HBVdb

Dataset for nucleotide sequence Genomes of genotype E

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          ** *   *   **  *                                * ********    **  *  *
TTCCACAACATTCCACCAAGCTCTGCAGGATCCCAGAGTAAGAGGCCTGTATttTCCTGCTGGTGGCTCCAGTTCCGGAA
  a  a g    t      a    a  aa      a-----a----------c--                       
                                   -g    -g  t      -cc                         
                                         c                                      

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **  *  * ***** **   ***  ** * *   **  *** *  *** * ** ***** ** **    **  ** *  
CAGTGAACCCTGTTCCGACTACTGCCTCACTCATCTCGTCAATCTTCTCGAGGATTGGGGACCCTGCACCGAACATGGAA
    a                   t     a                            t     g         c
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **  ** **   * ***    ******** **  ******* *** **** ** ***** ***** ***** *** **
AGCATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAAAATCCTCACAATACC
ga   t                             a           a                                
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *** ********************* **** * ** ******    *****  *  * *********** ** ** **
GCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCTCCCGTGTGTCTTGGCCAAAATTCGCAGTCCC
     a                          g           a tt           g           t        
                                              a            c                    
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ** ** ***** ** ** **** ******  *  ** *****   *** * ***** ** ******* **  *** 
CAAcCTCCAaTCACTCACCAACCTCTTGTCCTCCAATTTGTCCTGGCTATCGCTGGATGTGTCTGCGGCGTTTTATCATC
   t     g        t               g cc        t     t                          a
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **************** * ***** ******* *  **  **** ** ** **   * ** **** **  *** * * 
TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCT
                                                        c                       
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    **  ****  * *  *  *     **        *  * ***** **    * **     * ****      ****
AATTCCAGGATCATCAACCACCAGTACGGGACCCTGCCGAACCTGCACGACTCTTGCTCAAGGAACCTCTATGTTTCCCT
 c          cc          c           ta               c         g                
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *** ** ***  *** **    *    *** *** * ****  ******** ***** ******** * ***** ****
CATGTTGCTGTTCAAAACCTTCGGACGGAAATTGCACTTGTATTCCCATCCCATCATCATGGGCTTTCGGAAAATTCCTA
    c       t                                                                   
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****  ******* ** ***** **   ** **  ** ********  * ** ** ********  ** ******* ** 
TGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGCCGGGCTTTCCCCCAC
                        t                                     ta             t
                                                                               y
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  * *****  * **  *************  ****  * *   **   *  ** **  *  *  * * ***  **  
TGTCTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTATACCTCTGT
   t                                   g gaa   a      c      g          tg    
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ***** **  *  *  **** **  *  * **  *    **    *   * ***** **  *     * ** ****
TACCAATTTTCTTTTGTCTTTGGGTATACATTTAAATcCCAACAAAACAAAAAGATGGGGATATTCCCTaaATTTCATGG
g  t                    c      c g   t t  t     t  gc g     t     tt gc c  t    
                                     g a                             t  g       
                                                                     c          

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *    *** * ****  ** **  * ** **  * ** **       ** ***    * *****  * ** ** ** 
GTTATGTAATTGGaAGTTGGGGgTCATTACCACAgGAaCACATCAgAaTGAAAATCAAAGACTGTTTTAGAAAACTCCCT
  ca       t        a   g  g   t     tca tca      c g  t      g     t  a
             c        c        c     c       c ca            a                  
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * *   * *   * ** ***** *     *   *  * *  ** **  * ** ** ** ** ** ** ** ***** **
GTTAAcCGGCCTATTGATTGGAAAGTATGTCAAaGAATTGTGGGTCTTTTGGGCTTTGCTGCCCCTTTTACACAATGTGG
  c  ta a  c              c     gc gc c         a  t           c     g        
                          g           a                                       
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  ** ** **  ****    **  *  *    **        * *****    ** ** *  *  ** * * * **  
aTATCCTGCTTTAATGCCTCTgTATGCGTGTAtTCAATCTAAGCAGGCTTTCACTTTCTCGCCAACTTACAAGGCCTTTC
g                t a   a  c cc  ggac g         t tg  t  a  g         a    ct
c                  a c            c  g                                        
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*       ** **   *  ***** ***** **   *  * ***   *   * ******** ***** ** ***** ***
TGTGTAAACAATAccTGAACCTTTACCCCGTTGCCCGGCAACGGCCaGGTCTGTGCCAAGTGTTTGCTGATGCAACCCCC
 a a ccc  g  ta  gc               t         tac                       c         
                                              t                                 
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ** ********* *  * * *  **  **    *  **   ***   * * **    *  * *** *  *** ****
ACTGGCTGGGGCTTGGCCATAGGCCATCAGCGCaTGCGtGGAACCTTTGTGGCTCCTCTGCCGATCCATACTGCGGAACT
     t            g   at   a   c a  c        c         a a  a        g        
                    c            g                                              
                    t                                                           

