HBVdb

Dataset for nucleotide sequence Genomes of genotype D

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                             *                 *         *  ***  * *  *  **     
cTCCACAACCTTCCACCAAACTCTGCAAGATCCCAGaGTGAGAGGCCTGTATTTCCCTGCTGGTGGCTCCAGTTCAGGAA
t aa ag at  t  t   g g  a          ag    at     a   c t              a   c a g
         a     a                          g                                     
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *      * ** *   *     *                   *      * **    *   * **        ****  
CAGTAAACCCTGTTCCGACTACTGtCTCTCcCaTATCGTCAATCTTCTCGAGGATTGGGGACCcTGCGCTGAACATGGAG
   cg          t   c    ca    a tc  ta             a  c t   ga t  tatc         a
                                                                    aa          
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        * *      * *      * *        * * *****  * *   * *   * *     * *    *    
AACATCACATCAGGATTCCTAGGACCCCTgCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACC
 g             c             t                      c           a               
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       **   **  * *  **** ****** *  *   ****      *         **    *   * **  *  *
GCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGaACtACCGTGTGTCTTGGCCAAAATTCGCAGTCCC
aa                              g            g acc         g                    
                                                g                               
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *  ** ** * *** *   ** ***     *    **  * ***     **     ** *       ***  
CAACCTCCAATCACTCACCAACCTCCTGTCCTCCAACTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATC
                         t        g           a     t       a                  a
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * ** *  *  ***    *  *  * **  *  ***  *   *****    *  **  *      ***    **   
TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTtTGTCCTCT
                 t          c           g            c gg              c      a 
                                                        c              g        
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *              * **          **      *      * *    * ** *  *        *      
AATTCCA------GGATCtTCAACc---------ACCAGCacGGGACCATGCaGAACCTGCAcGACTcCTGcTCAAGGAA
gc                c  g  t               gt    t c   cag  t     tcat  t  g   c 
                  a     a                             c  a                      
                  g                                                             

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *           *  *  ** **    ***     *     *** * *** ******* * **** ** ** ***   
CCTCTATGTATCCCTCCTGTTGCTGTACCAAACCTTCGGACGGAAATTGCACCTGTATTCCCATCCCATCATCcTGGGCT
        at      a  c  t     a     c t   ta    c                          t      
                t                                                        a      
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** * **  *  * * **   **** *  ** ** ** **  * *   *  *  ** *  ** *  ** **  *** *  
TTCGGAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCcTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGT
                   c                     a                                     c
                                         t                                      
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      **** **  **  ***   *    **    ** *   * **   *** ** *              *      *
AGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAGCATCTTGAGTC
              t   c       t      g c                       aa    ttca  c     ag 
                                   t                             g  c           
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *         * *    *  *****        * **  * **  * **       ** **       *****  * *
CCTTTTTACCGCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAAACCCTAACAAAACaAAaAGATGGGGTTACT
     a                      c c   c    cg     c g  t   cct  g  t  gc g      t 
                                                               g              
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *  * *   ****       ** *        **  *     * **    ** **           *       ** 
CTtTAcATTTcATGGGcTATGTCATTGGAtGTTATGGgTCaTTGCCACAAGAtCACATCAtACAgAAAATCAAAGAaTGT
 cc ga c  t     t   agt     ta  cgg   c  a  g  g  a  t  tgg  ta  gc g c   c  c
              g           cg                    g       a   c           t   
                a                                           c   t           g   

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *    **     *  * **  * **  *  *  * *   *  *  * *   *     * *     *  ** **
TTTAGAAAACTTCCTgTTAACAGgCCTATTGATTGGAAAGTcTGTCAACGtATTGTGGGTCTTTTGGGTTTTGCTGCCCC
  cc g     c   a c  tc a               a     ga     a  c  cc a  g     c  t  
                                       g                        c        a  
                                         t                                      

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **    **  * *  ** **  *  *    **  * **  *  *    **             *      *        
TTTtACACAATGTGGTTATCCTGCtTTaAtGCCcTTgTATGCaTGTATTCAaTCtAAGCAGGCTTTCACTTTCTCGCCAA
g  c  g      g         g a   tc a      c c   gg gcga        t  c  t      c
a     t                                        c  c                         
                                                      a                         

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *   *    **          ** *       *  **  ***       * **        *  * ** ** *   * 
CTTACAAGGCCTTTCTGTGTAAACAATACCTGAACCTTTACCCCGTTGCCCGGCAACGGCCAGGTCTGTGCCAAGTGTTT
tg  t   a     t aca c       ta  cc               ta        t t     a            
 c                           t                   a           c                  
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  **  * ** ***   *  * **   *       ** *    * *  ***  *     *        *     *  **
GCTGACGCAACCCCCACTGGCTGGGGCTTGGTCATGGGCCATCAGCGCATGCGTGGAACCTTTctGGCTCCTCTGCCGAT
                  t          ct  a                           tc       t a     
                                                               aa               
                                                               gg               

