HBVdb

Dataset for nucleotide sequence Genomes of genotype C

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
           *                                                 ** *   *       *   
cTCCAcaACATTCCACCAAGCTCTGCTAGAtCCCAGAGTGAGGGGCCTaTAcTTTCCTGCTGGTGGCTCcAGTTCCGGAA
t    gc  t  t  t  ga    at    c  a a   a aaa t  g  tc c              a    ta  g 
         g                                      t                               
         c                                      c                               

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *  *  *       *                *             *    **     *    *     * * 
CAGTAAACCCTGTTCCGACTACTGCCTCaCCCATATCGTCAATCTTCTCGAGGACTGGGGACCCTGCACCGAAcATGGAG
   g  g            c    t  tt    cc  a             a  t            g     t      
   c                                                                            
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*       * *      **     * **    *      * **        *  *  *    *    * *          
AaCACaACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACC
 g   cg                           c           t               a               
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   **  *    *     *  *  * *   *  *   *    **            *   *  *   * ** **     *
ACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCACCCACGTGTCCTGGCCAAAATTcGCAGTCCC
g g      c                      g           a      aga                 t        
                                                     t                          
                                                     g                          

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *     *  * ** *   *      **   *     *     **    *    **       *  *  *  *  **  
CAACCTCCAATCACTCACCAACCTCTTGTCCTCCAAtTTGTCCTGGcTATCGCTGGATGTGTCTGCGGCGTTTTATCATa
               t  t      c        g cc        t     t                          c
                                              a                                 
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *    *   * *     * * *     * *      *  *    **  *      *  *       *   * **   
TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTAcCAAGGTATGTTGCCCGTTTGTCCTCT
                                   a g       g      gtagg                       
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
               *                                     *        *  *   *          
ACTTCCAG------GAA---CAT------------CA------------ACTACCAGCACGGGACCATGCAAGACCTGCA
                t    ta             c              c  a ct  a   c    ga       
                     c              g              a                            
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                    **        * *  *      *       *           *     *     * * **
CGAtTCCTGCTCAAGGAACCTCTATGTTTCCCTCTTGTTGCTGTACAAAACCTTCGGACGGAAAcTGCACTTGTATTCCC
 agcaa        aac a     c a       a  c        c           tac   t     c         
   g                                                                            
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ***    **   * * * *  *        ****        *  *  *     **  *                   
ATCCCATCATCcTGGGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAGTCCGTTTCTCCTGGCTCAGTTTACTAGTGCC
        g  t          t  a                                 a                c   
                                                           t                    
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      **              * *     *      ***  **     *    **  *    **    ***        
ATTTGTTCAGTGGTTCGtAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTC
                 c                  c          c   g t           t        g   a 
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *     *   *  *     **    *  *        *      *  ***    *   * *        **  
TGTACAACATCTTGAgTCCCTTTTTACCtCTaTTACCAATTTTCTTTTGTCTTTGGGTATACATTTgAACCCTAATAAAA
         c     ag      a    g  g      c      gc a      c      c a  t  cccc    
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *   *  ****  *    *      *    ** *        *      ** *     * *  *     ** *     
CCAAACGtTGGGGcTACTCCCTTAAcTTCATGGGATATGTAATTGGAaGTTGGGGTACtTTaCCaCAgGAACATATTGTA
 a  ga      t  t  cc t  t     c     g    agt c     a  cc g  g  a  c  c   a g
 t                            t           c        c  a           g         
                                              t                       t         

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   **             *            *          **        *        * *        *   *   
CtaAAAaTcAAgCAATGTTTTCGaAAAcTgCCTgTAAATAGaCCTATTGATTGGAAAGTATGTCAaaGAATTGTGGGTCT
tag  gc g  aa c     ca g   t t   a t   c g  g           g  g  c  gc gc    a  g  
  c   t t     g        t     a     c                       c        c           
  t     a              c                                                        

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *        *   *  *  *    **  *    *           **  *     *       *           *
TtTGGGCTTTGCtGCcCCTTTTACACAATGTGGcTAtCCtGCcTTaATGCCTTTaTATGCATGTATACAAtCTAAGCAGG
gc a  t  c  c  t    g  g     t  c  a  ac g a      g  c  g     t  tg g  a  a 
                      t        a     c  t                          c  c       
                                 g                                   g  a       

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **        *    *  *                    *  *           *  *                  * 
CTTTCACTTTCTCGCCAACTTACAAGGCCTTTCTGTGTAAACAATATcTGaACCTTTACCCCGTTGCcCGGCAACGGTCa
    t     t  at c  a  t  aatt   t a  cc       ca tc                ta        g c
                                  t            t                   g         c t
                                                                   a            

