HBVdb

Dataset for nucleotide sequence Genomes of genotype B

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
           *             *                                 *** *** *    *  **   
CTCCACCACtTTCCAcCAAACTCTTCAA---GATCCCAGAGTCAGGGCcCTGTACtTTCCTGCTGGTGGCTCCAGTTCAG
t  tc   ag  t  t   g    g  g     c  acag        t     tc c                      
         c     a                                a                               
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *  **    *  *        *       **        *        *  **** *   *    **  * *
GAACAGTgAgCCCTGcTCAGAAtACTGtCTCTgCCATATCGTCAAtCTTATCGAAGACTGGGGACCCTGTaCCGAACATG
ag t   a     t     cct   ca  at   c   a    c  ccc   c              cg     t   
                               gc                                               
                                a                                               

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*     *     *    *         * *   *  *  *  * ** *     *   *        * *   *    *  
GAGAACATCGCATCAGGACTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTtGTTGACAAAAATCCTCACAAT
    c  c t         a   ca            ga                   c           c         
         a                                                                    
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **        * *    *  *  **  * *  *  ** ** *              * *   *** * *  **  * **
ACCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAaTTTTCTAGGGGgAACACCCGTGTGTCTTGGCCAAAATTCGCAGT
   g                               g           ag       a     c                 
                                                c             g                 
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ** ** **  * *  ** *       * ** *     ** ***** ****    *        ****      * *
CCCAAATCTCCAGTCACTCACCAACcTGTTGTCCTCCaATTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATC
   c               t   t           g c         c     t       a                
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *   *** * * ***  *     *     *    *     *  * *   *** *     *  **      ***   ***
ATCTTCCTCTGCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCC
  a     t                                                  c                    
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                      ** *           ***       ****       * **       **        *
TCTAATTCCAGGATCATCAACaACCAGCACCGGACCATGCAaAACCTGCACaACTCCTGCTCAAGGAACCTCTATGTTTC
   cc          c  g  c     t  g   t      gg  a     gg ga      gc  c      tc     
               g     g                                                          
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ** ** *   *     ** **  *          ** *   ************     * *  * **  * *     *
CCTCATGTTGCTGTACAAAACCTACGGACGGAAACTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGCAAAATAC
                c           t     t                          c                t 
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* * **     **  * *  * *****        *  **  ****  *   *   **   **  **  ** *      *
CTATGGGAGTGGGCCTCAGTCCGTTTCTCTTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCC
                             a                  g                           
                                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *   ***       *     **   * * **  * *** * *   *    *  **    **     *         
CACTGTCTGGCTTTCAGTTATATGGATGATGTGGTtTTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTATgCCGC
  t   t             cg t  c   a t  ac     a g  aa    g     c     a   a     a    
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *      *  *       *         *         *    *         * *****  *     *  *    *
TGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAAACCCTCAcAAAACAAAAAGATGGGGaTAtTCCCTTAAcTTCA
       c        g a   c    c      c g  t  aa t     c   c t      c      c t  t 
                c t                          g     g     g                    
                                                   t                            

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * *       *  *        *   *    ** *     *           **                         
TGGGATATGTAATTGGgaGTTGGGGCACaTTgCCaCAgGAACATATTGTacaaAAAATCAAAatgTGTTTTAGgAAACTT
    g   a t     at c     tt c  a  c  ac c  c  ca gttg   c tcc caa      caa      
                tg       a  t     g              t cc       g tc                
                                  t                g                            

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *           *  * **  ****     * *      *     *       **    *  ** ** **  * ** **
CCTGTAAACAGgCCTATTGATTGGAAaGTaTGTCAACGAATTGTGGGTCTTTTGGGgTTtGCcGCcCCTTTcACgCAATG
     t  tc a            g  g  c   a c     a  a   c a  a  c  t  t      a     
                             c                                   a              
                             t                                                  

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** *                  * **     *                *   *    ** *         *        
TGGaTATCCTGCTTTAATGCCTTTATATGCATGTATACAAGCaAAACAGGCTTTTACTTTCTCGCCAACTTAcAAGGCCT
   t  c     cc g a      g        c  t  ct tcg         c     t  a  g  g  t       
   g                                c   a g                                     
   c                                      c                                     

