HBVdb

Dataset for nucleotide sequence Genomes of genotype D

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                             *                           *  **   * *  *  *      
cTCCACAACCTTCCACCAAACTCTGCAAGATCCCAGaGTGAGAGGCCTGTATTTCCCTGCTGGTGGCTCCAGTTCAGGAA
t aa ag at  t  t   g gt a          ag    ag     a   c t              a   c agg
         a                                t                                     
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *      * ** *   *     *                   *      * **        * **        ***   
CAGTAAACCCTGTTCCGACTACTGtCTCTCcCaTATCGTCAATCTTCTCGAGGATTGGGGACCcTGCGCTGAACATGGAG
   cg          t   c    ca    a tc  ta             a  c        t  tatc   t     a
                                                                    aa          
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *        *        * *          * *****    *   * *   * *     * *         
AACATCACATCAGGATTCCTAGGACCCCTgCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACC
 g             c             t                      c           a               
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       **   **  * *  **** *  *** *  *   * **                **    *   * **  *  *
GCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGaACtACCGTGTGTCTTGGCCAAAATTCGCAGTCCC
aa                              g           ag ac          g                    
                                                g                               
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *   * **   * * *   ** ***     *    **  * **       *     ** *       ***  
CAACCTCCAATCACTCACCAACCTCCTGTCCTCCAACTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATC
                         t        g           a     t       a                  a
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * ** *  *  **     *  *  * *   *  * *  *     ***        *  *      ***    **   
TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTtTGTCCTCT
                 t          c               a        c gg              c      a 
                                                        c              g        
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *              * *           **             *        ** *  *        *      
AATTCCA------GGATCtTCAACc---------ACCAGCacGGGACCATGCaGAACCTGCACGACTcCTGcTCAAGGAA
gc                c  g  t               gt    a c   cag  t     taat  t  g   c 
                  g     a                     t       c  a                      
                  a                                                             

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *           *  *  ** **    ***           *** * *** ******* * **** ** ** **    
CCTCTATGTATCCCTCCTGTTGCTGTACCAAACCTTCGGACGGAAATTGCACCTGTATTCCCATCCCATCATCcTGGGCT
         t      a  c  t     a     c t   ta    c                          t      
                t                                                        a      
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** * **  *  * * **   ***     ** ** **     *     *  *  *     *  *  ** **  *   *  
TTCGGAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGT
    c              c                     a                    c                c
                                         t                                      
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      ** *  *  **  ***   *    **    ** *   * **   ***  * *              *      *
AGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAgCATCTTGAGTC
              t   c       t      g t           g           aa   cgtca  c     ag 
                                   c                             t  c           
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *         * *    *  **  *        * *            *          *              ****
CCTTTTTACCGCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAAACCCTAACAAAACaAAaA------GATGGG
     a                      a c   c    cg     c g  ta ccct  g  t  gc       g    
                            c     g                    g       g                
                                                               c                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*        *  * *   ****       ** *        **  *     * **    ** **           *    
GTTACTCTtTAcATTTcATGGGcTATGTCATTGGAtGTTATGGgTCaTTGCCACAAGAtCACATCAtACAgAAAATCAAA
 g  t  cc ga c  t     t   agt     ca  cgg   c  a  g  g  a  t  tggg ta  gc t c 
 c                  g           tg                    g       a   c     g g 
                      a                                               t         

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   **        *    **     *  * **  * **     *  * *      *    *           *     * 
GAaTGTTTTAGAAAACTTCCTgTTAACAGgCCTATTGATTGGAAAGTcTGTCAACGtATTGTGGGTCTTTTGGGTTTTGC
  c  c  cc g     c   a c  tc a               a     ga a     a  c  cc a  g     
  t                                          g        c                 c     
  g                                            t                          a     

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ** **    **  * *  ** **  *       **  * **          **             *      *  
TGCCCCTTTtACACAATGTGGTTATCCTGCtTTaAtGCCcTTGTATGCaTGTATTCAaTCtAAGCAGGCTTTCACTTTCT
c  t  g  c  g      g        gc g a    a     c  c c   gg gcga        t  c  
   a        t                 c                        c  c                   
                                                            a                   

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *   *    **          ** *       *  **  **        * **        *  *  * *  
CGCCAACTTACAAGGCCTTTCTGTGTAAACAATACCTGAACCTTTACCCCGTTGCcCGGCAACGGCCAGGTCTGTGCCAA
     c g  t   a     t aca c       ta  cc               ta        t t          
       c                                               a           c            
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   * *  **  * ** ***   *  * *            ** *      *  * *  *     *        *    
GTGTTTGCTGACGCAACCCCCACTGGCTGGGGCTTGGTCATGGGCCATCAGCGCATGCGTGGAACCTTTctGGCTCCTCT
                        t          ct  a                           tc       t 
                                                                     aa         
                                                                     gg         