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ***   *  ** *     ** ** ** ** **  ***** **  *** **     *    ** *  **  * ** **  
CCATACTGCGGAACTCCTAGCCGCTTGtTTTGCTCGCAGCAGGTCTGGAGCAAACATTcTCGGGACgGATAACTCTGTTG
      c              a     c            c       g  g   g ca t     t      c  
                                                       c          a        g    
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  * ** ** ** *  **  * *  ********  * **  *  * **  ******   * ** **    *****  * 
TtCTCTCCCGCAAATATACATCgTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTT
  a     t  g    a ac           c    a                a                  
    t                 c                                      t                  
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *****  **    * ******  * ***   ** *     ** *   * **        *  *     *         
TACGTCCCGTCGGCGCTGAATCCcGCGGACGACCCtTCTCGGGGcCGCTTGGGaCTCTcTCGTCCCCTTCTCCGTCTGCC
        c  a                     g        t  tc    gactga      t  ca at c     
                                   c           g     t    g                     
                                                          t                     

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  *      *  **** *  *  ****  *** *   *** * **  ** **        * **** ** ** *****
GTTtCGaCCGACCACGGGGCGCACCTCTCTTTACGCGGACTCCCCGTCTGTGCCTTCTCATCTGCCGGACCGTGTGCACT
   c at  a                            c                             t           
      g                                                                         
      c                                                                         

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *  *  *** **      **          ***   **  *  **                                 
TCGCTTCACCTCTG---CACGTC------GCATGGAGACCACCGTGA---------ACGCCCACCa---a---tT-----
    g                               a                       t gt g   c   ag     
                                                                 t   g   g      
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *    **    *   *  ** *  ** * *  **        *  **     **           *  *    *
----CTTGCCCAAGGTCTTACATAAGAGGACTCTTGGACTCTCTGtAATGTCAACGACCGACCTTGAGGCATACTTCAAA
    ac        a    gt     c   a       t  aacg              t      ca          
    g                                      c  c                                 
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  ** *  *     *  ** * **    **    *         *                 * * *** * * ****
GACTGTTTGTTTAAaGACTGGGAGGAGTTGGGGGAGGAGatTAGaTTAAaGgTcTTTGTAcTAGGAGGCTGTAGGCATAA
      c    c  g           t c          ccg  gc  ct a g a    t g                 
                                       ta          t t                          
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    ** *    *                * **       *     **      **  ******* * *     * * * 
ATTGGTCTGCGCACCAGCACCATGCAACTTTTTCACCTCTGCCTAATCATCTCtTGTTCATGTCCTACTGTTCAAGCCTC
      g  tt      tt                                 ta           c   t          
                                                                                
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     ********    ** **  ** **  **     *    ***         ** *            * ** *  *
CAAGCTGTGCCTTGGGTGGCTTTgGGgCATGGACATtGAcCCTTATAAAGAATTTGGAGCTaCTGTGGAGTTACTCTCGT
                       a  a         c  tt g                  t c   c          t 
                                          a                                   a 
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*    *        *     *                  *        *        * *   *        *  *    
TTTTGCCTtCTGACTTCTTTCCTTCaGTACGAGATCTTCTaGATACCGCCTCAGCTCTgTATCGGGAaGCCTTAGAGTCT
        gac  t  t a   g  ca c  t  c  g  t  c     ta    gt a t   a  t  a     a   
        a                g  t  g     a            g       c        c  t         
        c                t                                            g         

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    * *      *    *  *   *     * *  *           **   * *              *     * * 
CCTGAGCATTGtTCACCTCAcCATACTGCACTCAGGCAAGCAATtCTtTGCTGGGGGGAacTAATGAcTCTAGCtACCTG
     a     ca tga   t     g  ta          tg c  g  t     a  gt t  atact gt c     
                          c              ct a  a           t  g                 
                          a                                c                    

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  **    **  *  *                *               *  *             *   *     *  
GGTGGGtGgTAATTTGGAAGATCCAgcATCtAGgGACCTAGTAGTcAGTTATGTcAACACTAATATGGGCCTAAAGTTCA
      aata     ac c  c agatg  c  a  t a   t  tgcc     t  ttaacccg a c t g  a  tc
      c cg        t      c                g  a a                        t       
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
             **  **    **          ** **                       *  *    **  * ***
GGCAACTaTTGTGGTTTCACATTTCTTGTCTcACTTTTGGAAGAGAAACgGTcaTAGAGTATTTGGTGTCTTTCGGAGTG
 a   t c  a         gc      c  t tg     g   c tgta  tt g  a           c       
       t                       a  c           c  c  ac t                        
                                                 t   g                          

