HBVdb

Dataset for nucleotide sequence Genomes of genotype B

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                           *** *** *       **   
CTCCACCACtTTCCAcCAAACTCTTCAA---GATCCCAGAGTCAGGGCcCTGTACtTTCCTGCTGGTGGCTCCAGTTCAG
t  tc a ag  t  t   g c  g  g     c  acag        t     tc c                      
         c     a                                a                               
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *  **    *  *        *        *        *        *  ***  *   *     *    *
GAACAGTgAgCCCTGcTCAGAAtACTGtCTCTgCCATATCGTCAAtCTTaTCGAAGACTGGGGACCCTGTaCCGAACATG
ag tc  a     t     cct   ca  at   c   a    c  ccc   c              cg     t   
                     t         gc                g                              
                                a                                               

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *     *    *         * *   *  *  *  *  *       *   *          *           
GAGAACATCGCATCAGGACTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTtGTTGACAAAAATCCTCACAAT
       c t         a   ca            ga                   c           c         
         a                                                                    
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *        * *    *  *   *  * *     ** **                * *   *   * *  **  * **
ACCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAaTTTTCTAGGGGgAACACCCGTGTGTCTTGGCCAAAATTCGCAGT
   g                               g           agc      a     c                 
                                                c             g                 
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *   * ** *   * *  *  *         ** *     ** **    * **             ** *      * *
CCCAAATCTCCAGTCACTCACCAACcTGTTGTCCTCCaATTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATC
   c        a        t   t          ag c         c     t       a                
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *   *** * * ***  *     *     *          *  * *   * *          *       ***    * 
ATCTTCCTCTGCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCC
  a     t                                                  c                    
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                      *              **        ***        * *        **        *
TCTAATTCCAGGATCATCAACaACCAGCACCGGACCATGCAaAACCTGCACaACTCCTGCTCAAGGAACCTCTATGTTTC
   cc          c  g  c     t  g  gt      gg  a     gg ga      gc  c a    tc     
   g           g     g                                 t                        
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **  * *   *     ** **             ** *   ** ** * ** *     * *    **    *      
CCTCATGTTGCTGTACAAAACCTACGGACGGAAACTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGCAAAATAC
              c       t   t     t                          c                t 
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* * **     **         *****        *  **  *     *   *   **       **   * *       
CTATGGGAGTGGGCCTCAGTCCGTTTCTCTTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCC
                             a                  g                             
                                                  c                             
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *   *         *      *   * * *   * **  * *   *        *     *               
CACTGTCTGGCTTTCAGTTATATGGATGATGTGGTtTTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTATgCCGC
  t   t             cg t      a t  ac     a g  aa    g     c     a   a     a    
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *      *  *                 *              *         * * * *  *     *        
TGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAAACCCTCAcAAAACAAAAAGATGGGGaTAtTCCCTTAAcTTCA
       c       gg a   c    c      c g  t   a t     c   c t      c      c t  t 
                c t                          g     g     g                    
                                                   t                            

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *                     *         * *     *           *                          
TGGGATATGTAATTGGgaGTTGGGGCACaTTgCCaCAgGAACATATTGTacaaAAAATCAAAatgTGTTTTAGgAAACTT
    g   a t     at c     tt c  a  c  ac c  c  ca gttg   c   c caa      caa  g   
                tg       a  t     g              t cc       g tc                
                                  t                g                            

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *           *  *  *    *      * *      *     *       **    *  ** ** **  * ** **
CCTGTAAACAGgCCTATTGATTGGAAaGTaTGTCAACGAATTGTGGGTCTTTTGGGgTTtGCcGCcCCTTTcACgCAATG
     t  tc a            g  g  c   a c     a  a   c a  a  c  t  t  c   a     
                             c                                   a              
                             t                                                  

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * *                  * *      *                *        ** *         *        
TGGaTATCCTGCTTTAATGCCTTTATATGCATGTATACAAGCaAAACAGGCTTTTACTTTCTCGCCAACTTAcAAGGCCT
   t  c     cc gca      g        c  t  ct tcg   a     c     t  a  g  g  t     t 
   g                                c   a g                       c             
   c                                      c                                     

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *                   *     **        * **  *     *    *         *          ** 
TTCTaagtAAACAgTATCTGAACCTTTACCCCGTTGCTCGGCAACGGcCtGGTCTGTGCCAAGTGTTTGCTGACGCAACC
 ct gcacccc  a   t  cc               c         t a     a                 t      
    ct           a  g                g                                          
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*****  * ** **   *    * *     *   *        *             *      *    *          
CCCACTGGtTGGGGCTTGGCCATaGGCCATCAGCGCATGCGtGGaACCTTTGTGTCTCCTCTGCCGATCCATACTGCGGA
        c           t  c            g    c  g              gt a  a        g     
                    a  t                    c              a     t        c     
                       g                                                        

