HBVdb

Dataset for nucleotide sequence PreS2 of genotype B

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                             ** 
ATGCAGTGGA------ACTCCACCACtTTCCAcCAAACTCTTCAA---GATCCCAGAGTCAGGGCcCTGTACtTTCCTGC
g aagt           t  tc a ag  t  t   g    g tg     c  aca         t  a  tc c     
                          c                                             y       
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***         **           *        *           *        *        *        *  *** 
TGGTGGCTCCAGTTCAGGAACAGTgAgCCCTGCTCAGAAtACTGtCTCTgCCATATCGTCAAtCTTaTCGAAGACTGGGG
                 ag t   a a     t     cct   ca  at   c   a    c  cc    c        
                                                gc               yg    m        
                                                 a                              

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *   *     *    *      *     *    *         * *            *  * *     *   *     
ACCCTGTACCGAACATGGAGAACATCGCATCAGGACTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTtGTTG
      cg     t            t         a   c             ga                c  c    
                          a                           c                    y    
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *             *        *      *  *      *       ** **                  *   
ACAAAAATCCTCACAATACCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAaTTTTCTAGGGGgAACACCCGTGTGTCT
                    g                               g     c     ag       a     c
                                                    r           rc             g
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   *    *   * ** *   * ** *   * *  *  *         ** *     ** **      *          
TGGCCAAAATTCGCAGTCCCAAATCTCCAGTCACTCACCAACcTGTTGTCCTCCaATTTGTCCTGGTTATCGCTGGATGT
                             a        t   t           g c         c     t       
                                                        y                       
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    ** *      * * *   **  * *  *   *           *          *  *     *            
gTCTGCGGCGTTTTATCATCTTCCTCTGCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGT
a                  a     t                         c                        c   
r                  m                                                            
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*       *      **                      *              **        ***        *    
ATGTTGCCCGTTTGTCCTCTAATTCCAGGATCATCAACaACCAGCACCGGACCATGCAaAACCTGCACaACTCCTGCTCA
                    cc          c  g  c        g   t      gg  a     gg ga      g
                    g           g     g                             r           
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      **            *  *     *     **  *              * *   ** ** * ** *     * *
AGGAACCTCTATGTTTCCCTCATGTTGCTGTACAAAACCTACGGACGGAAACTGCACCTGTATTCCCATCCCATCATCTT
c  c      tc                    tc           t     t                          c 
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    **    *      *   **     **         * ***        *  **  * *   *       **     
GGGCTTTCGCAAAATaCCTATGGGAGTGGGCCTCAGTCCGTTTCTCTTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGG
         t     t                              a                  g            
               w                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **   * *           *   *         *     **     * *   * **  *              *    
TTCGTAGGGCTTTCCCCCACTGTCTGGCTTTCAGTTATATGGATGATGTGGTtTTGGGGGCCAAGTCTGTACAACATCTT
    c              t   t             cg t      a t  ac     a g  aa    g     c   
                                                                r           y   
                                                                                

       810       820       830       840       850     
....:....|....:....|....:....|....:....|....:....|....:
 *                         *                    *      
GAGTCCCTTTATgCCGCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAA
  a   a     a           c        c a   c    c      c g 
            r                    g                     
                                                       
© 1998-2020Legal notice