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*     *     *         *     * * *       **               *                  *   
GGTCTcTGCCAAGTGTTTGCTGACGCAACCCCCACTGGaTGGGGCTTGGCcATaGGCCATCggCGCATGCGTGGAACCTT
  c  t                 t              t           tc t     caac   c             
     a                                c           ag g                          
     g                                               c                          

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                            *           **  *  *      *    *    ** *            
TGTGGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCAGCTTGTTTTGCTCGCAGCcGGTCTGGAGCgAAaCTtATCG
 a          a     t     c        t  g  g      c         a       g  a cca cc t 
                                    t  c                                 g  a 
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *      *           *        *     *  *    **   *                *     **    * 
GaACcGACAACTCtGTTGTCCTCTCTCGGAAATACACCTCCTTtCCATGGCTGCTaGGgTGTGCTGCCAACTGGATCCTG
 c  t        c  c  t  t  g  c  g      g  c           c  c                    a
 g  g        g     a     c  a         a                 a                    t
 t                                      t                 t                     

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *                ** *            ** *   *          *   *                *    
CGCGGGACGTCCTTTGTCTACGTCCCGTCGGCGCTGAATCCCGCGGACGACCCgTCTCGGGGCCGTTTGGGaCTCTAcCG
  a  a           t           a  a        t        t  a  g  c  t  cc    ga t  t  
                                         a           c  c              c        
                                                     t                 t        

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **                   *           *      *         **  *   *  *       *         
TCCCCTTCTtCgTCTGCCGTTCCGgCCGACCACGGGGCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTGCCTTCTCATC
   t     gtag  a       aa  ac    a     a                a                    gc 
         cac                                                                    
         a t                                                                    

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *         * *     **                    **   *  ** **                   
TGCCGGaCCGTGTGCACTTCGCTTCACCTCTGCACGTC------GCATGGAgACCACCGTGAACGCCCaCCA--------
c     t                              t            ca            a  tgaat        
      c                                                              t          
      g                                                                         

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                         * *    *          *       *         *  
-------GGTCTTGCCCAAGGTCTTAcATAAGAGGACTCTTGGACTCtCAGCAATGTCAACGACCGACCTTGAGGCaTAC
       aaca     t   c    gt c  ac             tg ga g        a              g   
          g                                    c ct c                           
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *       * *                 *                                           
TTCAAAGACTGTtTgTTTAAaGACTGGGAGGAGTTGGGGGAGGAGAtTAGGTTAAaGaTC---TTTGTACTaGGAGGCTG
            g a  c  ga           cca         tccc ac-g-t-g t    a    t g        
                                              g    - - - -                      
                                              a                                 

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TAGGCATAAATTGGTCTGTTCACCAGCACCATGCAA--------------------------------------------
               gc cgt           t tt                                            
                                                                                
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                *            *  **      **                *   ***            *  
-------------CTTTTTCACCTCTGCCTAATCATCTCaTGTTCATGTCCtACTGTTCAAGCCTCCAAGCTGTGCCTTG
                                       t         t c                            
                                       c                                        
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
              *****    * *    **          *                 *       **    *     
GGTGGCTTTgGGGCATGGACATTGACCCgTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTC---TTTTTTGCCTTCT
         a aa         c   aaa                 a  c c               g         g c
                            c                    a                             g
                            t                                                   

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*                                                                               
GACTTCTTTCCtTCtATTCGaGATCTCCTCGACACCGCCTCtGCTCTgTATCGGGAGGCCTTAGAGTCTCCGGAACATTG
  t  t  c  gaacg    t  c  ta t        aa a  ct ac ca a      c          a  g     
           a  g     g                 tg c     c                                
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *         *  *           *  *    *               *     * ****        *
TTCACCTCACCATACAGCACTcAGGCAAGCTATTCTGTGTTGGGGTGAGTTGATGAATCTGGCCACCTGGGTGGGAAGTA
ca tg          c  t         cg cg       t      a     ct    a  t         g   
                  c               t                          t                
                                                                              

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*                      *                 *           *  *                       
ATTTGGAAGAcCCAGCATCCAGGGAATTAGTAGTcaGCTATGTCAATGTTAATATGGGCCTAAAAaTCAGACAAcTAtTG
  c    c  t ag      c a   gcga t  ag t     t  ca    c      a g  gc t  g   a cc  
             t                                                   t        t g   
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **   *                                                   *  * *    * *  *     *
TGGTTTCACATTTCCTGTCTTACTTTTGGAAGAGAAACTGTTCTtGAGTATTTGGTGTCTTTTGGAGTGTGGATTCGCAC
     c  t  c  t  c  c  c  c    a  ct  g  c  a  a   c    a   c  g        c     
                                   c  c  a                                      
                                         g                                      

