HBVdb

Dataset for nucleotide sequence PreS1 of genotype C

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                        *   *                        *      *   
ATGGG---AGGTTGGTCTTCCAAACCTCGA------cAAGGCATGGGGACgAAtCTTTCTGTTCCCAATCCTCTGGGATT
 ----   ----cc----- a c      g      a             a  c  c  g  g  a  c           
            --ta c                                      g  c                    
             a                                                                  

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                        **               *      
CTTTCCCGaTCACCAGTTGGACCCtGCgTTCGGAGCCAAcTCAAACAATCCAGATTGGGACTTCAACCCCAACAAGGATC
t  g   agc  t        t  g  a  ta       t                          t           c 
                        a  t                                                    
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
AcTGGCCAG-aGGCAAAtCAGGTAGGAGcGGGAgCATTCGGGCCAGGGTTCACcCCACCACACGGCgg------------
ct     c  ca  ccgc          t    t c  t  a  g        t     c     aaa            
 a               g                                         t                    
                                                           g                    

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                           *                    
TCTTTTGGGGTGGAGCCCTCAGGCTCAGGGCAtATTGACAACAGTGCCAGcAGCaCCTCCTCCTGCCTCCACCAATCGGC
ca             t  g   a    a   gctc ag    g  a  cattatg           ta tg         
                               c g        c           t                         
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                 *                                                              
AGTCAGGAAGACAGCCTACTCCCATCTCTCCACCTCTAAGAGACAGTCATCCTCAGGCCATGCAGTGGAAcTCCAcaACA
    g  g  g g   c        t        g  c       c             gca  a     t    gc  t
                                                                               g
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                          *                   * 
TTCCACCAAGCTCTGCTAGAtCCCAGAGTGAGGGGCCTaTActTTCCTGCTGGTGGCTCcAGTTCCGGAACAGTAAACCC
  t  t  ga    at    c  a a   a aaa t  g  tcac              a    ta  g    c  g   
                                      t                                  g      
                                      c                                         

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *                                              **          *     *   *         
TGTTCCGACTACTGCCTCaCCCATATCGTCAATCTTCTCGAGGACTGGGGACCCTGCACCGAAcATGGAGAaCACaACAT
         c    t  tt    cc  a             a  t            g     t       g   cg   
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       **     *  *    *      * *            *  *         * *             **  *  
CAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACCACAGAGTCTA
                        c           t               a               g g      c
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *     *  *    *               **                       * *  *      *        * 
GACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCACCCACGTGTCCTGGCCAAAATTcGCAGTCCCCAACCTCCAA
                      g           a      aga                 t                  
                                           t                                    
                                           g                                    

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *           *     *     **    *     *                   **     *    * 
TCACTCACCAACCTCTTGTCCTCCAAtTTGTCCTGGcTATCGCTGGATGTGTCTGCGGCGTTTTATCATaTTCCTCTTCA
     t  t      c        g cc        t     t       a                  c          
                                    a                                           
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * *   *  *  *     * *      *       **  *         *       *   * *              
TCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTAcCAAGGTATGTTGCCCGTTTGTCCTCTACTTCCAG--
                  c      a g       g      gtagg                        a        
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                               *                               *
----GAA---CAT------------CAACtACCAGCACGGGACCATGCAAGACCTGCACGAtTCCTGCTCAAGGAACCTC
      t    ta             g  c  a ct  a  g  c    ga        a caa        aac a   
           c              c  a                               g                  
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                    *       *                 *    **    *  ***               * 
TATGTTTCCCTCTTGTTGCTGTACAAAACCTTCGGACGGAAAcTGCACTTGTATTCCCATCCCATCATCcTGGGCTTTCG
  c a       a  c                     ac   t     c                 g  t          
                                                                                
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          ****           *         *                             *              
CAAGATTCCTATGGGAGTGGGCCTCAGTCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGtAGGG
t  a  a                              a                c               a    c    
                                     t                                          
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*              **   **     *        *     *      *               *     *      * 
CTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAACATCTTGAgTCCCTT
              c          c   g t           t        g   a          c     ag     
                                                                                
                                                                                

      1210      1220      1230      1240      
....:....|....:....|....:....|....:....|....:.
    *        *        *           *    *      
TTTACCtCTaTTACCAATTTTCTTTTGTCTTTGGGTATACATTTgA
 a    g  g      c      gc a   c    c      c a 
                        g                     
                                              
© 1998-2020Legal notice