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  ** ***   *  **        * ** ** **     * **  **  *** **          *  *  **  *  
GCCGATCCATACTGCGGAACTCCTAGCCGCTTGtTTTGCTCGCAGCAGGTCTGGAGCAAACATTcTCGGGACgGATAACT
a           c              a     c            c       g  g   g ca t     t     
                                                             c          a       
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *   *  * ** **    *  **    *  ****** *  * **  *    **  *  ***   * ** *     ** 
CTGTTGTtCTCTCCCGCAAATATACATCgTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCC
 g  a   t     t  g   g  a ac                a                a            
 c        a                 c                                                   
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  * * *****          ******  * ***   ** *     **     * **        *  *     *   
TTTGTTTACGTCCCGTCGGCGCTGAATCCcGCGGACGACCCtTCTCGGGGcCGCTTGGGaCTCTcTCGTCCCCTTCTCCG
     c        c  a                     g        t  tc    gactga      t  ca at 
                                         c           g     tg   t               
                                                                g               

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *  *         **** *  *  ****  *** *   *** * **  ** **        * ** * **  *
TCTGCCGTTtCGaCCGACCACGGGGCGCACCTCTCTTTACGCGGACTCCCCGTCTGTGCCTTCTCATCTGCCGGACCGTG
c        c at  a                            c                             t     
            g                                                                   
            c                                                                   

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * ***    *  ***    **      **          ***   **  *  **                        
TGCACTTCGCTTCACCT---CTG---CACGTC------GCATGGAGACCACCGTGA---------ACGCCCACCa---a-
          g                            a     a                       t gt g   c 
                                                                          c   g 
                                                                          t     

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
               *     *    *   *  *  *  ** * *  *         *  **      *           
--tT---------CTTGCCCAAGGTCTTAcATAAGAGGACTCTTGGACTCTCTGtAATGTCAACGACCGACCTTGAGGCA
  ag         ac    a   a    gt         a       t  aacg              t      ca 
  gc         g                                      c  c                        
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        ***  *     *     *   * * **    **              *                      * 
TACTTCAAAGACTGTTTGTTTAAaGACTGGGAGGAGTTGGGGGAGGAGatTAGaTTAAaGgT---cTTTGTAcTAGGAGG
               c    c  g  a        t c          ccg  g   ct a    g a    t g     
                                                ta          t    t              
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** * *                                          *    *       *                 
CTGTAGGCATA--------------------------------------AATTGGTCTGCGCA-CCAGCACCATGCAACT
                                                        g  t       att  c t     
                                                                                
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **       *     *       *       *             * *      **** ***    ** *      **
TTTTCACCTCTGCCTAATCATCTCtTGTTCATGTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTgGGgCA
               g       ta           c   t                                 a  a  
                                                                                
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **     *    ***         ** *            *  * *  **    *        *     *        
TGGACATtGAcCCTTATAAAGAATTTGGAGCTaCTGTGGAGTTACTCTCGTTTTTGCCTtCTGACTTCTTTCCTTCaGTA
     c c  tt g                  t c   c          a         gac  t  t a   g  ca c
             a                                   t         atg              g  t
                                                           c                t   

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                            *              *  *        * *      *    *  *       
CGAGATCTTCTaGATACCGCCTCAGCTCTgTaTCGGGAaGCCTTAGAGTCTCCTGAGCATTGttCACCTCAcCATACTGC
  t  c  g  t  c  t  ta    gt a t   a  t  a     a   t    a   gtca tga   t     g  
  g     a            g       c        c  t                                   c  
                                      g                                         

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * *              **   *                *     * * **  **    **  *              
ACTCAGGCAAGCAATtCTtTGCTGGGGGGAacTAATGAcTCTAGCtACCTGGGTGGGTGgTAATTTGGAAGATCcAgcAT
ta          tg c  g  t     a  ct t  atact gt c           aata     ac c  c a atg 
            ct a  a           g  g  t                    c cg        t      cg  
                              t                             c                   

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *                  *             *   *     *               **  **     *    
CcAGgGACCTAGTAGTcAGTTATGTcAACACTAATATGGGCCTAAAGTTCAGgCAACTaTTGTGGTTTCACATTTCTTGT
 t  a  t a a t  tgcc     t  ttaacccg a c t g  a  tc a   t c  a         gc      c
       a     g    a            c           t            a t            c        
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      ** **                          *    **  * *****  *   * * **             **
CTCACTTTTGGAAGAGAAACgGTcaTAGAGTATTTGGTGTCTTTCGGAGTGTGGATTCGCACTCCTCcAGCTTATAGACC
  t tg     g a cctgta  tt g  a                                 a agcga        
  a  c           c  c  ac t                                        t   c        
                    t   g                                                       

