CACTCATCCTCAGGCCATGCAGTGGAA
   g     c      g a  a     
                           
                           
© 1998-2020Legal notice