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * ** ** ***** ***  **** *  **** **     * *  ** **  * ** ** ** ** ** **  * **  
CCTAGCCGCTTGTTTTGCTCGCAGCAGGTCTGGAGCgAAACTTATCGGGACaGATAATTCTGTCGTTCTCTCcCGGAAAT
 t g  a  c               c       g  accc  c  a  a   c     c  t  c      a    
      g                                      t                         c    
                                                                              

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **  * ** ****** **** ** **  **** ** *** * **    *********** *  * *** * ***    
ATACATCaTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTgCGAGGGACGTCCTTTGTCTACGTCCCGTCAGCG
     c                 a   a                aa                t           g   
       g                                      t                                 
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * ** *  * ****** ** *   **** *   * **       * *** *  **    **    * **   *  * **
CTGAATCCTGCGGACGACCCgTCTCGGGGTCGCTTGGGGaTCTaTCGTCCCCTTCTCCGTCTGCCGTTCCaGCCGACCAC
     c              c        c  tc     g t cc        a     a          ga   t    
                    a                    a g                               c    
                                           t                                    

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* * *  ** * * * *** * * *****  * **   **   *  *   **  *** * * ***** * ******    
GGGGCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTgCCTTCTCATCTGCCGGaCCGTGTGCACTTCGCTTCACCTCTGC
               g              a     tg  a   gc c     t                      t   
                                    a                g                          
                                                     c                          

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****  *****   **   **** *   *                * *** **      * **  ***** * ****   
ACGTCGCATGGAGACCACCGTGAACGCCCAC------CAAaTcTTGCCCAAGGTCTTACATAAGAGGACTCTTGGACTCT
            a   c        a t  t      aggcga               t     c             t 
                                        t                                       
                                        g                                       

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      ******** * * ********  ** **** *   **  * ** **  **** ***** *  ********    
CtGCAATGTCAACGACCGACCTTGAGGCATACTTCAAAGACTGTTTGTTTAAAGACTGGGAGGAGTtGGGGGAGGAGAtT
ag t                        g         a     g           a                cc 
 c                          c                                                 g 
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *      *   ***    **** ******** *****   * **           ** *   *****   ** ****
AGaTTAAaGgTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTCTGCGCACCAGCACCATGCAACTTTTTCACCTCTGC
  g c ct a g     ct c                       g    t    t                g        
                                                                                
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** ***  *   ** *  ***  * *  ****** * *  *  ** ********* **** ** *****   * ** * 
CTAATCATCTCTTGTTCATGTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTgGGgCATGGACATtGACCC
                       c             t        c              a  a         c  t  
                                                             r            y     
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *** ***  ***** *         *  *   **  ********    ** ** * **  **       *   *  *  
TTATAAAGAATTTGGAGCTaCTGTGGAGTTACTCTCGTTTTTGCCTTCTGACTTCTTTCCTTCAGTAAGAGATCTTCTAG
                   tgc              t        gggc  t  t a  ag  ca t a           
                                    a         a                                 
                                              c                                 

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *                 *    **  *  *          **     *                 * ****     
ATACCGCCTCaGCTCTGTATCGGGATGCCTTAGAATCTCCTGAGCATTGTTCACCtCACCAcACTGCACTCAGGCAAGCC
    t  ta t   t c t                 t    a   gtca c yg  t ct  g  ta         tt
       ac c                                          c  a     c               
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    * ** *****  *  * *      *    **  **** **    ** **  * *  *     **  * **     *
ATTCTTTGCTGGGGgGAacTAATGAcTCTAGCTACCTGGGTGGGtGtAAATTTGGAAGATCCAGCATCCAGGGACCTAGT
g  a g  t      ct t   taca   gc           g ct  c  ac t  c a t c   a  ttat  
   t             tg g      t                  g         g      a        a  g  
                  a                           a         c                       

