HBVdb

Dataset for nucleotide sequence PreS2 of genotype D

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                    *  **       
ATGCAGTGGAAcTCCACAACCTTCCACCAAACTCTGCAAGATCCCAGaGTGAGAGGCCTGTATTTCCCTGCTGGTGGCTC
  a        t aa a  at  t  t   g gt a          ag    ag     a   c t              
                    a                                t                          
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                   * ** *   *     *                          *           * **   
CAGTTCAGGAACAGTAAACCCTGTTCCGACTACTGcCTCTCcCaTATCGTCAATCTTCTCGAGGATTGGGGACCCTGCGC
      c agg   cg          t   c    ta    a tc  t              a           t  tat
                                                                               a
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     ***           *                   *            **  *    *     *   * *     *
TGAACATGGAGAACATCACATCAGGATTCCTAGGACCCCTgCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATC
c   t     a               c             t                      c           a    
a                                                                               
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *                 *   **  * *  **   *         *     **                **    *  
CTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGaACtACCGTGTGTCTTGGCCAAAA
           aa                              g           ag ac          g         
                                                           g                    
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  *  *               * **   * * *   *  ***           *  * **              * * 
TTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCCTGTCCTCCAACTTGTCCTGGTTATCGCTGGATGTGTCTGCGGC
                                    t        g           a     t       a        
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       **     *  * *  *  *      *  *  *     *  * *  *                *         *
GTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCC
          a                 t          c                        c gg            
                                                                   c            
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**    **                       *             *              *         * *  *    
GTtTGTCCTCTAATTCCA------GGATCtTCAACc---------ACCAGCacGGGACCATGCaGAACCTGCACGACTcC
  c      a gc                c  g  t               gt    a c   cag  t     taat
  g                          a     a                     t                      
                             g                                                  

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                               **  *    **             *    **    ** ** * **** *
TGcTCAAGGAACCTCTATGTATCCCTCCTGTTGCTGTACCAAACCTTCGGACGGAAATTGCACCTGTATTCCCATCCCAT
  t      c          t      a  c     ta     c t   ta    c     a                
                           t                                                    
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** **    *    **  *  * * **   ***        **        *     *           *  *  *  
CATCcTGGGCTTTCGGAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTT
    t          c              c        t            a                    c      
    a                                               t                           
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*       *           *         **    *     *    ** *          ***  * *           
CAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAg
          c              t   c       t      g t           g           aa   cgtca
                                              c                             t  c
                                                                                

       810       820       830       840       850       860 
....:....|....:....|....:....|....:....|....:....|....:....|.
   *         *           *       *   *                       
CATCTTGAGTCCCTTTTTACCGCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAA
  c     ag      a   t                  a     c    cg     c g 
                                             g               
                                                             
© 1998-2022Legal notice