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       **     * **  * * **    *             *  * *   *    ** *   *  *    ** *   
ACTCCTAGCCGCTTGTTTTGCTCGCAGCaGGTCTGGgGCaAAACTcATCGGGACTGACAATTCTGTCGTgCTcTCCCGCA
   t  g  t  c             c       a  g cc      a  c     c  g   c  t     t 
         a                                                     c     a  g     g 
                                                                     t  a     a 

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *  *    *  *   *    ** *   *  * *    *         ** *  *  *         *  * *  
AgTATACATCaTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCG
 a  c   g  c              t   a             a  a              c  c        c  a
          c                 a                                                   
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *  *           *       *        *           *                 *     *    
GCGCTGAATCCCGCGGACGACCCCTCcCGGGGCCGCTTGGGGCTCTACCGCCCGCTTCTCCGcCTgttGTACCGACCGAC
           t              t     t   c a     t  t  t     c     t  accc tt ag  at 
                          a                 g                    cg       t     
                                                                 t              

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *          *    *  *       *   **       **     **          * **          * 
CACGGGGCGCACCTCTCTTTACGCGGACTCCCCGTCTGTGCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTC
t        t                t                 t  gc ca    t                       
                          c                             g                       
                                                        c                       

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
            **           *                                    *                 
TGCACGTCGCATGGAgACCACCGTGAACGCCCACcGG---------AACc------------TGCCCAAG----------
               a            a   cta a          ctt              a a c           
                                 ag                                             
                                  t                                             

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                               *                               *
--------------------G------------------------TCTTgCATAAGAGGACTCTTGGACTTTCAGCAATG
                                                 at  c a      a       c tt t    
                                                                      g         
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *   *   *        *      *             *             *                   
TCAACGACCGACCTTGAGGCATACTTCAAAGACTGTGTGTTTAcTGAGTGGGAGGAGTTGGGGGAGGAGaTtAGGTTAAa
g   ta                                a   gag          tacc      a  agcg  a    t
                                            c                        c c        
                                                                     t          

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                      *                                                         
GgT--C---TTTGTAcTAGGAGGCTGTAGGCATAAATTGGTgTGTTCACCA-----------------------------
 a   t    a    t g                       cc cc                                  
                                             g                                  
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                         *  *  *
-------------------------------GCACCATGCAACTTT---TTCACCTCTGCCTAATCATCTCaTGTTCATG
                               t        g                      g       t        
                                                                       c        
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   *      *  *           * *     **   *     *  *                               
TCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTgGGgCATG-------------------------------
   c   t                                 a  a                                   
       a                                                                        
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *  *              * *    *  *              *                **             
-----GACATTGACcCgTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTC------TTTTTTGCCTTCTGACTTCTTT
          c   aat               ca  ac                     c  a  gga   t  t   
                c                 a    g                            a           
                                                                    c           

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**                 *                                *  *     *    **     *      
CCTTCtaTTCGAGATCTcCTCGACACCGCCtCTGCTCTGTATCGGGAGGCCTTAGAGTCTCCGGAACATTGTTCACCTCA
  gaagg g  g  c  t  a  t     taac  ct act a    a  t     a     t  g  c  ca gga   
     c           g           ag                                            t    
                 a                                                              

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *   * *                     * ***       *        *        *          **        
CCATACGGCACTCAGGCAAGCTATTcTGTGTTGGGGTGAGTTgATGAATCTAGCCACCTGGGTGGGAAGTAATTTGGAAG
t  c  a  ga          ag cg a  c    ag  a  a    c t g  tt          tgac     ac c 
         t           c   t c       ta                 a           c           t 
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
               *                                     *        *                 
AtCCAGCATCCAGGGAaTTAGTAGTCaGCTATGTCAAcGTTAATATGGGCCTAAAAaTCAGACAAcTATTGTGGTTTCAC
 c a   g  tc a  tccga    tgat     t  tac   c     at    gc t  g   t    a        t
       c        cg       a                       ta     t        a              
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                               *     * *        *  *  *                         
ATTTCCTGTCTTACTTTTGGgAGAGAAACTGTTCTTGAATATTTGGTGTCTTTTGGAGTGTGGATTCGCACTCCTCCTGC
g    t   a c tc     a a   cgtg     c  g        c  c     g              a  catcc 
c             g           t                    a                           t    
                                                                           g    

