HBVdb

Dataset for nucleotide sequence Genomes of genotype C

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                      *         
--CTCCAcaACATTCCACCAAGCTCTGCTAGAtCCCAGAGTgAGGGGCCTaTActTTCCTGCTGGTGGCTCcAGTTCCGG
  t    gc  t  t  t  ga    at----c----a---a-----------tc-c              a    ta  
       a   c              --    -  a -   -caaa t  c  --a-                       
                                                  g                             
                                                  t                             

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *  *                                         *    **                * 
AACAGTAAACCCTGTTCCGACTACTGCCTCaCCCATATCGTCAATCTTCTCGAGGACTGGGGACCCTGCACCGAAcATGG
g    c  g            c    t   t    cc  a          t  a  t            g     t    
     g                                                                     a    
                                                                           g    
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *                **     * **    *        *         *  *       *    * *        
AGAgCACaACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATA
   a   cg                           c           t        c        a             
                                                                                
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     **  *    *     *  *  * *   *           **                *      * *  *     
CCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCACCCACGTGTCCTGGCCAAAATTcGCAGTC
  g g   g  c                      g           a      aga                 t      
                                                       g                        
                                                       t                        
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *        *           *           *     *     **    *    **       *  *  *     **
CCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAAtTTGTCCTGGcTATCGCTGGATGTGTCTGCGGCGTTTTATCA
                 t  t      c        g cc        t     t                   c     
                                                a                               
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *    *   * *       * *     * *         *    **  *      *  *       *     *  
TaTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTACCAAGGTATGTTGCCCGTTTGTCCT
 c                            c      a g       g      gtagg              a      
                                                                                
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                 *                                                     *        
CTACTTCCAG------GAA---CAT------------CA------------ACtACCAGCACGGGACCATGCAAGACCTG
   a              t    ta             g              c  a ct  a  g  c    ga     
                       c                             a                          
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                      **             *      *       *                 *     * * 
CACGAtTCCTGCTCAAGGAACCTCTATGTTTCCCTCTTGTTGCTGTACAAAACCTTCGGACGGAAAcTGCACTTGTATTC
   a caa        aac a     c a       a  c                     a    t     c       
     g                                                                          
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  ***     *       *    *        ****        *  *  *     **                    
CCATCCCATCATCcTGGGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAGTCCGTTTCTCCTGGCTCAGTTTACTAGTG
          g  t t        t  a                                 a                c 
             a                                               t                  
                                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *              *       *      **   *      *        *     *             
CCATTTGTTCAGTGGTTCGtAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAG
                   c                  c          c   g t      a    tc       g   
                                                                                
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *     *   *  *     *        *        *           *    *     *        * 
TCTGTACAACATCTTGAgTCCCTTTTTACCtCTaTTACCAATTTTCTTTTGTCTTTGGGTATACATTTgAACCCTAATAA
a                ag      a    g  g             gc a   c           c a  t  cccc  
                                                g                               
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *   *  ****  *    *           ** *        *       * *       *        ** *   
AACCAAaCGtTGGGGCTACTCCCTTAAcTTCATGGGATATGTAATTGGAaGTTGGGGTACtTTaCCaCAgGAACATATTG
   t  ga      t  t  cc t  t     c     c     gt c     a  c  g  g  a  g  c  aa
   a                a           g     g     c        c  a           c       
                                                t                       t       
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     **                          *          **                 *          *   * 
TACtaAAAaTcAAgCAATGTTTTCGaAAAcTgCCTgTAAATAGaCCTATTGATTGGAAAGTATGTCAaaGAATTGTGGGT
 gtag  gc g  aa c     ca g   t t  cact   c g              g  g  c  gc g     a  g
    c   t t     g        t     a     c                       c                  
    t     a              c                                                      
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
               *      *       **  *    *           **  *             *          
CTTtTGGGCTTTGCtGCcCCtTTTACACAATGTGGcTAtCCtGCcTTaATGCCTTTaTATGCATGTATACAAtCTAAGCA
  gc a  t  c  c  t  c  c  g        t  c  a  ac gc c   g  ct g     t  cg g  a  
                    g     t        g     c  t     a                    t  c     
                                   a     g                             g  a     
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **           *       *                    *  *           *  *                  
GGCTTTcACTTTCTCGCCAACTTACAAGGCCTTTCTGTGTAAACAATATCTGAACCTTTACCCCGTTGCcCGGCAACGGt
a     t     t   t    a  t  aa t   t t   c       ca  cc      t        ta        c
                              a     a            t                   g         g
                                                                     a          
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *     *     *         *     *   *       **               *                  * 
CAGGTCTcTGCCAAGTGTTTGCTGACGCAACCCCCACTGGaTGGGGCTTGGCcATaGGCCATCagCGCATGCGTGGAACC
 c  c  t                 t              t           tc t c   cagc   c           
 t  g  a                                c           ag g                        
       g                                               c                        
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                              *           *   *  *      *         **            
TTTGTGGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCAGCTTGTTTTGCTCGCAGCcGGTCTGGAGCgAAaCTtAT
   a          a     t    tc           t  g  c     c         a       g  a cca cc 
                                      g  c  g                                g  
                                                                                
