HBVdb

Dataset for nucleotide sequence PreS1 of genotype B

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                 *               *    *     **       **  *      
ATGGGAGGTTGGTCTTCCAAACCTCGAAAAGGCATGGGGACAAATCTTTCTGTCCCCAATCCcCTGGGATTCTTcCCCGA
            a c  a         c             g     cg c           tt          t     
                                               g              a                 
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** **       *                              * *                                 
TCAtCAGTTGGACCCTGCATTCAAAGCCAACTCaGAaAATCCaGATTGGGACCTCAACCCgCACAAGGACAACTGGCCGG
c  c        t    tg           t  cacc     c        tt    t  at         ct     aa
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                    *     *                       *               *  *       *  
ACGCCAACAAGGTGGGAGTGGGAGCATTCGGGCCaGGgTTCAccCCtCCCCATGGGGGACTGTTGGGGTGGAGCCCTCAG
 tt  cgg          ca        t   ttg  ag  gtt  a  a  c     ct ag       at     a
                                              g  t                             c
                                              c                                 

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                      *         
GCTCAGGGCcTACTCACAACTGTGCCAGCAGCTCCTCCTCCTGCCTCCACCAATCGGCAGTcAGGAA---GGCAGCCTAC
     a   a gt tg  ta c     a ga a      t                    gtc  gc     a    a  
              a      a                                                          
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                 *                                                              
TCCCtTaTCTCCACCTCTAAGgGACACTCATCCT------CAGGCCATG---CAGTGGAACTCCACCACtTTCCACCAAA
a   c ga    g        a  tt g     a        a  ag a   agt     t  tc a ag  t  t   g
    a tw                                                             c          
      c                                                                         

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                        ** *** *       **           *        *  
CTCTTCAA---GATCCCAGAGTCAGGGCcCTGTACtTTCCTGCTGGTGGCTCCAGTTCAGGAACAGTgAgCCCTGCTCAG
    g tg     c  aca         t  a  tc c                      ag t   a a     t    
                                   y                                            
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *        *        *        *  ***  *   *     *    *      *     *    *  
AAtACTGtCTCTgCCATATCGTCAAtCTTATCGAAGACTGGGGACCCTGTACCGAACATGGAGAACATCGCATCAGGACT
 cct   ca  at   c   a    c  cc    c              cg     t            t         a
           gc               yg    m                                  a          
            a                                                                   

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       * *         *  *  *       *   *          *             *        * *    * 
CCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTtGTTGACAAAAATCCTCACAATACCACAGAGTCTAGACTCGT
   ca            ga                c  c                        g g              
                 c                    y                                         
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *      *       ** **                  *   *   *    *   * ** *   * ** *   * *  *
GGTGGACTTCTCTCAaTTTTCTAGGGGgAACACCCGTGTGTCTTGGCCAAAATTCGCAGTCCCAAATCTCCAGTCACTCA
               g           ag       a     c                    c        a       
               r           rc             g                                     
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *         ** *     ** **      *              ** *      * * *   **  * *  *   * 
CCAACcTGTTGTCCTCCaATTTGTCCTGGTTATCGCTGGATGTgTCTGCGGCGTTTTATCATCTTCCTCTGCATCCTGCT
 t   t           g c         c     t       a                  a     t           
                   y                       r                  m                 
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *          *  * *   *            *       **     **                    
GCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCATCAA
              c                        c                       cc          c  g 
                                                               g           g    
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *              **        ***        *          **        *   *  * *   *     **
CaACCAGCACCGGACCATGCAaAACCTGCACaACTCCTGCTCAAGGAACCTCTATGTTTCCCTCATGTTGCTGTACAAAA
 c        g   t      gg  a     gg ga      gc  c      tc                     c   
 g                             r                                                
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **              * *   ** ** * ** *     * *    **    *      *   **     **       
CCTACGGACGGAAACTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGCAAAATaCCTATGGGAGTGGGCCTCAGT
        t     t     t                 g  c          t     t                     
                                                                                
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * ***        *  **  * *   *       **       **   * *           *   *         * 
CCGTTTCTCTTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTCTGGCTTTCAGTTA
         a                  g                c              t   t             
                                                                                
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    **     * *   * **  *              *     *                         *         
TATGGATGATGTGGTtTTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTATgCCGCTGTTACCAATTTTCTTTTGT
c  t      a    ac     a g  aa    g     c     a   a     a           c       gc a 
                           r           y               r                    g   
                                                                                

      1210        
....:....|....:...
           *      
CTTTGGGTATACATTTAA
  c    c      c g 
                  
                  
© 1998-2020Legal notice