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **    ***** **   *      *   *           ** *  *  ** * **    **     * *  ** ** *
AGTcAGTTATGTCAATACTAATATGGGCCTAAAGTTCAGGCAATTATTGTGGTTTCACATTTCTTGTCTCACTTTTGGAA
g  tg c     t  c a c cg t cat t  a     a      c          t c      ca t tg  c  g 
                              g                                            g    
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        **     * *  ** ** ** *  ** *  ***** * *******    * ** ** **    *********
GAGAAACcGTCaTAGAGTATTTGGTGTCTTTTGGAGTGTGGATTCGCACTCCTCCAGCTTATAGACCACCAAATGCCCCT
  c tgtt  tg      tc     a  c                        aatc g  c     g a          
    c  a  at                                          tc  c                     
           c                                                                    

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** * **  *   *** **   * ***** *****              **** *   *  * ** *  ******* **
ATCTTATCAACACTTCCGGAGAaTACTGTTGTTAGACGAAGAG------GCAGGTCCCCTAGAAGAAGAACTCCCTCGCC
               t  a c       a        c                        c          a  
                      t                                                      t  
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *  **   *  **  *** **  *** *  *  **** **** * *    *    *   *  ** ** *   * *  
TCGCAGACGAAGATCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCCAGCTTCCCAATGTTAGTATTCCTTGGACTCAC
       cc                                      tg g  agc            g        t
                                                                                
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********        * **  * ** *** *       *     ** **       * * ** * *     ** **   
AAGGTGGGAAATTTTACGGGGCTTTAcTCTTCTACTATACCTGTCTTTAATCCTAACTGGAAAACTCCATCTTTTCCTGA
        c            c  t   a c   t t   a        t  cgt      c    t t   c   a 
                                                                    c           
                                                                                

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** **  *  * ** **  *  *    *  ** *   ** * ** ** **  * ** **  *  ***   *  *  * *
TATTCATTTGCACCAGGACATTATTAACAAATGTGAACAATTTGTAGGTCCTCTAACAGTAAATGAAAAACGAAGATTAA
c            a     g t      g        g  c  ct t             a gc gc   
                                                      g                         
                                                                                

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *  *  ******* *  ** * ***       ** ** **    **    ** ** ** *  **  * ** ** *  
AcTTAGTcATGCCTGCTAGATTTTTTCCCATCTCTACgAAATATTTgCCCCTAGAGAAAGGTATAAAACCTTATTATCCA
 tc  a                    t  tg    a        a  at g  t  g  c           c  c  c
 a                             a     t        t  t           g                 t
                                                                                

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *  *  ******* ***** **     * ** ***** *  **  * *** ***  **  * *******   * * 
GAtAATGTAGTTAATCATTACTTCCAAACCAGACACTATTTACATACCCTATGGAAGGCGGGCATCTTATATAAAAGaGA
  c   c              t     tc    t     g  c  tt t   g                 gc g  
  g                                               g                             
  a                                                                             

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *       ** *****    **    *  **  *  ******  *   ** * ****** *              
AACTACaCGTAGCGCCTCATTTTgTGGGTCACCTTATTCTTGGGAACAAGAGCTACATCATGGGGCTTTCTTGGACGGTC
   gt c     t        c tg  t     a              c  t            a     g         
      g                a                           c                            
                                                                                

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                   * ***    *          *   ****     * ***** ** ******** ****  **
CCTCTCGAATG---GGGGAAGAATCATTCCACCACCAATCCTCTGGGATTTTTTCCCGACCACCAGTTGGATCCAGCATT
     a              a   t g      t a      t                   t              g  
                          a                                                  c  
                                                                                

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   ** ** ***   *  ** ********    *****    * ***    ***       * * * *********** 
CAGAGCAAACACCAGAAATCCAGATTGGGACCACAATCCCAACAAAGACCACTGGACaGAAGCCAACAAGGTAGGAGTGG
 ca   g  t   cac              ta         c      t       ag cc                   
                                                         c                      
                                                                                

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  * **  *  * **  *  * ** *  ** **     *  * **    *   * * *****  ** *           
GAGCATTcGGGCCgGGGTTCACTCCCCCACACGGAGGCCTTTTGGGGTGGAGCCCTCAGGCTCAAGGCATGCTAAAAACA
         t   c        g  t         c    a c   t           g      tagcc  tg
             a              c                                                  c
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ***                             *    *      **  *** ** ** ** **     * ***** * 
TTGCCAGCAGATCCGCCTCCTGCCTCCACCAATCGGCAGTCAGGAAGGCAGCCTACCCCAATCACTCCACCTTTGAGAGA
    a  a    a        t        g     a      c                   g              
                                                                                
                                                                                

      3210      3220       
....:....|....:....|....:..
 *  *     *      *     ** *
CACTCATCCTCAGGCCATGCAGTGGAA
   g     c      g a  a     
                           
                           
© 1998-2021Legal notice