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *                           *     *  *    **                                
CGGaACcGACAACTCTGTTGTCCTCTCTCGGAAATACACCTCCTTtCCATGGCTGCTaGGgTGTGCTGCCAACTGGATCC
t  c  t        c  c  t  t  g  c  g        g  c           c  c                   
a  g  g        g     a     c  a           a                 a                   
   t                                      t                 t                   
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*                      * *            **     *          *                       
TGCGCGGGACGTCCTTTGTCTACGTCCCGTCGGCGCTGAATCCCGCGGACGACCCgTCTCGGGGCCGTTTGGGaCTCTAc
 a  a  a           t           a  a        t        t  a  g  c  t  cc    ga t  t
 t                                         a           c  c              c      
                                                       t                 t      
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *                               *                **  *              *       
CGTCCCCTTCTtCgTCTGCCGTTCCGgCCGACCACGGGGCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTGCCTTCTCA
     t     gtag  a       aa  ac    a     a                a       aa           g
           c c                                                                  
           a t                                                                  
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *         *       **                    *    *  ** **                 
TCTGCCGGaCCGTGTGCACTTCGCTTCACCTCTGCACGTC------GCATGGAgACCACCGTGAACGCCCaCCA------
  c     t                                           ca            a tagaat      
        c                                                            t t        
        g                                                                       
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                   *            
---------GGTCTTGCCCAA------------------------GGTCTTAcATAAGAGGACTCTTGGACTCtCAGCAA
         aaca     t                           c    gt c   c a           tg ga g 
            g                                                            c    c 
                                                                                
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
             *                    *       *                                     
TGTCAACGACCGACCTTGAGGCaTACTTCAAAGACTGTgTgTTTAAaGACTGGGAGGAGTTGGGGGAGGAGAtTAGGTTA
       a              g               t a  c  g             ca         tccc ac-g
                                                                        g    - -
                                                                        a       
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
---AtGaTC---TTTGTACTaGGAGGCTGTAGGCATAAATTGGTCTGTTCACCAGCACCATGCAA---------------
   -a-g t    a    t g                       gc cgt           t tt               
    - -                                                                         
                                                                                
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                             *            *          **         
------------------------------------------CTTTTTCACCTCTGCCTAATCATCTCaTGTTCATGTCC
                                                                    t         t 
                                                                    c           
                                                                                
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *    **                             * ***    *      **          *        
tACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTgGGGCATGGACATTGACCCgTATAAAGAATTTGGAGCTTCTG
c                                     a aa         c   aaa                 a  ca
                                                         c                    a 
                                                         t                      
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *       *     *     *                                                  
TGGAGTTACTCTC---TTTTTTGCCTTCTGACTTCTTTCCTTCtATTCGaGATCTCCTCGACACCGCCTCtGCTCTgTAT
c       a       g         g c  t  t  c  gaacg    t  c  ta t        ta a  ct ac c
                            g           a  g     g                 ag c     c   
                                                                                
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                 *  *              *            
CGGGAGGCCTTAGAGTCTCCGGAACATTGTTCACCTCACCATACAGCACTcAGGCAAGCTATTCTGTGTTGGGGTGAGTT
  a                    g     ca tga      c  c  ta        cg cg a       t   a  
                                 t                             t t              
                                                                 c              
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *     *  ***        **                      *                 *         
GATGAATCTGGCCACCTGGGTGGGAAGTAATTTGGAAGAcCCAGCATCCAGGGAATTAGTAGTcaGCTATGTCAATGTTA
a     ct    a         tg     c  a c  t ag      c a  cgcga t  ag t     t  ca   
            t                             t           t                         
                                                                                