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *                   *  *  **        * ** **     *    *    *    *    *     ** 
TTCTaagtAAACAgTATCTGAACCTTTACCCCGTTGCTCGGCAACGGcCtGGTCTGTGCCAAGTGTTTGCTGACGCAACC
 ct gcacc c  a   t  cc               g         t a     a                 t      
    ct    t      a  g                                                           
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*****  * *****   *    * *   * *  **        *    **       *      *    *          
CCCACTGGtTGGGGCTTGGCCATaGGCCATCAGCGCATGCGTGGaACCTTTGTGTCTCCTCTGCCGATCCATACTGCGGA
        c           t  t   t        g    c  g              gt a  a        g     
                    a  c                    c              a              c     
                       g                                                        

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       **  * ** **  * * **    *      *      *  * **  *    ** *   *  *    ** *   
ACTCCTAGCCGCTTGTTTTGCTCGCAGCaGGTCTGGgGCaAAACTcATCGGGACTGACAATTCTGTCGTgCTcTCCCGCA
   t  g   c             c       a  g cc       c        g   c  t     t 
                                                             c     a  a       
                                                                     t  g       

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *  *    *  *** *    ** *   * ** *   **         ** *  *  *     *  **  * *  
AgTATACATCaTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCG
 a  c   g  c              t   a                a              c  c           a
          c                                                                     
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * *  ****      * *  *  *    *      * **          *                 *     **   
GCGCTGAATCCCGCGGACGACCCCTCCCGGGGCCGCTTGGGGCTCTACCGCCCGCTTCTCCGcCTgttGTACCGACCGAC
           t              t     t     a     t           c     t  accc tt at  at 
                          a                 g                    cg       g     
                                                                 t              

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    **          *  * *  *    * **   **     * **     ****     ** * ***         * 
CACGGGGCGCACCTCTCTTTACGCGGACTCCCCGTCTGTGCCTTCTCATCTgCCGGACCGTGTGCACTTCGCTTCACCTC
t        t                t                 t  gc ca    t                       
         a                c                             g                       
                                                        c                       

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *         **    * *    *                           *       *                  
TGCACGTCGCATGGAgACCACCGTGAACGCCCACcGGAACc------------TGCCCAAGG------------------
               a            a   cta a  tt              a a c                    
                                 ag                                             
                                  t                                             

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *                               *        *   *  **        * *    * *    
------TCTTgCATAAGAGGACTCTTGGACTTTCAGCAATGTCAACGACCGACCTTGAGGCATACTTCAAAGACTGTGTG
          at  c a              c tt t    g   ta                                a
                               g         c                                      
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      **  **         *                                         *                
TTTAcTGAGTGGGAGGAGTTGGGGGAGGAGaTtAGGTTAAaGgT--C---TTTGTAcTAGGAGGCTGTAGGCATAAATTG
   gag          tac       a  agcg  a    t a   t    a    t g                     
     c                        c c                                               
                              t                                                 

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                 *   ***           *  *  ***  *      *  *       
GTgTGTTCACCAGCACCATGCAACTTTTTCACCTCTGCCTAATCATCTCaTGTTCATGTCCTACTGTTCAAGCCTCCAAG
  cc cc     t        g                   g       t           c   t           g  
      g                                          c                              
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    * *     **   *   * *  *                                    *  *  *      **  
CTGTGCCTTGGGTGGCTTTgGGgCATG------------------------------------GACATTGACcCgTATAA
                   a  a                                             c   aat     
                                                                          c     
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * *   **  *              *          **  * **             **                 *  
AGAATTTGGAGCTTCTGTGGAGTTACTCTC------TTTTTTGCCTTCTGACTTCTTTCCTTCtaTTCGAGATCTcCTCG
            aa  ac                      a  gg    t  t a   gaagg g  g  c  t  
                 g                            a                c           g    
                                                                           a    

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *                          *  *     *    **     *       *   * *              
ACACCGCCtCTGCTCTGTATCGGGAGGCCTTAGAGTCTCCGGAACATTGTTCACCTCACCATACGGCACTCAGGCAAGCT
     taac  ct act      a  t     a     t        ca gga   t  c  a  ga          a
       ag                               c            t             t            
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       * ***       *        *        **         **                 *     *      
ATTcTGTGTTGGGGTGAGTTgATGAATCTAGCCACCTGGGTGGGAAGTAATTTGGAAGAtCCAGCATCCAGGGAatTAGT
g cg a  c    ag  a  a    c t g  tt          tgac     ac c  c a   g  tc a  tccga 
   t c       t           g      a           c           t        c        cg    
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *                      **     *        **         *    *    **     *     *     
AGTCaGCTATGTCAAcGTTAATATGGGCCTAAAAaTCAGACAAcTATTGTGGTTTCACATTTCCTGTCTTACTTTTGGgA
   tgat     t  tac   c     at    gc t  g   t    a        tc    t   a c tc     a 
   a                       ta     t        a              g             g       
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *    ** *   * *  ** *  *      ** *                ** *  **     ** *  **
GAGAAACTGTTCTTGAATATTTGGTgTCTTTTGGAGTGTGGATTCGCACTCCTCCTGCATATAGACCACcAAATGCCCCT
a   cgtg     c    t      c  c     g              a  catcc c  c     gga          
    t                    a                           t    t        tt           
                                                     g                          

