HBVdb

Dataset for nucleotide sequence PreS1 of genotype C

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                            *                               *   
ATGGG---AGGTTGGTCTTCCAAACCTCGA------cAAGGCATGGGGACgAATCTTTCTGTTCCCAATCCTCTGGGATT
  ---   ----cat---- a c      g      a             a  c  g  g  g  a     g        
            -c-  c                                      c  c                    
             -                                                                  
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                        *                *      
CTTTCCCGaTCACCAGTTGGACCCtGCgTTCGGAGCCAAcTCAAACAATCCAGATTGGGACTTCAACCCCAACAAGGATC
   g   agc  t        t  g  a  ta    a  t  c        c        tc    t           c 
                        a  t                                                    
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
AcTGGCCAG-aGGCAAAtCAGGTAGGAGcGGGAgCaTTCGGGCCaGGGTTCACcCCACCACACGGCgg------------
ca     t  ca  ccgc     g    ta   t c     a  g        t     c     aaa            
 t     g      tt g                 t                       t                    
                                                           g                    
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                           *                    
TCTTTTGGGGTGGAGCCCTCAGGCTCAGGGCATATTGACAACAGTgCCAGcAGCaCCTCCTCCTGCCTCCACCAATCGGC
c              t  g   a    a   gctc a     g ca a atta g           aa tg         
                               c g        c        g  t                         
                                                                                
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
AGTCAGGAAGACAGCCTACTCCCATCTCTCCACCTCTAAGAGACAGTCATCCTCAGGCCATGCAGTGGAACTCCAcaACa
       g  g g   c  g     t        g        a cc     g      gca  a     t    gc  t
                                                                           a   c
                                                                               g
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                              * 
TTCCACCAAGCTCTGCTAGAtCCCAGAGTGAGGGGCCTaTActTTCCTGCTGGTGGCTCCAGTTCCGGAACAGTAAACCC
  t  t  ga    at    c  a a  -ac-------c--tcac              a     a  g    c  g   
                             --aa  t  g  --                              g      
                                      t                                         
                                      -                                         

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *                                                          *     *   *         
TGTTCCGACTACTGCCTCaCCCATATCGTCAATCTTCTCGAGGACTGGGGACCCTGCACCGAAcATGGAGAgCACaACAT
         c t  t   t    cc  a          t  a  t            g     t       a   cg   
                                                               a                
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       **     *  *    *      * *            *  *         * *             **  *  
CAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACCACAGAGTCTA
                        c           t               a               g g       
                                                                                
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *     *       *               **                            *      *        * 
GACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCACCCACGTGTCCTGGCCAAAATTcGCAGTCCCCAACCTCCAA
                      g           a      aga                 t                  
                                           g                                    
                                           t                                    
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *           *     *     **    *     *                   **     *    * 
TCACTCACCAACCTCTTGTCCTCCAAtTTGTCCTGGcTATCGCTGGATGTGTCTGCGGCGTTTTATCATaTTCCTCTTCA
     t  t      c        g cc        t     t                   c      c          
                                    a                                           
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * *   *  *  *     * *              **  *         *       *   * *              
TCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTACCAAGGTATGTTGCCCGTTTGTCCTCTACTTCCAG--
                  c      a g       g       t gg                        a        
                                                                                
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                           *                    
----GAA---CAT------------CA------------ACtACCAGCACGGGaCCATGCAAGACCTGCACGAtTCCTGC
      t    ta             g              c  a ct  a  g  c    ga        a caa    
           c                             a                               g      
                                                                                
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
           *                    *       *                 *    **    *   **     
TCAAGGAACCTCTATGTTTCCCTCTTGTTGCTGTACAAAACCTTCGGACGGAAAcTGCACTTGTATTCCCATCCCATCAT
    a c a     c a       a  c                     a    t     c                 g 
                                                                                
                                                                                
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *           ****                                                   *  
CcTGGGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAGTCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAG
 t t        t  a                                 a                c             
 a                                               t                              
                                                                                
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
            *                    *     *        *     *                      *  
TGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAACAT
  a    cc                 c          c  cg t           t        g   a           
                                                                                
                                                                                
                                                                                

      1210      1220      1230      1240      1250        
....:....|....:....|....:....|....:....|....:....|....:...
   *      *              *        *           *    *      
CTTGAgTCCCTTTTTACCtCTaTTACCAATTTTCTTTTGTCTTTGGGTATACATTTaA
     ag      a    g  g             gc a   c           c g 
                                                          
                                                          
                                                          
© 1998-2022Legal notice