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *        **           * *  *  *     **        *      *    *   **       *       
TCCTcCcGCTTACAGACCACCAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAG------ACG-----
a  cattc a  t  g    a             c                g         a           ta     
c   gaa                                                                         
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
            *   *  *          *            *        *       *      *  *         
-ACGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCTCAATCGCCGCGTCGCAGAAGATCTCAA
  a  t     a                             c       a        a               a  a  
                                                                                
                                                                                

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *               **  *  *   *  * *  * **  *        **  * ** **              
TCTCGGGAATCTCAATGTTAGTATCCCTTGGACTCATAAGGTGGGAAACTTTACTGGGCTTTATTCTTCTACTGTACCTG
       g c c            t  c      c           t     g      c     c  gacg   a
                                                                              
                                                                              

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *     *       **     * **       *                                   *  
TCTTTAATCCTGAgTGGCAAACTCCCTCcTTTCCTcACATTCATTTacAgGAGGAcATTATtaAtAGATGTCAACAATaT
 t     ct c  c   a g  c  t  t      a t  a  c  gaga  a  t  c  cgcc  g  cg g    tc
             a              a      g a                                          
             t                                                                  

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *       *      * *                  *                *      *             **
GTgGGCCCTCTTACAGTTAAtGAAAAAAGGAGATTAAAATTaATTATGCCTGCTAGGTTcTATCCTAACCTTACCAAATA
  a  t  c  c  ga c  c  g   c a   c g gg  g  c     g  c  a  t t   c  tagc  t     
              t  a                          a     c                 at          
                                                                                

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *          *  *         *  *        *             **                    *  
TTTGCCcTTgGAcAAAGGCATTAAACCtTATTATCCTGAACATgcAGTTAATCATTACTTCaAAACTAGgCATTATTTAC
 cga  tc a  t  g  t  c     a      g  gt catg              tc  g c  a  c     
      a              a     g        c   a                         g             
                           c                                                    

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *       **        *              *          ** **     *     * **      *
ATACTCTGTGGAAGGCtGGcATTcTATATAAGAGAGAAACTACaCGCAGcGCCTCATTTTGTGGGTCACCATATTCTTGG
 c  ct t     a  g  tg  t       a        c  t at  t  t     c  c                  
    g              g                       c  a                                 
                                           g                                    

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*          *                                        *      *     *    **    *   
GAACAAGAGCTACAGCATGGGAGGTTGGTCTTCCAAACCTCGAcAAGGCATGGGGACgAAtCTTTCTGTTCCCAATCCTC
               ----------c-------  c      ga             a  c  c  g  g  a       
                         -c a c                                g  c             
                          a                                                     

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ****    *       *   *    *                        *           **      *   *    
TGGGATTCTTTCCCGaTCACCAGTTGGACCCtGCgTTCGGAGCCAAcTCAAACAATCCAGATTGGGACTTCAACCCCAAC
       t  g   agc  t        t  g  a  ta       t           c              t      
                               a  t                                             
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *                         **                            *             
AAGGATCAcTGGCCAGaGGCAAAtCAGGTAGGAGcGGGAgCATTCGGGCCAGGGTTCACcCCACCACACGGCgg------
     c ct     c ca  ccgc          t    t c  t  a  g        t     c     aaa      
        a              g                                         t              
                                                                                

      3210      3220      3230      3240      3250      3260      3270      3280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
              *       *  *     *                                                
------TCTTTTGGGGTGGAGCCCTCAGGCTCAGGGCAtATTGACAA------------------------CAGTGCCAG
      ca             t  g   a    a   gctc a                             g  a   a
                                     c g                                c       
                                                                                

      3290      3300      3310      3320      3330      3340      3350      3360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                               *      *       **             *  
cAGCaCCTCCTCCTGCCTCCACCAATCGGCAGTCAGGAAGACAGCCTACTCCCATCTCTCCACCTCTAAGAGACAGTCAT
tt  g           ta t              g  gc g g   c        ta          c       c    
    t                                                                           
    c                                                                           

      3370      3380        
....:....|....:....|....:...
                    *       
CCTCAGGCCAT--GCAGT--GGAA----
         gc  a  a           
                            
                            
© 1998-2020Legal notice