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *                        *    *                                            
ATATGGGCCTAAAAaTCAGACAAcTAtTGTGGTTTCACATTTCCTGTCTTACTTTTGGAAGAGAAACTGTTCTtGAGTAT
 c      a g  gc t  g   a gc       c  t  c  t  c     c       accctgtg  c  a  a  c
              t        t c                                      c  c  g         
                                                                      a         
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *  * *    * *        * *        **           * *  *                  *   
TTGGTGTCTTTTGGAGTGTGGATTCGCACTCCTcCcGCTTACAGACCACCAAATGCCCCTATCTTATCAACACTTCCGGA
c    a   c  g        c  t  a  cattc c  t  g    a             c                
                             c   gaa  a                                         
                                                                                
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *    *         *        *                 *  *          *                    
AACTACTGTTGT------TAG------ACGACGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGT
g   g     a                 ta a  t     a  t                          c       a 
                             c                                                  
                                                                                
                                                                                

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *       *      *  *              *               **  *  *   *  * *  *          
CTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCTCAATGTTAGTATCCCTTGGACTCATAAGGTGGGAAACTT
       a               a  a         gcc ct       a   t  c      c           t  
                                                                                
                                                                                
                                                                                

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        * ** **                       *     *       **     * **       *         
TACTGGGCTTTATTCTTCTACTGTACCTGTCTTTAATCCTGAgTGGCAAACTCCCTCcTTTCCTcACATTCATTTacAgG
   g  a     c     c a  ct   a t  c  ct c  c   a g  c  t  t      a t  a  c  gaga 
      c                 g                 a                     g a             
                                          t                                     
                                                                                

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                          *      *       *      *                    *          
AGGAcATTATtaAtAGATGTCAACAATaTGTgGGCCCTCTTACAGTTAAtGAAAAAAGgAGATTAAAATTaATtATGCCT
 a  t  c  cgcc  g  cg g    tc  a        c ataca  c  g  gc a   c gtcg  gg c     g
                                              c                          a     c
                                                                                
                                                                                

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *      *             *      *             *         *  *                  
GCTAGGTTcTATCCTAAcCTTACCAAATATTTGCCcTTgGAtAAAGGCATTAAACCtTATTATCCTGAACATgcAGTTAA
  c  a  t t   c  aagc  t      cga  tc a  c  g  t  c     a      g  gt catg     
                 tt                a              a     g        c   a          
                 g                                      c                       
                                                                                

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *                     *           *       **                       *        
TCATTACTTCaAAACTAGgCATTATTTACATACTCTGTGGAAGGCtGGcATTcTATATAAGAGAGAAACTACaCGCAGcG
         tc  g c  a  c     g  c  ct t     a  g  tg  t       a        c  t aa  t 
                                 g           a                          c  t    
                                 a                                      g       
                                                                                

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *      *     * **       *          *                                       
CcTCATTTTGTGGGTCACCATATTCTTGGGAACAAGAGCTACAGCATGGGAGGTTGGTCTTCCAAACCTCGAcAAGGCAT
 t     c  c                                 ----------ca------a c      ga       
                                                      --ta cg                   
                                                       c                        
                                                                                

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *          *     *      *                                               
GGGGACgAAtCTTTCTGTTCCCAATCCTCTGGGATTCTTTCCCGaTCACCAGTTGGACCCtGCgTTCGGAGCCAAcTCAA
      a  c  g  g  g  a     g        t  g   agc  t        t  g  a  ta    a  t  c 
            c  c                                            a  t                
                                                                                
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
            **                         *                          *             
ACAATCCAGATTGGGACTTCAACCCCAACAAGGATCAcTGGCCAGaGGCAAAtCAGGTAGGAGcGGGAgCaTTCGGGCCA
       c        tc    t           c ca     t ca  ccgc     g    ta   t c     a  g
                                    gt     g     tt g           t     t         
                                           c                                    
                                                                                

      3210      3220      3230      3240      3250      3260      3270      3280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                           *                                    
GGGTTCACcCCACCACACGGCgg------------TCTTTTGGGGTGGAGCCCTCAGGCTCAGGGCAtATTGACAA----
        t     c     aaa            ca       t     t  g   a    a   gctc a        
              t                                                   c g           
              g                                                                 
                                                                                

      3290      3300      3310      3320      3330      3340      3350      3360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                            *   
--------------------CAGTgCCAGcAGCaCCTCCTCCTGCCTCCACCAATCGGCAGTCAGGAAGACAGCCTACTC
                     g ca   atta g           ta t              g  g  g g   c  g 
                     c        g  t                                              
                                                                                
                                                                                

      3370      3380      3390      3400      3410       
....:....|....:....|....:....|....:....|....:....|....:..
                                                         
CCATCTCTCCACCTCTAAGAGACAGTCATCCTCAGGCCAT--GCAGT--GGAA----
    t                   cc            gc  a  a           
                                                         
                                                         
                                                         
© 1998-2022Legal notice