HBVdb

Dataset for nucleotide sequence S of genotype C

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
ATGGAGAaCACaACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCAC
       g   cg                           c           t        c        a         
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
AATAC-------CACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCACCCACGTGTCCTGGCCAA
             g                               g           a      aga             
                                                                  t             
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
AA---TTcGCAGTCCCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAAtTTGTCCTGGcTATCGCTGGATGTGTCT
       t                       t  t      c        g c   a     t     t           
                                                              a                 
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
GCGGCGTTTTATCATaTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTAcCAAGGTATGT
               c                            c        g       g       t gg       
                                                                                
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TGCCCGTTTGTCCTCTACTTCCA------G------GA------A---C---AT------CA------ACtACCAGCACG
                 a                          t       t                 c  a ct ta
                                                    c                 a         
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
GGACCATGCAAGACCTGCACGAtTCCTGCTCAAGGAACCTCTATGTTTCCCTCTTGTTGCTGTACAAAACCTTCGGACGG
  g  c    ga        a ca         a c a     c         a  c                     ac
                      g                                                         
                      a                                                         

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                     *                          
AAAcTGCACTTGTATTCCCATCCCATCATCcTGGGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAGTCCGTTTCTCCT
   t     c                 g  t          t  a                                 a 
                                                                              t 
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
GGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATG
  t            c               a    cc                 c          c   g t       
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TGGTATTGGGGGCCAAGTCTGTACAACATCTTGAgTCCCTTTTTACCtCTaTTACCAATTTTCTTTTGTCTTTGGGTATA
             g   a                ag      a    g  g              c a   c        
                                               a                 g              
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CATTTgA-------------------------------------------------------------------------
   c-a-                                                                         
     -                                                                          
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
--------------------------------------------------------------------------------
                                                                                
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
--------------------------------------------------------------------------------
                                                                                
                                                                                
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
--------------------------------------------------------------------------------
                                                                                
                                                                                
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
--------------------------------------------------------------------------------
                                                                                
                                                                                
                                                                                

      1130        
....:....|....:...
                  
------------------
                  
                  
                  
© 1998-2022Legal notice