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **    *         *   * *          ****   *   *          *                 **    
ATATAGACCACcAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAGA------CGAaGAGGCAGGTCCC
c  c     gga             c    c  g        g   g     a           ga c gt     a   
t        t                                                       c    c         
                                                                                

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  *  *    * ** ** * *  *           *       *         *  *                     
CTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCTCAATCgCCGCGTCGCAGAAGATCTCAATCTCGGGA---ATCT
                   a              a        a                a         g    c c
                                                                                
                                                                                

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *                  *  *  *            *        * *           **       *   *  
CAATGTTAGTATTCCTTGGACaCATAAGGTGGGAAACTTTACGGGGCTTTATTCTTCTACGGTACCTtgCTTTAATCCTa
t       a   c  g  c  t    ga        t  cg t     c  c        t c   gaa      c   g
                     g                                      a     cgt          c
                                                                  a             

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
           **       *         *       *   *              *          *   *  *    
AaTGGCAAACTCCTTCTTTTCCTGACATTCATTTGCAGGAGGACATTGTTgATAGaTGTaAgCAATTTGTGGGgCCCCTt
ct           c  c  c  aa t  a     aaga  aa t  ca ca    g   gca        a   t  c
 c              g     c              t                     c                 a
                      g                                                       

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                *     *     *    *****        *     *          *  **            
ACAGTaAATGAAAacAGGAGACTAAAATTaATtATGCCTGCTAGgTTtTATCCcAAtGTTACtAAATATTTGCCCTTAGA
  cacg  c  g ca  a   t t     g  c     c     a  c t   t cgacc  c     c  a  t  g  
     t       tt        g        a                       ccg               a     
                                                                                

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *     **        * ** **                * **      *  *    *     ** *     *  *   
TAAAGGgATcAAACCtTATTATCCAGAGcATGTAGTTAATCATTACTTCCAGACgaGACATTATTTACAcACTCTTTGGA
c     a  t     g        c  at cacg   g       t  t   ac g        g  t tc  g    
      c        c        t                             t                         
               a                                                                

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *   *    **     * **  *          **    *         * *     *  ***   **      *
AGGCGGGtATCTTATATAAAAGAGAGtCcACACGTAGCGCCTCATTTTGcGGGTCACCATATTCTTGGGAACAAGAtCTA
    a  gg t        g     aa a  g ac  t  t     c at                       c  ga  
    t  a  a                 g                                                   
                            t                                                   

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                     *            *  * *  *     **   *   **  *  
CAGCATGGGAGGTTGGTCTTCCAAACCTCGAAAAGGCATGGGGACAAATCTTTCTGTCCCCAATCCcCTGGGATTCTTcC
  t           c   c  ac        c             g  c   c           tt        c 
                                                                  a             
                                                                  g             

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     ** **       *            *  *              * *        *       **           
CCGATCAtCAGTTGGACCCTGCATTCAAAGCCAACTCaGAaAATCCaGATTGGGACCTCAAcCCgCACAAGGACAACTGG
       c        t  a  g     g     t  ca c     c        tt    t aat       ttct   
                                                                                
                                                                                

      3210      3220      3230      3240      3250      3260      3270      3280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                        *     *         *       *     *   *           *  *     *
CCGGACgCCAACAAGGTGGGAGTGGGAGCATTCGGGCCaGGgTTCAccCCtCCCCATGGGGGaCTGTTGGGGTGGAGCCC
  a  tt  cgg          ca        t   ttg  ag  gtt  a  t  c     ct a        at  
                                                  g  a                          
                                                  c                             

      3290      3300      3310      3320      3330      3340      3350      3360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *     *                                                               *     *  
TCAgGCTCAGGGCaTACTCACAACTGTGCCAGCAGCtCCTCCTCCTGCCTCCACCAATCGGCAGTcAGGAAGGCAGCCTA
   a     a   c gt tg  ta c     a ga a      t                    gtc cgc  ac   
   c              a      a                                                      
                                                                                

      3370      3380      3390      3400      3410      3420 
....:....|....:....|....:....|....:....|....:....|....:....|.
      *           *                      *                   
CTCCCtTaTCTCCACCTCTAAGgGACACTCATCCT------CAGGCCATG---CAGTGGAA
    tc ga    g        a  tt g     a        a  ag a   agt     
     a t                                                     
       c                                                     
© 1998-2022Legal notice