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  *   * * **          *  **    ***** * **** *  *     ***  *       * *   ** *  
TGGATTCGCACTCCTCcAGCTTATAGACCACCaAATGCCCCTATCtTATCAACACTTCCGGAGACTACTGTTgTTAGACG
              a agcga         tat            c       g        a t tg    a     ga
                t             g                                   g             
                              a                                                 

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *        ****  *     *  *  ** ** **  * *  *       *      **   *     *   *  * 
ACGAG------GCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGgTCTCAATCGCCGCGTCGCAGAAGAT
 a  c                              a              a   a                    a
                                                                              
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     * *  *             *           **  * *     * * *     *    **  * **  *      
CTCAATCTCGGG---AATCTCAATGTTAGTATTCCTTGGACTCATAAGGTGGGaAAcTTTACgGGGCTTTATTCTTCTAC
  a            gcc ca c     a   c  c        c  a     g gt     t       c  ct 
                                                     t        a                 
                                                                                

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          ** *   *     **               ** *     ** *   *              *    *  *
TGTaCCTGTCTTTAAcCCTCATTGGAAAA---CACCcTCTTTTCCTAATATACATTTACACCAAGACATtATCAAAAAAT
 act   a       t  aa c           c  aat      c  c  t  c  g  t   a t  c  tg c  
   g                                t                                           
                                                                                

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*        *     *    **  *    *  *  *   *     *            ***  * *   * *  ** *  
GTGAACAaTTTGTAGGcCCACTCACAGTcAATGAgAAAaGAAGAcTGCAATTgATTATGCCTGCTAGGTTTTATCCAAAt
       g  c  g  t  g   ta t     a   c gc gt aa    a  c        c  a  c  c  t  g
       c           t        a                                                  a
                                                                               c

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   ** **  * ** **       *  ** ** *   *  * ** **     *    **  **      *   *      
GTTACCAAATATTTgCCATTgGATAAGGGTATTAAACCTTATTATCCAGAACATCTAGTTAATCATTACTTCCAAACcAG
tcc  t        a  c  a  c     c  c      c  c  g      t g              t   g t  
 g               t                                    g                      a  
                                                      a                         

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    * *    *     * **  *    **    ** *               *    *   *    ** *   *     
ACAtTATTTACACACTCTATGGAAGGCGGGTaTATTATATAAGAGAGAAACAACACaTAGCGCCTCATTTTGTGGGTCAC
   c        t     t   c    a   g t     c         t t    g            c     a   t
                  g              c                                              
                                                                                

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *     *** ** *      **  *****                                                 
CATATTCTTGGGAACAAgAgCTACAGCATGG--------------------------GGC--------------------
     a           a ta   gt                                                      
                                                                                
                                                                                

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                         *  *                                     * * **  * ****
-------------A-------GAATCTTT------------------------------CCACCAGCAATCCTCTGGGAT
                           g                                                    
                                                                                
                                                                                

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  * **  *  * *    **  ** *  * *  * *     *       *  *  *****   * *  *    *   * 
TCTTTCCCGACCACCAGTTGGATCCAGCCTTCAGAGCAAACACcGCAAATCCAGATTGGGACTTCAATCCCAACAAGGAC
         t        c          a      tt aaac  c           t                  
                                           t g                                  
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * *      *     **    ** *  **  *    **    **   *   *      * ** *      *      
ACCTGGCCAGACGCCAACAAGGTAGGAGCTGGAGCATTCGGGCTGGGaTTCACCCCACCgCACGGAGGCCTTTTGGGGTG
c t      a t              g  g     c     a ca  tc       g  a        t  g  a  a  
  a                                        y   g           t                    
                                                                                

      3210      3220      3230      3240      3250      3260      3270      3280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    **       *   *                                              *               
GAGCCCTCAGGCTCAGGGCATAcTACAAACcTTGCCAgCAAATCCGCCTCCTGCcTCtACCAATCGCCAGTCAGGAAGGC
      g  a     a    cga g  c  tg     aa g    a     g tag c        t   a g  gc a 
                               c      t               t                    c    
                                                                                

      3290      3300      3310      3320      3330        
....:....|....:....|....:....|....:....|....:....|....:...
*                *      *                              *  
AGCCTACCCCgCTGTCTCCACCTTTGAGAaACACTCATCCTCAGGCCATGCAGTGGAA
 a  c  t  t   a       gc  c  g t  g  c     a  ag a       c
    g     a                       c                       
                                                          
© 1998-2020Legal notice