HBVdb

Dataset for nucleotide sequence P of genotype B

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                              * 
ATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAGA------CGAaGAgGCAGGTCCCCTAGAAGAAGAACT
----       c       g        g   g     a           ga c gt     a                 
                                                   c    c                       
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * ** * *              *       *            *                              *    
CCCTCGCCTCGCAGACGAAGGTCTCAATCGCCGCGTCGCAGAAGATCTCAATC------TCGGGA---ATCTCAATGTTA
     a              a        a            c  a  a               g    c ct       
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
              *  *  *            *          *           **       *   *          
GTATTCCTTGGACaCATAAGGTGGGAAACTTTACGGGGCTTTATTCTTCTACGGTACCTtgCTTTAATCCTaAaTGGCAA
a   c  g     t              t     t     c  c        t c   caa   c  c   gct      
             g                                      a     agt          c c      
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   **                 *       *   *              *          *   *  *            
ACTCCTTCTTTTCCTGACATTCATTTGCAGGAGGACATTGTTgATAGaTGTaAgCAATTTGTGGGgCCCCTtACAGTAAA
     c  c  c  ca t  a     aaga  aa t  ca  a    g   gca        a      c  cacg  
        g     a              t                     c                   a        
              g                                                                 

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *     *     *     ****        *     *          *  **        *    *     *
TGAAAacAGGAGACTAAAATTaATtATGCCTGCTAGgTTtTATCCcAATGTTACtAAATATTTGCCCTTAGATAAAGGgA
c  g ca  a   t t  g  g  c     c     a  c t   t cgacc  c     c  a  t  g  c     a 
     tt        g        a                       c g               a             
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*        * ** **                * **      *       *     ** *     *  *        *  
TcAAACCgTATTATCCAGAGcATGTAGTTAATCATTACTTcCAGACgcGACATTATTTACAcACTCTTTGGAAGGCGGGg
 t     t        c  at    g   g       t  t  a  aa g        g  t  c           a  t
       c                                                                       a
       a                                                                        

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *    **     * **  *          **    *         *          *** * **      *        
ATCTTATATAAAAGAGAGtCcACACGTAGCGCCTCATTTTGCGGGTCACCATATTCTTGGGAACAAGAtCTACAGCATGG
g a              aa a  g a   t  t     c at                       c  ga    t     
  t                 g                                                           
                    t                                                           

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                             *            *       *     **   *   **  *       *  
GAGGTTGGTCTTCCAAACCTCGAAAAGGCATGGGGACAAATCTTTCTGTCCCCAATCCcCTGGGATTCTTcCCCGATCAt
      c   c  a         c             g     c  c           tt        c t        c
                                           g              a                     
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *            *  *              * *                 *                   
CAGTTGGACCCTGCATTCAAAGCCAACTCaGAaAATCCaGATTGGGACCTCAACCCgCACAAGGACAACTGGCCGGACGC
        t     g           t  cacc     c        tt    t aat         ct        tt 
                                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                *     *                       *   *                             
CAACAAGGTGGGAGTGGGAGCATTCGGGCCaGGgTTCAccCCtCCCCATGGGGGACTGTTGGGGTGGAGCCCTCAgGCTC
 cgg          ca        t   ttg  ag  gtt  a  a  c     ct ag    a    at     a    
                                          g  t                             c    
                                          c                                     

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                               *                
AGGGCcTACTCACAACTGTGCCAGCAGCTCCTCCTCCTGCCTCCACCAATCGGCAGTcAGGAAGGCAGCCTACTCCCtTa
 a   a gt tg  ta c     a ga a      t                    gtc  gc  a    a  a   c g
          a      a                                                           a t
                                                                               c

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *                      *                                              
TCTCCACCTCTAAGgGACACTCATCCT------CAGGCCATG---CAGTGGAACTCCACCACtTTCCACCAAACTCTTCA
a    g        a  tt g     a        a  ag a   agt     t  tc a ag  t  t   g    g t
                                                              c     a           
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                *** *** *       **           *  **    *  *      
A---GATCCCAGAGTCAGGGCcCTGTACtTTCCTGCTGGTGGCTCCAGTTCAGGAACAGTgAgCCCTGcTCAGAAtACTG
g     c  aca         t     tc c                      ag t   a     t     cct   
                                                                                
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *        *        *        *  ***  *   *     *    *      *     *    *         
tCTCTgCCATATCGTCAAtCTTATCGAAGACTGGGGACCCTGTACCGAACATGGAGAACATCGCATCAGGACTCCTAGGA
ca  at   c   a    c  cc    c              cg     t          c t         a   ca  
    gc                g                                       a                 
     a                                                                          