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     **** *  *** *  *     ***  *       * *   ** *              * **        *  * 
ACCaAATGCCCCTATCtTATCAACACTTCCGGAGACTACTGTTgTTAGACGACGAG------GCAGGTCCCCTAGAAGAA
 aat            c       g        a t tg    a     ga a  c           a          
 g                                   g                 t           c            
 t                                                                              

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ** **  * *  *       *      **   *     *   *  *      * *  *             *    
GAACTCCCTCGCCTCGCAGACGAAGgTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGG---AAtCTCAATGTTAG
          a              a   a              c     a  a          gcc ca c     a
                                                                                
                                                                                

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       **  * *     *   *     *    **  * **  *                   *   *     **    
TATTCCTTGGACTCATAAGGTGGGaAAcTTTACgGGGCTTTATTCTTCTACTGTaCCTGTCTTTAAcCCTCATTGGAAAA
   c  c     g  c  a     g gt     t       c  ct  act   a       t  aa c       
                        t        a                    g                         
                                                                                

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
            * *     ** *   *              *       **              *    **  *    
---CACCcTCTTTTCCTAATATACATTTACACCAAGACATtATCAAAAAATGTGAACAaTTTGTAGGcCCACTCACAGTc
       aa       c  c  t  cc g  t   a t  c  tg c g         g  c     t  g   ta t
       t           g                                                  t        a
                                                                                

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *      *     *            **   * *     *  *        ** **  * ** **           *
AATGAgAAAaGAAGAcTGCAATTgATTATGCCTGCTAGGTTTTATCCAAAtGTTACCAAATATTTgCCATTgGATAAGGG
     a   c g  gt aa    a  c     a  c  a  c  c  t  gtcc  t        a  c  a  c     
                                                  aag   a           t           
                                                  c                             

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **     *    ** **     *    **          *              *      *     * **  *    *
TATTAAACCTTATTATCCAGAACATcTAGTTAATCATTACTTCCAAACcAGACAtTATTTACACACTCTATGGAAGGCGG
c  c     c  c  c  g     ct g              t   g t     c        t  a  t   c    a 
         g               g                      a                    g          
                         a                                                      

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*     * *               *    *   *    *  *   *       *     *** *  *      **  ***
GTaTATTATATAAGAGAGAAACAACACaTAGCGCCTCATTTTGTGGGTCACCATATTCTTGGGAACAAgAgCTACAGCAT
  g t     cc        t t    g      t     c     a   t     a           a ta   gt   
    c                                                                           
                                                                                

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*                                                                              *
GG--------------------------GGC---------------------------------A-------GAATCTTT
                                                                              g 
                                                                                
                                                                                

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                     * * **    *****  * **  *  * *    **  ** *  
------------------------------CCACCAGCAATCCTCTGGGATTCTTTCCCGACCACCAGTTGGATCCAGCC
                                                            t        c      
                                                                                
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *  * *             *  *  *****   * *  *    *   *    * *      *     **    **   
TTCAGAGCAAACACcGCAAATCCAGATTGGGACTTCAATCCCAACAAGGACACCTGGCCAGACGCCAACAAGGTAGGAGC
    a      tt aaac  c           t              a   c t      a t              g  
              ttg                                    a                          
                                                                                

      3210      3220      3230      3240      3250      3260      3270      3280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **  *          **   *          * **                   *            *           
TGGAGCATTCGGGCTGGGaTTCACCCCACCgCACGGAGGCCTTTTGGGGTGGAGCCCTCAGGCTCAGGGCATAcTACAAA
g     c     a ca  tc       g  a        t  g  a  a        g  a     a    cga g  c 
      g           g           t                                          t      
                                                                                

      3290      3300      3310      3320      3330      3340      3350      3360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                   *                            
CcTTGCCAgCAAATCCGCCTCCTGCcTCtACCAATCGCCAGTCAGGAAGGCAGCCTACCCCgCTGTCTCCACCTTTGAGA
 tg     aa g    a     g tag c        t  aa ga gc a  a  c  t  t   a       gc  c  
  c      t               t           a        c        g  a  a                  
                                                                                

      3370      3380         
....:....|....:....|....:....
                             
aACACTCATCCTCAGGCCATGCAGTGGAA
g t  g  c     a  a  a        
     a                       
     c                       
© 1998-2022Legal notice