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  *  *    ****   *   *    *   * *               * **     *  *  * *  * ** ** * 
ATCTTATCAACACTTCCGGAAACTACTGTTGTTAGA------CGAaGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCC
   c    c  g        g   g  a  a           ga c gt     a                      a  
                                           c    c                               
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *           *       *      *  *  *          *             *         *   *    
TCGCAGACGAAGGTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGA---ATCTCAATGTTAGTATTCCTTGGACa
            a        a             a  a         g    c c        a   c  g     t
                                                                               g
                                                                                

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** *  * *   *      *  *     * *           **    *  *   *     **    * **       * 
CATAAGGTGGGAAACTTTACGGGGCTTTATTCTTCTACGGTACCTtgCTTTAATCCTaAaTGGCAAACTCCTTCTTTTCC
  c           t  cg     c  c        t c   caa      c   gct           c  c  c  
                                      a      gt          c c              g     
                                                                                

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *       *   *  *          **          *  **  *  *                 *     
TGACATTCATTTGCAGGAGGACATTGTTgATAGaTGTaAgCAATTTGTGGGgCCCCTtACAGTAAATGAAAacAGGAGAC
ca t  a     aaga  aa  ca  a    g   gca        a      c  cacg  c  g ca  a   t
a              t                     c                   a             tt       
g                                                                               

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*     *    *****       **     *          *  **        *    *   * **        * ** 
TAAAATTaATtATGCCTGCTAGgTTtTATCCcAATGTTACtAAATATTTGCCCTTAGATAAAGGgATcAAACCgTATTAT
 t     g  c     c     a  c t   t cgacc  c     c  a  t  g  c     a  t     t      
 g        a                       c                 a     a              c      
                                                                         a      

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**                * **  **  *  *    *  ** ** *     *  **       **  *    **     *
CCAGAGcATGTAGTTAATCATTACTTCCAGACgaGACATTATTTACAcACTCTTTGGAAGGCGGGtATCTTATATAAAAG
  c  at    g   g       t    ac g        g  t  c           a  gg a           
                                                                  t           
                                                                                

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **  *          **  * *         * *     *  *** * **      **                     
AGAGtCcACACGTAGCGCCTCATTTTGCGGGTCACCATATTCTTGGGAACAAGAtCTACAGCATGGGAGGTTGGTCTTCC
   aa a  g a   t      c at                       c  ga    t           c   c  a
      g                                                                         
      t                                                                         

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *     *  *            *  * *  *     **   *   **  *       ** **   *   *    
AAACCTCGAAAAGGCATGGGGACAAATCTTTCTGTCCCCAATCCcCTGGGATTCTTcCCCGATCAtCAGTTGGACCCTGC
         c             g      c           tt          t        c        t     
                                          a                                   
                                                                                

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *     *  *          *   * * *      *       **   *                             
ATTCAAAGCCAACTCaGAaAATCCaGATTGGGACCTCAACCCgCACAAGGACAACTGGCCGGACgCCAACAAGGTGGGAG
    g     t  c  c     c        tt    t aat         ct        tt  cgg          
                                                                                
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **    *         *       *     *   *           *  *     * *     *              
TGGGAGCATTCGGGCCaGGgTTCAccCCtCCCCATGGGGGACTGTTGGGGTGGAGCCCTCAgGCTCAGGGCaTACTCACA
ca        t   ttg  ag  gtt  a  a  c     ct a        at  c  a     a   c gt tg  
                            g  t                             c              a   
                            c                                                   

      3210      3220      3230      3240      3250      3260      3270      3280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *                                         *     *     *  *           *   
ACTGTGCCAGCAGCTCCTCCTCCTGCCTCCACCAATCGGCAGTcAGGAAGGCAGCCTACTCCCtTaTCTCCACCTCTAAG
ta c     a ga a      t                    gtc  gc  a    a     tc ga    g        
   a                                                           a t              
                                                                 c              

      3290      3300      3310         
....:....|....:....|....:....|....:....
                   *                   
gGACACTCATCCT------CAGGCCATG---CAGTGGAA
a  tt g     a        a  ag a   agt     
                                       
                                       
© 1998-2020Legal notice