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *   *     *  *  *       *   *          *             *        * *    *  *   * 
CCCCTGCTCGTGTTACAGGCGGGGTTTTTCTtGTTGACAAAAATCCTCACAATACCACAGAGTCTAGACTCGTGGTGGAC
          ga                c  c           c            g g                     
          c                    y                                                
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *       ** **                * *   *   * *  **  * ** *   * ** *   * *  *  *    
TTCTCTCAaTTTTCTAGGGGgAACACCCGTGTGTCTTGGCCAAAATTCGCAGTCCCAAATCTCCAGTCACTCACCAACcT
        g           ag       a     c                    c        a        t   t 
                    rc             g                                            
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     ** *     ** **    * **             ** *      * * *   *** * *  **  *        
GTTGTCCTCCaATTTGTCCTGGTTATCGCTGGATGTgTCTGCGGCGTTTTATCATCTTCCTCTGCATCCTGCTGCTATGC
          g c         c     t       a                  a     t                  
                                                                                
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *          *  * *   * *          *       ***    **                      *    
CTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCATCAACaACCAG
       c                    g   c                       cc          c  g  c     
                                                        g           g     g     
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          **        ***        * *        **        *   *  * *   *     ** **    
CACCGGACCATGCAaAACCTGCACaACTCCTGCTCAAGGAACCTCTATGTTTCCCTCATGTTGCTGTACAAAACCTACGG
   g   t      gg  a     gg ga      gc         tc                     c          
                                                                                
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         ** *   ** ** * ** *     * *    **    *      * * **     **         *****
ACGGAAACTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGCAAAATaCCTATGGGAGTGGGCCTCAGTCCGTTTC
 t     t     t                 g  c          t     t                            
                                                                                
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *  **  * *   *   *   **       **   * *           *   *         *     ** 
TCTTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTCTGGCTTTCAGTTATATGGAT
  a                  g                               t   t             cg t   
                                                                                
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * * *   * **  * *            *     *                         *  *             
GATGTGGTtTTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTATgCCGCTGTTACCAATTTTCTTTTGTCTTTGGG
   a    ac     a g  aa    g     c     a   a     a           c        g a   c    
                                                                     c t        
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *              *         * * * *  *     *         *                     *   
TATACATTTAAACCCTCAcAAAACAAAAAGATGGGGaTAtTCCCTTAAcTTCATGGGATATGTAATTGGgaGTTGGGGCA
c      c g  t     t     c   c t      c      c t  t     g   a t     at c     tt
                  g     g     g                                    tg       a 
                        t                                                       

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      * *     *           *                                         *  *  *    *
CaTTgCCaCAgGAACATATTGTacaaAAAATCAAAatgTGTTTTAGgAAACTT--CCTGTAAACAGgCCTATTGATTGGA
 c  a  c  ac c  c  ca gttg   c   c caa      caa             t  tc a           
 t     g              t cc       g tc                                           
       t                g                                                       

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      * *      *     *       **    *  ** ** **  * ** **  * *                  * 
AAGTaTGTCAACGAATTGTGGGTCTTTTGGGgTTtGCcGCcCCTTTcACgCAATGTGGaTATCCTGCTTTAATGCCTTTA
 g  g  c   a c     a  a   c a  a  c  t  t  c   a        t  c     cc g a      g
    c                                   a                 g                     
    t                                                     c                     

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*      *                *   *    ** *         *        *  *                     
TATGCATGTATACAAGCaAAACAGGCTTTTACTTTCTCGCCAACtTAcAAGGCCTTTCTaagtAAACAgTATCTGAACCT
        c  t  ct t     a     c     t  a  g  c  t        ct gcacc c  a   t  cc   
           c   a g                          g              ct    t      a  g    
                 c                                                              

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    **          **  *     *    *         *           * *****  * ** **   *    * *
TTACCCCGTTGCTCGGCAACGGcCtGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGtTGGGGCTTGGCCATaG
            g         t a     a                 t              c           t  c 
                                                                           a  t 
                                                                              g 

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * *   *        *             *           *                        * **  * * *
GCCATCAGCGCATGCGTGGaACCTTTGTGTCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCCGCTTGTTTTGCTCGC
           g    c  g              gt a  a        g        t  g  a  c          
                   c              a              c              t               
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*    *             *  * *   *    ** *   *  *     * *         *  *    *  *   *   
AGCaGGTCTGGgGCaAAACTcATCGGGACTGACAATTCTGTCGTgCTcTCCCGCAAgTATACATCaTTTCCATGGCTGCT
   c       a  g cc      a  c        g   c  t        a  c   c  c           
                                      c     a  a                 g              
                                            t  g                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **     *  * *    *         ** *  *  *        **  *           *  *           *  
AGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCCGCGGACGACCCCT
   a   a                a              c  c           a           t             
   t                                                                            
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*    *        *           *                 *     *         *          *    *   
CCCGGGGCCGCTTGGGGCTCTACCGCCCGCTTCTCCGcCTgttGTACCGACCGACCACGGGGCGCACCTCTCTTTACGCG
 t     t     a     t           c     t  accc tt ag  at t        t               
 a                 g                    cg       t                              
                                        t                                       

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *   **       **     **          * ***         *   *         **           
GACTCCCCGTCTGTGCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGCACGTCGCATGGAgACCACCGTG
 t                 t  g  ca    t                                 g    a       --
 c                             g                                                
                               c                                                

 
.
 
A
-
 
 
© 1998-2020Legal notice